JN Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Neurophysiol 77: 484-490, 1997;
0022-3077/97 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Verdru, P.
Right arrow Articles by Callewaert, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Verdru, P.
Right arrow Articles by Callewaert, G.

The Journal of Neurophysiology Vol. 77 No. 1 January 1997, pp. 484-490
Copyright ©1997 by the American Physiological Society

Na+-Ca2+ Exchange in Rat Dorsal Root Ganglion Neurons

P. Verdru, C. De Greef, L. Mertens, E. Carmeliet, and G. Callewaert

Laboratorium voor Fysiologie, Katholieke Universiteit Leuven, Campus Gasthuisberg, B-3000 Leuven, Belgium

    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

Verdru, P., C. De Greef, L. Mertens, E. Carmeliet, and G. Callewaert. Na+-Ca2+ exchange in rat dorsal root ganglion neurons. J. Neurophysiol. 77: 484-490, 1997. The role of the Na+-Ca2+ exchanger was examined in isolated rat dorsal root ganglion (DRG) neurons. Neurons were dialyzed with the Ca2+ indicator Indo-1. Ca2+ transients were elicited by depolarizing the cells from -80 to 0 mV for 100 ms under voltage clamp conditions. In most cells (45 of 67), the decay of intracellular Ca2+ concentration ([Ca2+]i) could be fitted with a single exponential with a time constant of 2.43 s. In the remaining 22 cells, the decay of [Ca2+]i could be described with a double exponential with time constants of 0.76 and 11.84 s. In cells that displayed a biphasic [Ca2+]i relaxation, Na+-free medium caused resting [Ca2+]i to increase from 116 to 186 nM; the slow component of recovery to basal [Ca2+]i was nearly abolished in Na+-free medium or by application of 5 mM Ni2+. In 35 of 45 cells displaying a monophasic [Ca2+]i decay, omitting external Na+ increased the time constant of [Ca2+]i decay from 2.02 to 3.63 s. In the remaining 10 cells, Na+-free solution did not affect Ca2+ handling. The time constant of [Ca2+]i relaxation was voltage dependent. These findings demonstrate the important role of the Na+-Ca2+ exchanger in DRG neurons. Its presence was further confirmed both at the mRNA and the protein level.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

The presence of a Na+-dependent Ca2+ transport mechanism is well established in many cell types. In cardiac myocytes and retinal rods (for review see Philipson and Nicoll 1992), the Na+-Ca2+ exchanger has been described to be the dominant Ca2+ efflux pathway. Little is known about the expression of the Na+-Ca2+ exchanger in neurons. The Na+-Ca2+ exchanger has been reported to be important for removing Ca2+ from synaptosomes (Blaustein 1988). Moreover, during anoxia it could mediate Ca2+ influx in mammalian CNS white matter, thus causing deleterious effects (Stys et al. 1991). In addition, glutamate neurotoxicity has been partly explained by reduced Ca2+ efflux via the Na+-Ca2+ exchanger due to a breakdown of the Na+ gradient (Kiedrowski et al. 1994). In dorsal root ganglion (DRG) neurons, its importance for the regulation of intracellular Ca2+ concentration ([Ca2+]i) has been questioned. In rat DRG cells, removing external Na+ had no effect on resting [Ca2+]i and the relaxation following a Ca2+ load was only slightly affected or not affected (Benham et al. 1992; Thayer and Miller 1990). In mouse DRG neurons, resting [Ca2+]i was Na+ dependent, but omitting Na+ had little effect on the handling of Ca2+ loads (Duchen et al. 1990).

We investigated both the function and presence of the Na+-Ca2+ exchanger in rat DRG neurons by the use of electrophysiological and molecular biological techniques. We demonstrate an important role for the Na+-Ca2+ exchanger in these neurons.

    METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Cell isolation

DRG cells were isolated from adult rats according to the procedure described by Delree et al. (1989). In contrast with this method, however, pooled cell suspensions were not filtered. Immediately after isolation, only DRG neurons and no other cell types could be visualized. Cells were used for experiments 24-48 h after isolation. This short period avoided the growth of dendrites, which would complicate efficient voltage clamping. The mean diameter of the cells used for patching was 32 ± 1 (SE) µm. DRG neurons used for mRNA extraction were stored at -80°C immediately after isolation; neurons used for immunocytochemistry were fixed immediately after plating.

Electrophysiological experiments

SOLUTIONS. The pipette solution contained (in mM) 120 CsCl, 1 MgCl2, 10 N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), 2 Na2ATP, and 0.1 K5Indo-1, pH adjusted to 7.3 with NaOH, giving a free Na+ concentration of 10.7 mM. The external solution contained 130 mM NaCl, 2 mM CaCl2, 10 mM HEPES, 1 mM MgCl2, 5 mM KCl or CsCl, 10 mM glucose, and 1.5 µM tetrodotoxin, pH adjusted to 7.3 with NaOH. Na+-free solution was prepared by replacing NaCl with isotonic tetraethylammonium (TEA) chloride or LiCl; pH was then adjusted with the use of TEAOH or LiOH, respectively. All experiments were performed at room temperature (21-23°C).

CURRENT MEASUREMENTS. Currents were recorded with the use of a List EPC-7 amplifier. The whole cell configuration of the patch clamp was used. Pipettes had a resistance of 2.5 MOmega . Experiments were performed 3-5 min after breaking into the cells, allowing sufficient loading with Indo-1.

FLUORESCENCE MEASUREMENTS AND ESTIMATION OF [Ca2+]i. The optical system was built around a Nikon TMD inverted microscope as described previously (Callewaert et al. 1991). [Ca2+]i was estimated from Indo-1 fluorescence by the ratio method with the use of single excitation (360 nm) and dual emission (405 and 485 nm) (Grynkiewicz et al. 1985). In brief, background fluorescence was measured in the cell-attached mode at both emission wavelengths. After subtraction of the background, fluorescence signals obtained in the whole-cell mode were used to give the 405 nm:485 nm ratio (R). The value of R was an estimate of [Ca2+]i according to the following equation (Grynkiewicz et al. 1985)
[Ca<SUP>2+</SUP>]<SUB>i</SUB> = <IT>K</IT><SUB>d</SUB>⋅β⋅(<IT>R − R</IT><SUB>min</SUB>)/(<IT>R</IT><SUB>max</SUB> − <IT>R</IT>)
Rmin and Rmax are the limiting ratios obtained in the absence of Ca2+ and at saturating Ca2+. beta  is the ratio of the fluorescence signal at 485 nm in the absence of Ca2+ and at saturating Ca2+. With the same method as previously described (Callewaert et al. 1991), Rmax, Rmin, and beta  were determined within DRG neurons. The dissociation constant (Kd) was assumed to be 213 nM (Benham 1989).

PERFUSION SYSTEM. A fast perfusion system was used, allowing fast (±100 ms) application of different external solutions (Callewaert et al. 1989).

DATA ACQUISITION AND ANALYSIS. Data were stored on an IBM-compatible PC with the use of PClamp software. Home-made software was used for calculating [Ca2+]i. The time constants of recovery to basal [Ca2+]i were fitted to the data by computer with the use of a nonlinear least-squares fitting routine based on the Levenberg-Marquardt algorithm. As a first approximation, a single-exponential model was used to fit the data. The goodness of fit was judged by the value of chi 2 and the number of runs. In many cells, chi 2 or the number of runs was not significantly improved by fitting the data with a double-exponential model, or the time constants of the two components were similar. These cells were classified as cells displaying monophasic [Ca2+]i decay. However, in a large group of cells, a much better fit was obtained by the use of a double-exponential model, yielding time constants for the two components that were well separated. These cells were classified as cells displaying biphasic [Ca2+]i decay.

Results are expressed as means ± SE. Unless mentioned otherwise, Student's t-test for paired or unpaired data was used to determine the significance of the differences of the mean [Ca2+]i or time constants.

Reverse-transcriptase polymerase chain reaction (PCR)

Poly(A)+-RNA was isolated from ~2.105 cells with the use of the Micro-FastTrack mRNA Isolation Kit (Invitrogen) according to the manufacturer's instructions. Reverse transcription was performed on 1/10 of the obtained poly(A)+-RNA in an oligo(dT)-primed reaction with the use of 200 ng oligo(dT)15 primer (Boehringer Mannheim) and 200 U Moloney-murine leukemia virusreverse transcriptase (Gibco BRL) in a final volume of 20 µl containing 50 mM tris(hydroxymethyl)aminomethane/HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 1 mM 1,4-dithiothreitol (DTT), 0.5 mM of each deoxynucleoside triphosphate (dNTP), and 40 U rRNasin (Promega).

Aliquots of the first strand reaction mixture (4 µl) served as templates for the PCR amplification. The reaction mixture (50 µl) consisted of commercially supplied buffer (high Mg2+, Amersham), 200 µM of each dNTP, 0.5 µM of each primer, and 0.5 U GoldStar DNA polymerase (Eurogentec, Liège, Belgium). Denaturation of the samples occurred at 94°C for 2 min, followed by 30 cycles of 1 min of denaturation at 94°C, 1 min of primer annealing at 57 or 65°C for the first and second set of primers, respectively, and 1 min of synthesis at 72°C. Aliquots of the PCR products (10 µl) were run on a 6% nondenaturing polyacrylamide gel and visualized by ethidium bromide staining.

Two sets of primers were used. The first one amplifies a fragment of equal length (224 bp) of both rat brain isoforms described by Furman et al. (1993) and consists of the sense strand primer GAACAGTTCAAAGTGTCCCCTGG (residues 2692-2714 and 2772-2794 of mRNA I and II, respectively) and the antisense strand primer CCTTTTATGTGGCAGTAGGCCTC (residues 2893-2915 of mRNA I and 2973-2995 of mRNA II). In addition, another set of primers was used to amplify a fragment of 829 bp of the second nonallelic isoform of the Na+-Ca2+ exchanger that was recently described in rat brain and skeletal muscle (Li et al. 1994). The set consists of the sense strand primer CGCAGGGGACGAGGAGGAGGAT (residues 2106-2127) and the antisense strand primer AGGGAGGGCAAGGGATGGGATTC (residues 2912-2934).

IDENTIFICATION OF THE PCR PRODUCTS. To identify the obtained PCR product, restriction analysis was used. In addition, the smallest of the two PCR products was also sequenced. Therefore the 224-bp fragment was blunt-ended, phosphorylated, and recovered via QIAEX purification (Qiagen). After subcloning in a SmaI-cleaved and dephosphorylated pGEM-7Zf(-) plasmid cloning vector, four recombinant clones were sequenced in both directions by the dideoxy chain termination method with Sequenase T7 DNA Polymerase (USBiochemical).

Immunocytochemistry

Cells plated on coverslips were immediately fixed in 3% paraformaldehyde for 15 min, permeabilized by another 5 min of incubation in 3% paraformaldehyde plus 0.5% TritonX-100, and washed three times during 15 min with phosphate-buffered saline. After blocking for 1 h with 10% goat serum (Sigma), the cells were incubated overnight with anticardiac Na+-Ca2+ exchanger monoclonal antibody R3F1 (kindly provided by Dr. H. Porzig, Department of Pharmacology, University of Bern, Bern, Switzerland.) at 10 µg/ml. After rinsing with phosphate-buffered saline (3 times during 15 min), incubation with the secondary antibody, goat anti-mouse immune gamma globulin (Fab specific) fluorescein isothiocyanate conjugate (Sigma) at 1:50 dilution took place for 1 h, followed again by three washes with phosphate-buffered saline. In the control experiments, cells were only incubated with the secondary antibody. The coverslips were examined on a Nikon/Biorad MRC 1000 inverted confocal microscope with the use of an iris diaphragm of 3 mm.

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Resting [Ca2+]i and depolarization-induced [Ca2+]i transients in the presence of Na+

In rat DRG cells, mean resting [Ca2+]i at a holding potential of -80 mV was 107 ± 9 nM (n = 67). As illustrated in Fig. 1, depolarization from -80 to 0 mV for 100 ms elicited an inward current that decayed rapidly. The inward current peaked at ~5 ms and can be attributed to activation of the calcium current. Depolarizing steps were associated with an increase in [Ca2+]i, reaching a peak value of477 ± 29 nM (n = 67) ~100 ms after the end of the depolarizing pulse. [Ca2+]i then slowly decayed back to resting levels. In most cells (45 of 67 cells), the normalized decay in [Ca2+]i was monophasic and its time course could be fitted to a single exponential
<IT>y = Ae<SUP><SUP>−</SUP>t<UP>/τ</UP></SUP></IT>
with tau  = 2.43 ± 0.25 s and A = 1 (n = 45) (Fig. 1B, left). Cells displaying [Ca2+]i transients with monophasic decay will be referred to as the monophasic cell type. In the remaining cells (22 of 67 cells), [Ca2+]i decayed in two phases: an early rapid phase was followed by a late and much slower phase (Fig. 1A, left). The normalized time course of the [Ca2+]i decay could be described by a double exponential
<IT>y = A</IT><SUP></SUP><SUB>1</SUB><IT>e</IT><SUP><IT>−t</IT>/<SUP>τ</SUP>1</SUP> + <IT>A</IT><SUB>2</SUB><IT>e</IT><SUP><IT>−t</IT>/<SUP>τ</SUP>2</SUP>
with tau 1 = 0.76 ± 0.08 s and tau 2 = 11.84 ± 1.27 s, A1 = 0.69 ± 0.03 and A2 = 0.31 ± 0.03 (n = 22). These cells will be referred to as the biphasic cell type.


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1. Intracellular Ca2+ concentration ([Ca2+]i) transients and membrane currents in control and Na+-free solution. Superimposed [Ca2+]i transients and current traces in control (thick lines) and in Na+-free solution (- - -). Right: inward current (bottom traces) and the rise in [Ca2+]i (top traces) evoked by a 100-ms depolarization from -80 to 0 mV. Left: same [Ca2+]i transients on a slower time scale. A: biphasic cell. On removal of external Na+, resting [Ca2+]i is increased and the slow component of the [Ca2+]i decay is nearly abolished; the fast decay of the inward current is abolished by replacing Na+ with tetraethylammonium (TEA+). B: monophasic cell. Omitting external Na+ causes a small increase in resting [Ca2+]i and slows down the decay of [Ca2+]i. Note that the fast decay of the inward current is affected in the same way as in a biphasic cell.

Resting [Ca2+]i and depolarization-induced [Ca2+]i transients in Na+-free external solutions

In Fig. 1, Ca2+ signals and membrane currents recorded in Na+-free conditions are represented together with those recorded in control conditions. Removal of external Na+ slowed the decay of [Ca2+]i in most cells. However, in ~15% of the cells (10 cells of 67, see Table 1) there was no significant difference between control and Na+-free conditions. These nonresponding cells all displayed a clear [Ca2+]i transient with monophasic decay on membrane depolarization. This monophasic decay had a slower mean time constant compared with the mean time constant of responding monophasic cells (3.85 ± 0.91 s vs. 2.02 ± 0.13 s, P < 0.05, Welch's approximate t-test). For most cells, however, substituting external Na+ with either TEA+ or Li+ clearly affected both the resting [Ca2+]i and Ca2+ handling following a depolarizing step (see Table 1). In the responding monophasic cell type (Fig. 1B), resting [Ca2+]i increased by ~23 nM (from 102 ± 12 nM to 125 ±17 nM, n = 35, P < 0.001). By contrast, in the biphasic cell type, the increase in resting [Ca2+]i was larger and amounted to 70 nM (from 116 ± 15 nM to 186 ±18 nM, n = 22, P < 0.0001) (Figs. 1A and 2).

 
View this table:
[in this window] [in a new window]
 
TABLE 1. Overview of the Na+ dependence of [Ca2+]i in different types of DRG neurons


View larger version (14K):
[in this window]
[in a new window]
 
FIG. 2. [Ca2+]i and truncated current traces from a dorsal root ganglion (DRG) neuron held at -80 mV. Three depolarizing steps for 100 ms to 0 mV were given each 30 s. Immediately after the 2nd depolarizing step, the neuron was exposed to a Na+-free solution (bar); both the holding current and the decay of the [Ca2+]i transient were reversibly affected.

Omitting Na+ from the external solution clearly affected the [Ca2+]i transient accompanying the depolarizing step, the most prominent effect being on the time constants of the [Ca2+]i decay. In the responding monophasic cells, the time constant of [Ca2+]i decay increased from 2.02 ± 0.13 s to 3.63 ± 0.25 s (n = 35, P < 0.0001, Table 1). In the biphasic cell type, the time constant of the second slow component increased from 11.84 ± 1.3 s to 39.7 ± 9.2 s (n = 22, P = 0.01), whereas the time constant of the fast component was only slightly affected (from 0.76 ± 0.08 s to 0.97 ± 0.09 s, n = 22, P <0.0001). The relative amplitudes of both time constants increased from 0.69 ± 0.03 to 0.78 ± 0.03 for the fast component and decreased from 0.31 ± 0.03 to 0.22 ± 0.03 for the slow one (P = 0.0017). In both cell types, the peak of the [Ca2+]i transient increased, but because resting [Ca2+]i was also increased, the absolute amplitude of the [Ca2+]i transient was not significantly affected (see Table 1).

In all cases the increase in resting [Ca2+]i was accompanied by an outward shift in the holding current ranging from 20 to 200 pA.

In Na+-free solutions standard depolarizing steps from -80 to 0 mV evoked an inward current. When external Na+ was replaced with Li+, the inward current was similar to the control (data not shown). With TEA+ as Na+ substitute, however, the fast decay of the inward current was abolished, suggesting that the current decay is due to activation of a TEA+-sensitive outward current (Fig. 1).

As illustrated for a biphasic cell type (Fig. 2), the effects of removing external Na+ on both membrane current and Ca2+ handling were immediate and completely reversible.

The finding that both resting [Ca2+]i and Ca2+ handling in DRG cells is dependent on external Na+ strongly suggests the involvement of the Na+-Ca2+ exchanger.

Voltage dependence of Ca2+ decay

Because Na+-Ca2+ exchange has been shown to be electrogenic (for review see Blaustein 1988), Ca2+ handling is expected to be dependent on the membrane potential. For this purpose, cells were depolarized for 100 ms from -80 to 0 mV and the recovery from a Ca2+ load was studied at different test potentials. Figure 3, left, compares the recovery from a Ca2+ load at -80 and -60 mV in a monophasic cell type. It is obvious that the [Ca2+]i decay is markedly slowed by setting the membrane potential at -60 mV. In biphasic cells, this protocol affected mainly the slow component of the decay (Fig. 3, right).


View larger version (34K):
[in this window]
[in a new window]
 
FIG. 3. Voltage dependency of [Ca2+]i recovery: [Ca2+]i transients were induced by a 100-ms depolarizing step from -80 to 0 mV and [Ca2+]i relaxation was measured at test potentials of -80 and -60 mV as indicated. Data are shown on a semilogarithmic scale. In the monophasic cell type (left) the normalized [Ca2+]i decay could be fitted by a single exponential with time constant of 2.7 and 5.0 s at -80 and -60 mV, respectively. In the biphasic cell type (right) the normalized [Ca2+]i decay at -80 mV was fitted by the sum of 2 exponentials with time constants of 0.6 and 8.3 s. Changing the test potential to -60 mV clearly slowed down the 2nd component, because the time constants were 0.8 and 24.9 s.

In both cell types, holding the cell at different membrane potentials in the range of -80 to -60 mV did not affect resting [Ca2+]i.

Effect of Ni2+ on Ca2+ decay

In cardiac myocytes, Ni2+ completely blocked Na+-Ca2+ exchange (Kimura et al. 1987). When Ni2+ (5 mM) was added after a voltage step to 0 mV, as shown for a biphasic celltype in Fig. 4, the late slow component of [Ca2+]i decay was dramatically slowed. These results confirm that the late phase of [Ca2+]i decay is mainly due to Ca2+ removal via the exchanger. The shift in outward current during exposure to Ni2+ is comparable with the shift observed in Na+-free solutions.


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 4. Effect of Ni2+ on [Ca2+]i recovery. [Ca2+]i and truncated current traces from a DRG neuron held at -80 mV. Depolarizing steps for 100 ms to 0 mV were given each 30 s. The decay of the Ca2+ signal has a slow and a fast phase. When 5 mM Ni2+ was applied after the depolarizing voltage step to 0 mV (bar), the recovery to basal [Ca2+]i was greatly slowed down. This procedure was accompanied by a shift of the holding current in the outward direction.

Reverse transcriptase PCR

To support the hypothesis that the Na+-Ca2+ exchanger plays an important role in the regulation of [Ca2+]i in DRG neurons, we looked for the presence of a Na+-Ca2+ exchanger at the RNA level by the use of reverse transcriptase PCR (Fig. 5). First the presence of mRNA transcripts derived from the first described gene (Nicoll et al. 1990) encoding the Na+-Ca2+ exchanger was checked. A fragment of the predicted length (224 bp) could be amplified. The nature of the fragment was confirmed both by restriction analysis and cDNA sequencing. In the amplified region we found a 100% sequence identity in the sequence of the two cloned allelic Na+-Ca2+ exchanger isoforms in rat brain (Furman et al. 1993). To demonstrate the expression of the second recently cloned nonallelic isoform of the Na+-Ca2+ exchanger (Li et al. 1994), primers were designed that specifically amplify products derived from this Na+-Ca2+ exchanger transcript. We thus could amplify a PCR product of the predicted length of 829 bp. Its identity was confirmed by restriction analysis. We conclude that both genes encoding two nonallelic isoforms of the Na+-Ca2+ exchanger are expressed in rat DRG neurons.


View larger version (40K):
[in this window]
[in a new window]
 
FIG. 5. Polyacrylamide gel electrophoresis of cDNA amplified by polymerase chain reaction (PCR). Left: 224-bp fragment of the 1st type Na+-Ca2+ exchanger. Right: 829-bp fragment of the 2nd nonallelic isoform of the Na+-Ca2+ exchanger. M, molecular weight marker in bp.

Immunocytochemistry

The presence of mRNA does not necessarily imply the expression of a functional protein. The expression of the Na+-Ca2+ exchanger was further confirmed at the protein level by immunocytochemistry. We used as primary antibody R3F1, a monoclonal antibody raised against the canine cardiac Na+-Ca2+ exchanger (Porzig 1991; Porzig et al. 1993). As can be seen in Fig. 6, labeling of the cells occurred only after incubation with the primary and secondary antibody. Thus antibodies raised against the canine cardiac Na+-Ca2+ exchanger cross-react with the rat brain Na+-Ca2+ exchanger, as could be expected because the Na+-Ca2+ exchanger isoforms described by Furman et al. (1993) are splice variants of the same gene transcript. This immunofluorescence pattern clearly demonstrates the presence of the Na+-Ca2+ exchanger in rat DRG neurons.


View larger version (147K):
[in this window]
[in a new window]
 
FIG. 6. Pseudocolor image of distribution of the Na+-Ca2+ exchanger in isolated DRG neurons. Top: confocal image of a cell incubated with the fluorescein isothiocyanate conjugated secondary antibody. Bottom: confocal image of neurons incubated with anticardiac Na+-Ca2+ exchanger monoclonal antibody, followed by the secondary antibody.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

The present study clearly demonstrates that a functional Na+-Ca2+ exchanger is important for Ca2+ homeostasis in rat DRG neurons. This is demonstrated at the functional level, the mRNA level, and protein level.

In most DRG cells and particularly in the biphasic cell type, removal of external Na+ evoked an increase in resting [Ca2+]i. This effect can most readily be explained by assuming Ca2+ influx via the Na+-Ca2+ exchanger. Normally, the exchanger uses the Na+ gradient to drive Ca2+ out of the cell (for review see Blaustein 1988). In Na+-free conditions, however, extrusion of Ca2+ is not possible and the exchanger may even operate in the reverse mode, thus causing Ca2+ influx. Both effects result in an increase in [Ca2+]i. Ni2+, which blocks both operating modes of the exchanger (Kimura et al. 1987), did not significantly alter resting [Ca2+]i at -80 mV. This observation thus suggests that the Na+-free induced rise in resting [Ca2+]i is mainly due to Ca2+ influx via the reverse mode of the exchanger. The outward shift in holding current that accompanies this rise in resting [Ca2+]i is compatible with an electrogenic exchanger having a stoichiometry of 3 Na+/1 Ca2+ (for review see Philipson and Nicoll 1992).

In the biphasic cell type, the effect of removing external Na+ on resting [Ca2+]i was large and immediate. This finding suggests that in this cell type the other Ca2+ handling systems, such as the endoplasmatic reticulum, mitochondria, and plasmalemmal Ca2+ pumps, cannot compensate for the Ca2+ influx via the exchanger. In the monophasic cells, on the other hand, the increase in resting [Ca2+]i induced by removing external Na+ was only small or even absent. This suggests that, in these cells, the other Ca2+ removal mechanisms have the capacity to handle the increased Ca2+ influx via the Na+-Ca2+ exchanger.

Manipulations affecting the Na+-Ca2+ exchanger had much larger effects on the recovery of [Ca2+]i after a Ca2+ load compared with the effects on resting [Ca2+]i. Removal of external Na+ dramatically slowed the [Ca2+]i decay: in responding monophasic cells the time constant of recovery nearly doubled, whereas in biphasic cells the slow component disappeared. From this we can conclude that in biphasic cells the Na+-Ca2+ exchanger is the main contributing mechanism to the slow phase of the [Ca2+]i decay. Ni2+, when added after a Ca2+ load, also affected the slow [Ca2+]i decay. Because Ni2+ did not affect resting [Ca2+]i , we can conclude that Ca2+ efflux via the Na+-Ca2+ exchanger is only important when [Ca2+]i is well above resting levels, i.e., after a Ca2+ load. The finding that the time constant of [Ca2+]i decay, but not resting [Ca2+]i, was voltage dependent is in agreement with this. The contrast between the equivocal role of the Na+-Ca2+ exchanger at resting [Ca2+]i compared with its contribution to the [Ca2+]i decay after a Ca2+ load was also reported for cultured cortical neurons (White and Reynolds 1995); moreover, a similar variability in response to Na+-free solution was seen within this neuronal population. The finding that in the nonresponding monophasic cells the decay of [Ca2+]i is not affected by omitting external Na+ suggests that these cells do not express a functional Na+-Ca2+ exchanger. Interestingly, the decay of [Ca2+]i in these nonresponding monophasic cells was not different from the decay in responding monophasic cellsin Na+-free conditions (time constants 3.85 ± 0.91 s vs.3.63 ± 0.25 s, P = 0.41, Welch's approximate t-test), adding evidence to the absence of a functional Na+-Ca2+ exchanger in these cells.

The expression of the Na+-Ca2+ exchanger was additionally demonstrated at the mRNA level. Both known nonallelic isoforms of the Na+-Ca2+ exchanger were shown to be expressed in rat DRG cells. The functional differences between these isoforms are not well established, but the affinity for regulatory intracellular Ca2+ has been reported to be lower for the second isoform (Li et al. 1994). One could speculate that the relative expression of both exchangers within the DRG population is variable, explaining the observed differences in the Na+ dependency of the Ca2+ removal in the DRG neurons tested. The relative expression levels of both isoforms in this cell type remain a topic for further study.

Moreover, the presence of the Na+-Ca2+ exchanger protein could be demonstrated by immunocytochemistry. The antibody used binds to the large intracellular hydrophilic loop of the cardiac Na+-Ca2+ exchanger (Porzig et al. 1993). It is not known whether the antibody also recognizes the new nonallelic isoform of the exchanger (Li et al. 1994).

Our results differ from previous reports on Ca2+ handling in DRG neurons. In cultured neonatal rat DRG neurons, removal of external Na+ had only a small and transient effect on resting [Ca2+]i, whereas the recovery rate after a Ca2+ load was not altered (Thayer and Miller 1990). One could argue that leaving these cells in culture for a prolonged period could alter their Ca2+ extrusion machinery. Cultured cells have less Ca2+ load to handle and therefore coulddownregulate their Ca2+ extrusion proteins. Benham et al. (1992), using small (20 µm) rat DRG neurons, also could not detect changes in resting [Ca2+]i on removal of external Na+, whereas the time constant of decay after a Ca2+ load was slightly increased from 5.1 to 6.1 s. However, in mouse DRG neurons, small cells (<25 µm) have been shown to have slow [Ca2+]i transients (time of half recovery of 6.1 s) compared with fast [Ca2+]i transients (time of half recovery of 1.7 s) in larger cells (>40 µm) (Shmigol et al. 1994). Thus cell size could influence the kinetics of Ca2+ extrusion. The cells used in the present study all had diameters of ~30 µm. It is tempting to speculate that in small DRG cells, the expression level of the Na+-Ca2+ exchanger is lower compared with that in larger cells. This could explain both the faster Ca2+ relaxation and the larger effect of omitting external Na+ observed in our experiments, compared with the findings of Benham et al. (1992). Other factors cannot be excluded, however.

Other Ca2+ buffering mechanisms are present in DRG neurons. In biphasic cells, they are responsible for the Na+-insensitive fast component of the [Ca2+]i decay. In monophasic cells, the Na+-insensitive Ca2+ removal mechanisms are able to compensate for the reduced Ca2+ efflux via the Na+-Ca2+ exchanger, rendering the dissection between the Na+ dependent and Na+ independent mechanisms difficult. Different Na+-independent Ca2+ removal mechanisms have been described to be present in DRG neurons. Plasma membrane Ca2+ ATPases are expressed and can cause the decay of [Ca2+]i after Ca2+ loads (Benham et al. 1992). Mitochondria are also involved in buffering large but physiological Ca2+ loads (Werth and Thayer 1994). DRG neurons further possess caffeine-sensitive Ca2+ stores that could play a role in buffering Ca2+ loads (Neering and McBurney 1984). In rat DRG neurons, however, these stores were reported not to be important for handling depolarization-induced [Ca2+]i transients (Benham et al. 1992). In mouse DRG neurons, on the other hand, thapsigargin (a specific blocker of endoplasmatic Ca2+ ATPases) causes a slowing of the [Ca2+]i decay after depolarization-induced [Ca2+]i loads (Shmigol et al. 1994). The importance of these other mechanisms relative to Ca2+ extrusion via the Na+-Ca2+ exchanger is presently unknown and is a topic for further study.

In conclusion, we demonstrate both at the functional and molecular level that the Na+-Ca2+ exchanger is present in rat DRG neurons. The Na+-Ca2+ exchanger is important for removal of Ca2+ loads, whereas its effect on resting [Ca2+]i is more equivocal. Three different types of neurons were distinguished according to the Na+ dependence of [Ca2+]i: 1) in the largest group of cells (52% of the cells tested), the time constant of decay almost doubled in Na+-free medium, whereas there was only a small increase in resting [Ca2+]i; 2) in the second group (33% of the cells tested), cells displayed a biphasic decay of [Ca2+]i; omitting Na+ abolished the slow component of decay; in this cell type, the increase in basal [Ca2+]i was pronounced; and 3) finally, in 15% of the cells no Na+ dependence could be detected.

    ACKNOWLEDGEMENTS

  The authors thank Dr. Porzig for providing anticardiac Na+-Ca2+ exchanger antibodies. We are grateful to D. Hermans for the cell isolation. We also thank L. Heremans for preparing the solutions for the electrophysiological experiments and for administrative support.

    FOOTNOTES

  Address reprint requests to G. Callewaert.

  Received 20 April 1996; accepted in final form 31 July 1996.

    REFERENCES
Abstract
Introduction
Methods
Results
Discussion
References

0022-3077/97 $5.00 Copyright ©1997 The American Physiological Society



This article has been cited by other articles:


Home page
J. Neurophysiol.Home page
H. I. Rocha-Gonzalez, S. Mao, and F. J. Alvarez-Leefmans
Na+,K+,2Cl- Cotransport and Intracellular Chloride Regulation in Rat Primary Sensory Neurons: Thermodynamic and Kinetic Aspects
J Neurophysiol, July 1, 2008; 100(1): 169 - 184.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
T. D. Gover, T. H. V. Moreira, J. P. Y. Kao, and D. Weinreich
Calcium regulation in individual peripheral sensory nerve terminals of the rat
J. Physiol., January 15, 2007; 578(2): 481 - 490.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S.-G. Lu, X. Zhang, and M. S. Gold
Intracellular calcium regulation among subpopulations of rat dorsal root ganglion neurons
J. Physiol., November 15, 2006; 577(1): 169 - 190.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Verdru, P.
Right arrow Articles by Callewaert, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Verdru, P.
Right arrow Articles by Callewaert, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online