|
|
||||||||
The Journal of Neurophysiology Vol. 79 No. 5 May 1998, pp. 2668-2676
Copyright ©1998 by the American Physiological Society
-SNS Sodium Channel Expression in Small Dorsal Root Ganglion Neurons After Axotomy by Nerve Growth Factor In Vivo
Department of Neurology, Yale University School of Medicine, New Haven, 06510; and PVA/EPVA Center for Neuroscience, Veterans Affairs Medical Center, West Haven, Connecticut 06516
| |
ABSTRACT |
|---|
|
|
|---|
Dib-Hajj, S. D., J. A. Black, T. R. Cummins, A. M. Kenney, J. D. Kocsis, and S. G. Waxman. Rescue of
-SNS sodium channel expression in small dorsal root ganglion neurons after axotomy by nerve growth factor in vivo. J. Neurophysiol. 79: 2668-2676, 1998. Small (18-25 µm diam) dorsal root ganglion (DRG) neurons are known to express high levels of tetrodotoxin-resistant (TTX-R) sodium current and the mRNA for the
-SNS sodium channel, which encodes a TTX-R channel when expressed in oocytes. These neurons also preferentially express the high affinity receptor for nerve growth factor (NGF), TrkA. Levels of TTX-R sodium current and of
-SNS mRNA are reduced in these cells after axotomy. To determine whether NGF participates in the regulation of TTX-R current and
-SNS mRNA in small DRG neurons in vivo, we axotomized small lumbar DRG neurons by sciatic nerve transection and administered NGF or Ringer solution to the proximal nerve stump using osmotic pumps. Ten to 12 days after pump implant, whole cell patch-clamp recording demonstrated that TTX-R current density was decreased in Ringer-treated axotomized neurons (154 ± 45 pA/pF; mean ± SE) compared with nonaxotomized control neurons (865 ± 123 pA/pF) and was restored partially toward control levels in NGF-treated axotomized neurons (465 ± 78 pA/pF). The V1/2 for steady-state activation and inactivation of TTX-R currents were similar in control, Ringer- and NGF-treated axotomized neurons. Reverse transcription polymerase chain reaction revealed an upregulation of
-SNS mRNA levels in NGF-treated compared with Ringer-treated axotomized DRG. In situ hybridization showed that
-SNS mRNA levels were decreased significantly in small Ringer-treated axotomized DRG neurons in vivo and also in small DRG neurons that were dissociated and maintained in vitro, so as to correspond to the patch-clamp conditions. NGF-treated axotomized neurons had a significant increase in
-SNS mRNA expression, compared with Ringer-treated axotomized cells. These results show that the administration of exogenous NGF in vivo, to the proximal nerve stump of the transected sciatic nerve, results in an upregulation of TTX-R sodium current and of
-SNS mRNA levels in small DRG neurons. Retrogradely transported NGF thus appears to participate in the control of excitability in these cells via actions that include the regulation of sodium channel gene expression in vivo.
Dorsal root ganglion (DRG) neurons, with axons that project from the periphery to the spinal cord, exhibit a variety of electrophysiological phenotypes related to their function. Two broad classes of sodium currents, tetrodotoxin-sensitive (TTX-S) and TTX-resistant (TTX-R) (Caffrey et al. 1993; Elliott and Elliott 1993 Surgery
Mouse 2.5 S NGF (Upstate Biotechnology) was diluted in filtered Ringer solution immediately before use in Alzet osmotic pumps (Alza Scientific Products). Pumps designed for 14-day use were filled with NGF for a delivery rate of 125 ng/h; this rate falls within the range of exogenous NGF administration that has been shown to be effective when applied to the axotomized adult rat sciatic nerve in vivo (Fitzgerald et al. 1985 Cell culture
Cultures of DRG neurons from adult rats were established as described previously (Rizzo et al. 1994 Electrophysiology
Whole cell patch-clamp recordings were conducted at room temperature (21°C) using an EPC-9 amplifier. Data were acquired on a Macintosh Quadra 950 using the Pulse program (v 7.52, HEKA Electronic, Germany). Fire-polished electrodes (0.8-1.5 M RT-PCR
For RT-PCR, four animals were killed at 10-12 days after implantation of NGF and Ringer pumps, and the L4/L5 DRGs from the respective sides were pooled. Total cellular RNA was isolated by the single step guanidinum isothiocyanate-acid phenol procedure (Chomczynski and Sacchi 1987 In situ hybridization
For the study of cells in DRG sections, 14-µm cryosections were mounted on poly-L-lysine-coated glass slides and processed for in situ hybridization as previously described (Black et al. 1994a Data analysis
To obtain a quantitative measurement of hybridization signal, images of cultured or tissue section DRG neurons were captured with a ComputerEyes/1024, Version 1.07, image capture board. In tissue sections, only those small neurons the nuclei of which were apparent were included in the analysis. Optical density (OD) measurements of each neuron were obtained using the NIH Image program; the program was calibrated with images of neutral density filters of 0.1, 0.3, and 0.6 OD and fitted to a straight line (R2 > 0.999). All signals measured were within the linear calibration range. The means ± SD for optical densities for small (<25 µm diam) neurons of control (no pump implant), NGF-treated axotomized and Ringer-treated axotomized DRG were determined. Student's t-test analyses were performed with Microsoft Excel software. Three in vivo and four in vitro experiments were analyzed for the expression of TTX-R sodium currents are increased by NGF treatment after axotomy
Using patch-clamp recording, control (no sciatic nerve transection), NGF-treated axotomized and Ringer-treated axotomized [10-12 days post axotomy (dpa)] neurons were examined. Sodium currents were recorded from small (18-25 µm) DRG neurons after 12-24 h in culture using whole cell patch-clamp techniques. For each of the three experimental groups, 5-12 cells per culture were studied from at least four different cultures. Figure 1 shows recordings from a typical neuron for each group. The sodium currents in control neurons were similar to those previously described in small DRG neurons (Caffrey et al. 1992
SNS mRNA expression is increased by NGF treatment
Previous work has shown that the expression of sodium channel RT-PCR
In situ hybridization
Sodium channel
This study, which focused on C-type (small) DRG neurons, which include nociceptive and temperature-sensitive cells and which preferentially express the
![]()
INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References
; Kostyuk et al. 1981
; Roy and Narahashi 1992
), have been recorded in DRG neurons, and these cells express the mRNAs for at least six sodium channel
-subunits (Black et al. 1996
). Unmyelinated C-type and myelinated cutaneous afferent DRG neurons produce relatively high levels of TTX-R sodium current (Cummins and Waxman 1997
; Honmou et al. 1994
; Rizzo et al. 1994
). The expression of TTX-R sodium currents in C-type DRG neurons, in particular, is associated with high levels of mRNA for the
-SNS sodium channel (Black et al. 1996
; Dib-Hajj et al. 1996
), which is expressed preferentially in these cells and encodes a TTX-R sodium current when expressed in oocytes (Akopian et al. 1996
; Sangameswaran et al. 1996
). After axotomy, the density of TTX-R sodium current decreases in myelinated cutaneous afferent (Rizzo et al. 1995
) and C-type DRG neurons (Cummins and Waxman 1997
) and, concomitantly, levels of
-SNS mRNA are reduced in these cells (Dib-Hajj et al. 1996
).
) are not fully understood. Nevertheless, there is evidence indicating that nerve growth factor (NGF) may be involved in this process, at least for several of the isoforms expressed in these cells. The electrophysiological phenotype of nociceptive and cutaneous afferent DRG neurons is regulated by NGF during development (Ritter and Mendell 1992
; Ritter et al. 1991
). NGF induces increases in sodium channel expression in several types of cells (D'Arcangelo et al. 1993
; Fanger et al. 1995
; Kalman et al. 1990
; Mandel et al. 1988
; Toledo-Aralet al. 1995), including increases in the expression of TTX-Rsodium current in PC-12 cells (Rudy et al. 1987
) and in DRG neurons (Aguayo and White 1992
). NGF also has been shown to upregulate the expression of mRNA for sodium channel
-subunits II (Mandel et al. 1988
) and PN1 (D'Arcangelo et al. 1993
; Toledo-Aral et al. 1995
) in PC-12 cells and
-subunit II in embryonic DRG neurons (Zur et al. 1995
).
) is reversed partially by administration of NGF to the injured nerve stump in vivo (Oyelese et al. 1997
). However, the effect of NGF on sodium channel gene expression in these cells has not been studied, and the contribution of changes in
-SNS mRNA expression to the effects of NGF on sodium currents in DRG neurons is not known. A similar decrease in TTX-R sodium current density occurs after axotomy in C-type DRG neurons (Cummins and Waxman 1997
) and is associated with a decrease in
-SNS mRNA levels in these cells (Dib-Hajj et al. 1996
). Thus C-type DRG neurons present a cell type in which it is possible to study the expression of both a particular class of sodium current (TTX-R) and a mRNA that encodes a TTX-R sodium channel. Small DRG neurons are known to preferentially express the high affinity receptor for NGF, TrkA (Kashiba et al. 1995
; McMahon et al. 1994
). It has been shown that NGF, delivered directly to cell bodies, acts to maintain high levels of
-SNS mRNA expression in C-type DRG neurons in an in vitro model that mimics axotomy (Black et al. 1997
). However, the effects of NGF on axotomized C-type DRG neurons have not been studied previously in vivo, and the effects of peripheral delivery of NGF to the transected nerve stump have not been examined. In the present study, small DRG neurons were axotomized within the sciatic nerve of adult rats, and exogenous NGF was administered to the proximal peripheral nerve stump using osmotic pumps. Patch-clamp recording examined the expression of TTX-R sodium current, and reverse transcription polymerase chain reaction (RT-PCR) and in situ hybridization were used to measure the expression of
-SNS mRNA in these cells. The results demonstrate that exogenously administered NGF, delivered to the transected nerve, mitigates the effects of axotomy on C-type DRG neurons, maintaining high levels of TTX-R sodium current and
-SNS mRNA in these cells.
![]()
METHODS
Abstract
Introduction
Methods
Results
Discussion
References
; Munson et al. 1997
; Verge et al. 1995
; Wong and Oblinger 1991
). Experiments (Oyalese et al. 1997) in which pumps filled with 4% Fluorogold were implanted and the L4/L5 DRG then were removed, sectioned, and examined by fluorescent microscopy resulted in high levels of staining of DRG neurons but not of satellite cells, making it unlikely that delivery of NGF from the pump site to the DRG was limited to passive diffusion. For comparison with NGF, additional pumps were filled with sterile Ringer solution. A polyethylene catheter connected to a silicone cuff was attached to each pump, and the units were allowed to equilibrate 5 h to overnight at 37°C in sterile Ringer solution. Adult Sprague-Dawley female rats were anesthetized with ketamine/xylazine (40/2.5 mg/kg ip), and the NGF pump with catheter and cuff was implanted in a subcutaneous pocket in the abdominal region on the right side. The Ringer pump was implanted similarly in the left side. For axotomy and connection with the pump, the sciatic nerve was exposed, ligated with 4.0 silk suture, and transected at the level of the pyriform tendon. The ligated nerve stump was drawn into the silicon cuff and sutured in place. Ten to 12 days after pump implantation, animals were anesthetized with ketamine/xylazine and the animals were exsanguinated and L4/L5 DRG excised and processed for cell culture (Black et al. 1996
) for patch-clamp recording or in situ hybridization, exsanguinated and L4/L5 DRG rapidly dissected and placed on dry ice for extraction of RNA for RT-PCR (Dib-Hajj et al. 1996
), or intracardially perfused, first with phosphate-buffered saline and then with 4% paraformaldehyde in 0.14 M Sorenson's phosphate buffer, and the L5/L5 DRGs removed and processed for in situ hybridization cytochemistry (Black et al. 1996
; Waxman et al. 1994
). In all cases, the pumps were examined to verify that they remained intact and connected to the sciatic nerve stump for the duration of implantation.
). Briefly, lumbar ganglia (L4, L5) from control (no pump implant or axotomy) and NGF- and Ringer-pump-implanted adult Sprague Dawley female rats were freed from their connective sheaths and incubated sequentially in enzyme solutions containing collagenase and then papain. The tissue was triturated in culture medium containing 1:1 Dulbecco's modified Eagle's medium and Hank's F12 medium and 10% fetal calf serum, 1.5 mg/ml trypsin inhibitor, 1.5 mg/ml bovine serum albumin, 100 U/ml penicillin, and 0.1 mg/ml streptomycin and plated at a density of 500-1,000 cells/mm2 on polyornithine/laminin coated coverslips. The cells were maintained at 37°C in a humidified 95% air-5% CO2 incubator overnight and used for electrophysiological recording or in situ hybridization within 24 h of plating.
) were fabricated from 1.65-mm capillary glass (WPI) using a Sutter P-87 puller. Cells were not considered for analysis if the initial seal resistance was <5 G
or if they had high leakage currents (holding current >1 nA at
80 mV), membrane blebs, or an access resistance >5 M
. Access resistance was monitored throughout the experiment and data were not used if resistance changes of >20% occurred. The average access resistance was 2.1 ± 0.6 M
(mean ± standard deviation, n = 137). Voltage errors were minimized using 80% series resistance compensation, and the capacitance artifact was canceled using the computer-controlled circuitry of the patch clamp amplifier. Linear leak subtraction, based on resistance estimates from four to five hyperpolarizing pulses applied before the depolarizing test potential, was used for all voltage-clamp recordings. Membrane currents were filtered at 5 kHz and sampled at 20 kHz. The pipette solution contained (in mM) 140 CsF, 2 MgCl2, 1 ethylene glycol-bis(
-aminoethyl ether)-N,N,N',N'-tetraacetic acid, and 10 Na-N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid(HEPES) (pH 7.3). The standard bathing solution contained (in mM) 140 NaCl, 3 KCl, 2 MgCl2, 1 CaCl2, 0.1 CdCl2, 10 HEPES, and 10 glucose (pH 7.3). The liquid junction potential for these solutions was <5 mV; data were not corrected to account for this offset. The osmolarity of all solutions was adjusted to 310 mosM (Wescor 5550 osmometer). The offset potential was zeroed before patching the cells and checked after each recording for drift: if the drift was >5 mV/h, the recording was not used.
). Extraction buffer was used at 25 µl per 1 mg of tissue. The quality of the RNA was assessed by electrophoresis in a 1.2% agarose gel. First strand cDNA was reverse transcribed in a 25 µl final volume using 1 µM random hexamer (Boehringer Mannheim), 500 units SuperScript II reverse transcriptase (Life Technologies) and 100 units of RNase Inhibitor (Boehringer Mannheim). The buffer consisted of (in mM) 50 tris(hydroxymethyl)aminomethane (Tris)-HCl (pH 8.3), 75 KCl, 3 MgCl2, 10 DTT, and 5 dNTP. The reaction was allowed to proceed at 37°C for 90 min and 42°C for 30 min and then was terminated by heating to 65°C for 10 min.
-SNS RT-PCR, primers were used that are complementary to sequences in domain 1 (D1) and which amplify a 479-bp product that corresponds to nucleotides 762-1241 (accession number: SNS X92184). The amplified product spans multiple exon/intron boundaries (Souslova et al. 1997
). Forward primer F1 (5' GACCCRTGGAATTGGTTGGA 3') matches multiple subunits with a T-to-C mismatch at position 3 compared with
-SNS. Reverse primer R1 (5' GAGGAATGCCCACGCAAAGGAATC 3') specifically matches subunit
-SNS. The F1/R1 primer pair amplified only one product from a DRG cDNA template; this product matched the predicted fragment properties of length and restriction enzyme polymorphism (data not shown).
). DNaseI treatment was routinely performed before reverse transcription to prevent amplification of GAPDH sequences from genomic processed pseudogenes that might have contaminated the total RNA preparation (Benham et al. 1984
).
-SNS and GAPDH were determined empirically. To prevent inhibition of the amplification of
-SNS template by GAPDH, we delayed addition of the GAPDH primers until later stages of amplification (Kinoshita et al. 1992
). GAPDH and
-SNS primers were used at final concentrations of 0.5 and 3.3 µM, respectively. Amplification typically was performed in 60 µl volume using 1.75 units of Expand Long Template DNA polymerase enzyme mixture (Boehringer Mannheim). Control PCR with water or RNA template produced no amplification products (data not shown). The PCR reaction buffer consisted of 50 mM Tris-HCl (pH 9.2), 16 mM (NH4)2SO4, 2.25 mM MgCl2, 2% (vol/vol) dimethyl sulfoxide, and 0.1% Tween 20. Amplification was carried out in three stages: first, denaturation at 94°C for 4 min, annealing at 60°C for 2 min, and elongation at 72°C for 90 s, pause at 20°C to allow addition of the GAPDH primers; second, denaturation at 94°C for 1 min, annealing at 60°C for 1 min, and elongation at 72°C for 90 s, repeated 26 times; and third, elongation at 72°C for 10 min. Multiple amplifications were performed for each RNA sample.
-SNS quantified in auto-analysis mode. The level of the
-SNS in the cDNA pool was expressed as the ratio "a:b", where a and b are the areas under the peaks of the
-SNS and GAPDH, respectively. Four independent amplifications were performed on each template and the results analyzed for statistical significance by two-tail t-test (2 samples assuming unequal variance) using Microsoft Excel software.
). Briefly, the sections were sequentially incubated in 1) 4% paraformaldehyde in 0.14 M phosphate buffer, 5 min; 2) phosphate-buffered saline (PBS), three times, 2 min each; 3) proteinase K (10 µg/ml; Boehringer-Mannheim) in 100 mM Tris/50 mM (ethylenedinitrilo)tetraacetic acid, disodium salt (EDTA), pH 8.0, 25 min at 37°C; 4) PBS, three times, 2 min each; 5) 0.1 M triethanolamine (TEA), pH 8.0, 2 min; 6) 0.25% acetic anhydride in 0.1 M TEA, 10 min; 7) 2× saline-sodium citrate buffer (SSC), three times, 2 min each; 8) prehybridization solution, containing 50% formamide, 5× SSC, 5× Denhardt's, and 100 µg/ml salmon sperm DNA (Sigma), for 1-2 h; 9) hybridization solution, containing 50% formamide, 1 mg/ml dextran sulfate, 5× SSC, 1× Denhardt's, 100 µg/ml salmon sperm DNA, and 0.25 ng/µl
-SNS sense or antisense riboprobe overnight at 56°C in a humified chamber; 10) 4× SSC, 5 min; 11) 2× SSC, twice, 10 min each; 12) RNase A (20 µg/ml in 10 mM Tris/500 mM NaCl, pH 8) at 37°C for 30-45 min; 13) 2× SSC, 10 min, twice; 14) 0.2× SSC, 20 min at 56°C, three times; 15) 100 mM Tris/150 mM NaCl, pH 7.5, 2 min; 16) 100 mM Tris/150 mM NaCl, pH 7.5, containing 2% normal sheep serum and 1% bovine serum albumin, 15 min; 17) anti-digoxigenin antibody conjugated to alkaline phosphatase (Boehringer-Mannheim; 1:500 in blocking solution) overnight at 4°C; 18) 100 mM Tris/150 mM NaCl, three times, 5 min each; 19) 100 mM Tris/100 mM NaCl/50 mM MgCl2, pH 9.5, three times, 5 min each; and 20) alkaline phosphatase color substrate (NBT/X-phos) for 1 h. The reaction was stopped with 10 mM Tris/1 mM EDTA, pH 8, and the glass slides were coverslipped with poly-aqua-mount (Polysciences).
). Briefly, coverslips were washed twice with Hank's balanced salt solution (HBSS) and then fixed with 4% paraformaldehyde in HBSS for 10 min at 4°C. The coverslips then were rinsed several times in HBSS, incubated for 15 min in HBSS containing 0.1% Triton, rinsed several times in HBSS and then 2× SSC, and incubated for 1 h in prehybridization solution (50% formamide, 5× SSC, 5× Denhardt's solution, and 100 µg/ml salmon testis DNA) at room temperature. The coverslips were hybridized overnight at 56°C in hybridization solution containing 50% formamide, 5× SSC, 1× Denhardt's solution, 100 µm/ml salmon testis DNA, and 0.25 ng/µl
-SNS antisense or sense riboprobe. The coverslips then were processed as described above for tissue sections.
-SNS mRNA in small DRG neurons. Analysis of the pooled data from the in vivo or in vitro experiments, and of individual experiments, yielded similar results.
![]()
RESULTS
Abstract
Introduction
Methods
Results
Discussion
References
; Elliott and Elliott 1993
; Rizzo et al. 1994
; Roy and Narahashi 1992
), with most control neurons expressing both fast-inactivating TTX-S and slow-inactivating TTX-R sodium currents (Fig. 1). Because TTX-S currents inactivate at potentials ~35 mV more negative than TTX-R currents, prepulse inactivation can be used to separate the TTX-R and TTX-S current components (McLean et al. 1988
; Roy and Narahashi 1992
). TTX-subtraction and prepulse-inactivation methods give essentially the same results (Cummins and Waxman 1997
), but prepulse-inactivation is simpler than TTX subtraction. Therefore, the relative contributions of the fast and slow currents were estimated using the inflection point in the steady-state inactivation curves (Fig. 1) (Cummins and Waxman 1997
). The inflection point was usually near -50 mV, and the TTX-R current amplitude typically was measured using a 20-ms test pulse to -10 mV after a 500-ms prepulse to -50 mV. The TTX-S current amplitude was estimated by subtracting the TTX-R current (typically obtained with the -50 mV prepulse) from the current elicited with a 20 msec test pulse to -10 mV after a 500-ms prepulse to -120 mV.

View larger version (22K):
[in a new window]
FIG. 1.
Families of traces from representative control (A), Ringer-treated axotomized (B), and nerve-growth factor (NGF)-treated axotomized (C) neurons are shown. Currents were elicited by 20-ms test pulses to
10 mV after 500-ms prepulses to potentials over the range of
130 to
10 mV. Corresponding steady-state inactivation curves are shown for control (D), Ringer-treated axotomized (E), and NGF-treated axotomized (F) neurons. Two current components can be resolved easily in control and NGF-treated axotomized cells: a slowly inactivating component that has a relatively depolarized voltage dependence of inactivation and a fast inactivating component that has a more negative voltage dependence of inactivation. Dashed lines in D and F indicate the point of inflection in steady-state inactivation curves, which are bimodal for these cells because of the different inactivation properties of the 2 sodium current components. Ringer-treated axotomized cell appears to exhibit predominantly fast inactivating currents, and the steady-state inactivation curve is not inflected.

View larger version (18K):
[in a new window]
FIG. 2.
Tetrodotoxin-resistant (TTX-R) current density was estimated in control (n = 27), Ringer-treated axotomized (n = 50), and NGF-treated axotomized (n = 60) small dorsal root ganglion (DRG) neurons using prepulse inactivation (500-ms prepulses) and a 0-mV test pulse. A: TTX-R current density was obtained by dividing the estimated peak current by the whole cell capacitance. Cells were assigned to 1 of 3 groups for each condition based on TTX-R current density. B: ratio of the TTX-R current density to TTX-sensitive (TTX-S) current density is shown for the control, Ringer-treated axotomized, and NGF-treated axotomized neurons. Cells were classified according to the ratio.
) was
23 ± 2 mV (n = 15) for control TTX-R currents,
21 ± 2 mV (n = 11) for Ringer-treated axotomized TTX-R currents, and
21 ± 1 mV (n = 15) for NGF-treated axotomized TTX-R currents (Fig. 3D). The V1/2 for steady-state inactivation was
37 ± 1 mV (n = 25) for control TTX-R currents,
36 ± 1 mV (n = 18) for Ringer's-treated axotomized TTX-R currents, and
37 ± 1 mV (n = 41) for NGF-treated axotomized TTX-R currents (Fig. 3E). Thus the TTX-R currents in NGF-treated axotomized neurons appear to have similar properties to those of control neurons.

View larger version (29K):
[in a new window]
FIG. 3.
Families of TTX-R sodium currents recorded from representative control (A), Ringer-treated axotomized (B), and NGF-treated axotomized (C) small DRG neurons. Currents were elicited by test pulses from
80 to +40 in 5-mV steps. Holding potential was
100 mV. TTX-S currents were eliminated using prepulse subtraction. D: normalized current-voltage relationships for the peak TTX-R currents in control (
, n = 15), Ringer-treated axotomized (
, n = 11), and NGF-treated axotomized (×, n = 15) neurons are shown. Error bars indicate standard deviation. E: normalized steady-state inactivation curves for the peak TTX-R currents in control (
, n = 25), Ringer-treated axotomized (
, n = 41), and NGF-treated axotomized (×, n = 18) neurons are shown. Voltage dependence of activation and steady-state inactivation for TTX-R currents from all 3 groups are nearly identical.
-SNS mRNA in Xenopus oocytes is accompanied by the appearance of TTX-resistant, slow sodium currents (Akopian et al. 1996
; Sangameswaran et al. 1996
). Moreover, axotomy of DRG neurons results in a downregulation of
-SNS mRNA that parallels the reduction in TTX-R sodium currents (Dib-Hajj et al. 1996
). To determine whether the changes in sodium currents observed in axotomized in vivo DRG neurons provided with exogenous NGF were accompanied by alterations in
-SNS mRNA levels, these cells were examined by RT-PCR and in situ hybridization cytochemistry.
-SNS and GAPDH, which was used as an endogenous internal control, amplification products migrate slightly faster than the 500- and 700-bp-size markers, respectively, consistent with their predicted sizes of 479 and 666 bp, respectively (Fig. 4A). An increase in
-SNS transcript levels in NGF-treated DRG is reflected by an increased competition with GAPDH manifested as a reduction in the amplification product of the latter (Fig. 4A) and hence an elevated SNS/GAPDH ratio. A total of eight independent amplifications for four separate experiments were analyzed. Analysis of the relative RT-PCR results indicates that NGF-treated axotomized DRG results in higher levels (1.9-fold increase) of
-SNS transcripts compared with those in Ringer-treated axotomized DRG. The mean ± SD ratios of
-SNS/GAPDH products for NGF- and Ringer-treated axotomized DRG samples were 2.83 ± 1.02 and 1.54 ± 0.16, respectively (Fig. 4B). These two means are significantly (P < 0.05) different.

View larger version (44K):
[in a new window]
FIG. 4.
Relative reverse transcription polymerase chain reaction (PCR) quantitation from Ringer- and NGF-treated axtomized DRG. A: representative gel analysis of the coamplified
-SNS and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) products. M, 100-bp standard (Pharmacia). Lanes 1, 2, 5, and 6: PCR products from 2 independent amplifications of cDNA from Ringer-treated axotomized DRG. Lanes 3, 4, 7, and 8: PCR products from 2 independent amplifications of cDNA from NGF-treated axotomized DRG. Gel image was digitized using GelBase 7500 system (UVP) and printed on a Fargo Primera Pro laser color printer (Fargo Electronics) in black-and-white dye sublimation mode. B: mean levels of
-SNS amplification products normalized to GAPDH in 8 independent amplifications of cDNA templates from Ringer- and NGF-treated DRG. Data were extracted from gel analysis of PCR products as shown in A. Error bars represent standard deviations.
-SNS mRNA is expressed abundantly in small (<25 µm diam) neurons from control (nonaxotomized) DRG (Fig. 5A). In contrast, there is an attenuation of the
-SNS hybridization signal in small neurons within Ringer-treated axotomized DRG (Fig. 5B); the reduction in
-SNS signal in small DRG neurons is similar to that observed following transection and ligation of the sciatic nerve without pump implant (Dib-Hajj et al. 1996
). Delivery of exogenous NGF to transected sciatic nerves results in a maintenance of high levels of
-SNS mRNA in small neurons within DRG (Fig. 5C).

View larger version (60K):
[in a new window]
FIG. 5.
-SNS mRNA expression in small neurons in vivo from control and Ringer-treated axotomized and NGF-treated axotomized DRG. A: many small neurons (
) in control DRG express high levels of hybridization signal for
-SNS mRNA. B: signal for
-SNS mRNA is attenuated in small neurons (
) in Ringer-treated axotomized DRG. C: NGF-treated axotomized small DRG neurons (
) express high levels of
-SNS mRNA. Magnification, ×300. Bar, 25 µm.
-SNS mRNA in small neurons within sections of control, Ringer- and NGF-treated axotomized DRG was measured by microdensitometry. A total of 292 control, 219 Ringer-treated, and 207 NGF-treated axotomized neurons from three rats were studied. The mean ± SD optical density (OD) signal for
-SNS was significantly lower (P < 0.01) in Ringer-treated axotomized neurons, compared with control neurons. The
-SNS signal was enhanced significantly (P < 0.01) in NGF-treated, compared with Ringer-treated, axotomized neurons (Fig. 7). Similar trends were present and reached statistical significance (P < 0.01) when each of the three individual experiments was analyzed independently. These results are consistent with our RT-PCR observations in demonstrating that exogenous NGF administered to transected sciatic nerve maintains a high level of
-SNS mRNA in small DRG neurons.

View larger version (13K):
[in a new window]
FIG. 7.
Quantification of
-SNS mRNA hybridization signal in small DRG neurons in vivo and in vitro. Mean ± SD optical density (OD) for control (no transection), Ringer-treated axtomized (Ringer), and NGF-treated axotomized (NGF) small DRG neurons in vivo and in vitro is shown graphically. For both in vivo and in vitro conditions, the mean OD for NGF-treated neurons is significantly (P < 0.01; *) greater than that of Ringer-treated neurons.
-SNS mRNA expression in a population of cells more closely corresponding to those that we studied by patch-clamping, in situ hybridization also was performed on cultured DRG neurons derived from control, NGF-treated axotomized, and Ringer-treated axotomized DRG. As with the electrophysiological recordings, in situ hybridization studies were performed on cultured neurons within 24 h of plating.
-SNS hybridization signal (Fig. 6A) similar to those observed within normal DRG tissue. Small neurons cultured from Ringer-treated axotomized DRG show a reduction in the level of
-SNS mRNA expression (Fig. 6B). In contrast, high levels of
-SNS hybridization signal are observed in most small neurons derived from NGF-treated axotomized DRG (Fig. 6C).

View larger version (81K):
[in a new window]
FIG. 6.
SNS mRNA expression in small neurons in vitro from control and Ringer-treated axtomized and NGF-treated axotomized DRG. A: small neurons from control DRG exhibit a high level of
-SNS mRNA expression. B: signal for
-SNS mRNA is reduced in many small neurons derived from Ringer-treated axotomized DRG. C: small neurons cultured from NGF-treated axotomized DRG exhibit increased levels of
-SNS mRNA signal. Magnification, ×300. Bar, 25 µm.
-SNS hybridization signal of cultured small DRG neurons derived from control, Ringer-treated, and NGF-treated axotomized DRG also was quantitated by microdensitometry. A total of 120 control, 219 Ringer-treated, and 108 NGF-treated axotomized small DRG neurons from four separate cultures were studied. The mean ± SD OD signal for
-SNS was significantly lower (P < 0.01) in Ringer-treated axotomized neurons compared with control neurons. The
-SNS signal was enhanced significantly (P < 0.01) in NGF-treated compared with Ringer-treated axotomized neurons (Fig. 7). A decrease in
-SNS signal in Ringer-treated axotomized compared with control neurons and an increase in
-SNS signal in NGF-treated axotomized compared with Ringer-treated axotomized neurons also were present and reached statistical significance (P < 0.05) when each of the four individual experiments was analyzed independently, with one exception in one experiment where the Ringer-treated OD was not significantly lower than the OD for control neurons.
![]()
DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References
-SNS sodium channel, demonstrates that the in vivo administration of exogenous NGF to the proximal peripheral nerve stump of the transected sciatic nerve results in an elevation of the level of TTX-R sodium current after axotomy of these cells. Patch-clamp studies have demonstrated that, in the absence of exogenous NGF, TTX-R current levels are reduced substantially in C-type DRG neurons after axotomy (Cummins and Waxman 1997), and the present results thus demonstrate a partial rescue of TTX-R current expression in small DRG following axotomy by NGF. The results also demonstrate that administration of exogenous NGF to transected sciatic nerve results in an elevation in levels of mRNA encoding the
-SNS sodium channel in small DRG neurons after axotomy. Previous studies have shown that, in the absence of exogenous NGF,
-SNS mRNA levels are decreased substantially in small DRG neurons after axonal injury (Dib-Hajj et al. 1996
). The present results extend, to the in vivo situation, earlier studies that showed that exogenously added NGF attenuates the drop in
-SNS mRNA expression that occurs in C-type DRG neurons in an in vitro model of axotomy after dissociation and cell culturing (Black et al. 1997
). The present results also provide a parallel, in C-type DRG neurons, for previous reports that exogenous NGF attenuates the loss of TTX-R sodium current in myelinated cutaneous afferent DRG neurons (Oyelese et al. 1997
).
), in the present experiments NGF was not applied directly to the DRG neuron cell body but rather administered to its peripheral axon, ~4 cm distal to the soma. These results are consistent with the model that NGF acts as a target-derived trophic factor (Mendell 1995
) provided by cells in the distal nerve stump after injury (Heumann et al. 1987
; Meyer et al. 1992
). Because, in the present study, NGF was applied to the nerve at the site of injury, the effects of NGF on sodium channel gene expression presumably reflect retrograde transport, which has been demonstrated previously (Bhattacharyya et al. 1997
; DiStefano et al. 1993
; Matheson et al. 1997
).
-SNS expression in DRG neurons (Hinson et al. 1997
), and it is well established that Schwann cells can act as sources of neurotrophic factors including NGF (Bandtlow et al. 1987
; Heumann et al. 1987
; Meyer et al. 1993). The effects of exogenously delivered NGF on axotomized DRG neurons in this study were demonstrated both by patch-clamp recording of TTX-R sodium currents and by examination of the expression of
-SNS mRNA with RT-PCR and in situ hybridization. The patch-clamp recordings on these cells reported here confirmed the marked reduction in TTX-R current that has been observed previously in these neurons after axotomy (Cummins and Waxman 1997
) and demonstrated a threefold increase in TTX-R current density in NGF-treated compared with Ringer-treated neurons. However, TTX-R current densities were not fully restored to control values and reached only 54% of the level that was observed in control neurons. Consistent with the electrophysiological observations, our RT-PCR and in situ hybridization experiments both showed a significant upregulation of
-SNS mRNA in NGF-treated compared with Ringer-treated DRG after axotomy. The in situ hybridization experiments might be interpreted as suggesting a restoration of
-SNS mRNA expression, after NGF treatment, to levels close to those in controls. The quantitative difference between the degree of recovery of SNS mRNA levels and TTX-R sodium current levels may reflect technical limitations inherent in the quantitation of in situ hybridization. It is unlikely that our patch-clamp recordings failed to detect electrotonically distant sodium current in cell processes because, with the short culture times that we used, there was very little neuritic growth. It is possible that the difference between patch-clamp and in situ hybridization results may reflect a contribution of posttranscriptional or posttranslational mechanisms to the regulation of functional channel incorporation into the membrane. Precedent for this is provided by observations that suggest that some neurons express
-aminobutyric acid-A (Hales and Tyndale 1994
) or NMDR1 (Sucher et al. 1993
) mRNAs but do not express functional receptors on their surfaces. Deployment of TTX-R sodium channels in DRG neurons, although dependent on NGF, also may require additional neurotrophic factors or other factors. Irrespective of this, the present results are significant in indicating that the NGF-induced increases in TTX-R sodium currents in axotomized DRG neurons are accompanied by a substantial increase in
-SNS mRNA levels. These results suggest that the action of NGF on sodium channel expression in vivo is mediated, at least in part, by transcriptional mechanisms that regulate sodium channel gene expression.
; Oyalese et al. 1997). TTX-R channels display steady-state inactivation that is shifted in a depolarized direction compared with TTX-S channels in DRG neurons (Caffrey et al. 1992
; Cummins and Waxman 1997
; Elliott and Elliott 1993
). Moreover, TTX-R channels underlie a persistent sodium current that may have a depolarizing influence on resting potential, thereby regulating the availability of TTX-S channels in DRG neurons (Cummins and Waxman 1997
). The ratio of TTX-S to TTX-R currents in DRG neurons may be an important determinant of firing properties in these cells.
-subunits II (Mandel et al. 1987; Zur et al. 1995
) and PN1 (D'Arcangelo et al. 1993
; Toledo-Aral et al. 1995
), its effect does not appear to be nonspecific. The mRNA for sodium channel
-subunit III is upregulated in DRG neurons after axotomy (Dib-Hajj et al. 1996
; Waxman et al. 1994
). This upregulation of
-III mRNA is opposed by NGF, which reduces
-III mRNA expression in DRG neurons that have been dissociated, cultured, and maintained in exogenously added NGF-containing medium (Black et al. 1997
). NGF thus appears to upregulate some sodium channel mRNAs inaxotomized DRG neurons, while downregulating other sodium channel mRNAs. DRG neurons express mRNAs for at least six sodium channel
-subunits (Black et al. 1996
). Opposing actions of NGF on expression of different sodium channel subunits, taken together with the present results and the demonstration in PC-12 cells that NGF upregulates
-II and PN1 through distinct signal transduction pathways (D'Arcangelo et al. 1993
), suggest that NGF can modulate the electrogenic properties of DRG neurons via mechanisms that include the positive and negative control, in a specific manner, of various sodium channel genes.
| |
ACKNOWLEDGEMENTS |
|---|
The authors thank B. Toftness for excellent technical assistance.
This work was supported in part by the Medical Research Service, Department of Veterans Affairs, and the National Multiple Sclerosis Society. S. Dib-Hajj was supported in part by a Spinal Cord Research Fellowship from the Eastern Paralyzed Veterans Association. T. R. Cummins was supported in part by a fellowship from the Spinal Cord Research Foundation.
| |
FOOTNOTES |
|---|
Address for reprint requests: S. G. Waxman, Dept. of Neurology, LCI 707, Yale University School of Medicine, New Haven, CT 06510-8018.
Received 6 November 1997; accepted in final form 26 January 1998.
| |
REFERENCES |
|---|
|
|
|---|
-subunit mRNAs.
Mol. Brain Res.
43: 117-131, 1996. [Medline]
-SNS in spinal sensory neurons following axotomy.
Proc. Natl. Acad. Sci. USA
93: 14950-14954, 1996.
- and
1-subunit mRNAs in cultured embryonic DRG neurons following exposure to NGF.
Mol. Brain Res.
30: 97-103, 1995.
This article has been cited by other articles:
![]() |
J. R. A. Wooltorton, S. Gaboyard, K. M. Hurley, S. D. Price, J. L. Garcia, M. Zhong, A. Lysakowski, and R. A. Eatock Developmental Changes in Two Voltage-Dependent Sodium Currents in Utricular Hair Cells J Neurophysiol, February 1, 2007; 97(2): 1684 - 1704. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yu and J. D. Kocsis Schwann Cell Engraftment Into Injured Peripheral Nerve Prevents Changes in Action Potential Properties J Neurophysiol, August 1, 2005; 94(2): 1519 - 1527. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Fang, L. Djouhri, S. McMullan, C. Berry, K. Okuse, S. G. Waxman, and S. N. Lawson trkA Is Expressed in Nociceptive Neurons and Influences Electrophysiological Properties via Nav1.8 Expression in Rapidly Conducting Nociceptors J. Neurosci., May 11, 2005; 25(19): 4868 - 4878. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Craner, J. Newcombe, J. A. Black, C. Hartle, M. L. Cuzner, and S. G. Waxman Molecular changes in neurons in multiple sclerosis: Altered axonal expression of Nav1.2 and Nav1.6 sodium channels and Na+/Ca2+ exchanger PNAS, May 25, 2004; 101(21): 8168 - 8173. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Hains, J. P. Klein, C. Y. Saab, M. J. Craner, J. A. Black, and S. G. Waxman Upregulation of Sodium Channel Nav1.3 and Functional Involvement in Neuronal Hyperexcitability Associated with Central Neuropathic Pain after Spinal Cord Injury J. Neurosci., October 1, 2003; 23(26): 8881 - 8892. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ma, Y. Shu, Z. Zheng, Y. Chen, H. Yao, K. W. Greenquist, F. A. White, and R. H. LaMotte Similar Electrophysiological Changes in Axotomized and Neighboring Intact Dorsal Root Ganglion Neurons J Neurophysiol, March 1, 2003; 89(3): 1588 - 1602. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Cummins, S. D. Dib-Hajj, S. G. Waxman, and D. F. Donnelly Characterization and Developmental Changes of Na+ Currents of Petrosal Neurons With Projections to the Carotid Body J Neurophysiol, December 1, 2002; 88(6): 2993 - 3002. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. Abdulla and P. A. Smith Changes in Na+ Channel Currents of Rat Dorsal Root Ganglion Neurons Following Axotomy and Axotomy-Induced Autotomy J Neurophysiol, November 1, 2002; 88(5): 2518 - 2529. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y H Zhang, M R Vasko, and G D Nicol Ceramide, a putative second messenger for nerve growth factor, modulates the TTX-resistant Na+ current and delayed rectifier K+ current in rat sensory neurons J. Physiol., October 15, 2002; 544(2): 385 - 402. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Leffler, T. R. Cummins, S. D. Dib-Hajj, W. N. Hormuzdiar, J. A. Black, and S. G. Waxman GDNF and NGF Reverse Changes in Repriming of TTX-Sensitive Na+ Currents Following Axotomy of Dorsal Root Ganglion Neurons J Neurophysiol, August 1, 2002; 88(2): 650 - 658. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Moore, T. M. R. Stewart, C. Hill, and S. J. Vanner TNBS ileitis evokes hyperexcitability and changes in ionic membrane properties of nociceptive DRG neurons Am J Physiol Gastrointest Liver Physiol, June 1, 2002; 282(6): G1045 - G1051. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-N. Liu, M. Devor, S. G. Waxman, and J. D. Kocsis Subthreshold Oscillations Induced by Spinal Nerve Injury in Dissociated Muscle and Cutaneous Afferents of Mouse DRG J Neurophysiol, April 1, 2002; 87(4): 2009 - 2017. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Benn, M. Costigan, S. Tate, M. Fitzgerald, and C. J. Woolf Developmental Expression of the TTX-Resistant Voltage-Gated Sodium Channels Nav1.8 (SNS) and Nav1.9 (SNS2) in Primary Sensory Neurons J. Neurosci., August 15, 2001; 21(16): 6077 - 6085. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lei, W. F. Dryden, and P. A. Smith Nerve Growth Factor Regulates Sodium But Not Potassium Channel Currents in Sympathetic B Neurons of Adult Bullfrogs J Neurophysiol, August 1, 2001; 86(2): 641 - 650. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Waxman Acquired channelopathies in nerve injury and MS Neurology, June 26, 2001; 56(12): 1621 - 1627. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lancaster, E. J. Oh, and D. Weinreich Vagotomy Decreases Excitability in Primary Vagal Afferent Somata J Neurophysiol, January 1, 2001; 85(1): 247 - 253. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Cummins, J. A. Black, S. D. Dib-Hajj, and S. G. Waxman Glial-Derived Neurotrophic Factor Upregulates Expression of Functional SNS and NaN Sodium Channels and Their Currents in Axotomized Dorsal Root Ganglion Neurons J. Neurosci., December 1, 2000; 20(23): 8754 - 8761. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Black, S. Dib-Hajj, D. Baker, J. Newcombe, M. L. Cuzner, and S. G. Waxman Sensory neuron-specific sodium channel SNS is abnormally expressed in the brains of mice with experimental allergic encephalomyelitis and humans with multiple sclerosis PNAS, October 10, 2000; 97(21): 11598 - 11602. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Sleeper, T. R. Cummins, S. D. Dib-Hajj, W. Hormuzdiar, L. Tyrrell, S. G. Waxman, and J. A. Black Changes in Expression of Two Tetrodotoxin-Resistant Sodium Channels and Their Currents in Dorsal Root Ganglion Neurons after Sciatic Nerve Injury But Not Rhizotomy J. Neurosci., October 1, 2000; 20(19): 7279 - 7289. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Ritter, C. J. Woodbury, K. Albers, B. M. Davis, and H. R. Koerber Maturation of Cutaneous Sensory Neurons From Normal and NGF-Overexpressing Mice J Neurophysiol, March 1, 2000; 83(3): 1722 - 1732. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kohama, K. Ishikawa, and J. D. Kocsis Synaptic Reorganization in the Substantia Gelatinosa After Peripheral Nerve Neuroma Formation: Aberrant Innervation of Lamina II Neurons by Abeta Afferents J. Neurosci., February 15, 2000; 20(4): 1538 - 1549. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Black, T. R. Cummins, C. Plumpton, Y. H. Chen, W. Hormuzdiar, J. J. Clare, and S. G. Waxman Upregulation of a Silent Sodium Channel After Peripheral, but not Central, Nerve Injury in DRG Neurons J Neurophysiol, November 1, 1999; 82(5): 2776 - 2785. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. D. Luo, S. R. Chaplan, B. P. Scott, D. Cizkova, N. A. Calcutt, and T. L. Yaksh Neuronal Nitric Oxide Synthase mRNA Upregulation in Rat Sensory Neurons after Spinal Nerve Ligation: Lack of a Role in Allodynia Development J. Neurosci., November 1, 1999; 19(21): 9201 - 9208. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Waxman, S. Dib-Hajj, T. R. Cummins, and J. A. Black Sodium channels and pain PNAS, July 6, 1999; 96(14): 7635 - 7639. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fjell, T. R. Cummins, K. Fried, J. A. Black, and S. G. Waxman In Vivo NGF Deprivation Reduces SNS Expression and TTX-R Sodium Currents in IB4-Negative DRG Neurons J Neurophysiol, February 1, 1999; 81(2): 803 - 810. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Dib-Hajj, L. Tyrrell, J. A. Black, and S. G. Waxman NaN, a novel voltage-gated Na channel, is expressed preferentially in peripheral sensory neurons and down-regulated after axotomy PNAS, July 21, 1998; 95(15): 8963 - 8968. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |