|
|
||||||||
The Journal of Neurophysiology Vol. 81 No. 2 February 1999, pp. 611-624
Copyright ©1999 by the American Physiological Society
1Department of Anesthesiology and 2Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, Missouri 63110
| |
ABSTRACT |
|---|
|
|
|---|
Li, Zi-Wei, Jiu Ping Ding, Vani Kalyanaraman, and Christopher J. Lingle. RINm5f cells express inactivating BK channels whereas HIT cells express noninactivating BK channels. Large-conductance Ca2+- and voltage-activated BK-type K+ channels are expressed abundantly in normal rat pancreatic islet cells and in the clonal rat insulinoma tumor (RINm5f) and hamster insulinoma tumor (HIT) beta cell lines. Previous work has suggested that the Ca2+ sensitivity of BK channels in RIN cells is substantially less than that in HIT cells, perhaps contributing to differences between the cell lines in responsiveness to glucose in mediating insulin secretion. In both RIN cells and normal pancreatic beta cells, BK channels are thought to play a limited role in responses of beta cells to secretagogues and in the electrical activity of beta cells. Here we examine in detail the properties of BK channels in RIN and HIT cells using inside-out patches and whole cell recordings. BK channels in RIN cells exhibit rapid inactivation that results in an anomalous steady-state Ca2+ dependence of activation. In contrast, BK channels in HIT cells exhibit the more usual noninactivating behavior. When BK inactivation is taken into account, the Ca2+ and voltage dependence of activation of BK channels in RIN and HIT cells is essentially indistinguishable. The properties of BK channel inactivation in RIN cells are similar to those of inactivating BK channels (termed BKi channels) previously identified in rat chromaffin cells. Inactivation involves multiple, trypsin-sensitive cytosolic domains and exhibits a dependence on Ca2+ and voltage that appears to arise from coupling to channel activation. In addition, the rates of inactivation onset and recovery are similar to that of BKi channels in chromaffin cells. The charybdotoxin (CTX) sensitivity of BKi currents is somewhat less than that of the noninactivating BK variant. Action potential voltage-clamp waveforms indicate that BK current is activated only weakly by Ca2+ influx in RIN cells but more strongly activated in HIT cells even when Ca2+ current magnitude is comparable. Concentrations of CTX sufficient to block BKi current in RIN cells have no effect on action potential activity initiated by glucose or DC injection. Despite its abundant expression in RIN cells, BKi current appears to play little role in action potential activity initiated by glucose or DC injection in RIN cells, but BK current may play an important role in action potential repolarization in HIT cells.
| |
INTRODUCTION |
|---|
|
|
|---|
Membrane ion channels play a central role in the
regulation of secretion of insulin from the beta cells of the
pancreatic islets (Ammala et al. 1997
; Ashcroft
et al. 1994
; Dukes and Philipson 1996
). In
particular, influx of Ca2+ through voltage-dependent
Ca2+ channels appears to be the primary source of
Ca2+ necessary for activation of insulin secretion
initiated by glucose-induced depolarization of beta cells.
Participating with voltage-dependent Ca2+ channels in the
regulation of beta cell electrical behavior is a number of distinct
K+ channels the activity of which serves to control beta
cell resting potential and terminates either single action potentials
or bursts of action potentials. Modulation of various K+
channels, e.g., inhibition or activation of ATP-sensitive
K+ channels (Dukes and Philpson 1996
) or
Ca2+ channels (Love et al. 1998
) appears to
be a major mechanism by which insulin can be regulated.
Several early studies suggested that the Ca2+- and
voltage-dependent BK channels might play an important role in the
regulation of the electrical activity of beta cells with concomitant
effects on secretion (Atwater et al. 1983
). Single BK
channels commonly are found in beta cell membranes (Bokvist et
al. 1990
; Smith et al. 1990
). BK current is
activated rapidly by depolarizing voltage steps particularly when
intracellular Ca2+ buffering approximates physiological
conditions (Satin et al. 1989
). Quinine, a blocker of BK
channels (Mancilla and Rojas 1990
), influences insulin
secretion (Atwater et al. 1979
). Furthermore, in rat
insulinoma tumor (RIN) and hamster insulinoma tumor (HIT) cells, BK
channels were reported to exhibit very different sensitivities to
Ca2+, which was proposed to contribute to the differences
in the ability of glucose to initiate insulin secretion in the two cell
lines (Eddlestone et al. 1989
). Modulatory effects of
glucose on BK channel activity in RIN cells also have been reported
(Ribalet et al. 1988
). On the basis of this earlier
work, some models were proposed suggesting that activation of BK
channels might serve to terminate glucose-initiated bursting (e.g.,
Chay 1990
).
Interest in the role of BK channels in beta cell secretion and
electrical activity waned with the report that blockade of BK channels
by the scorpion toxin, charybdotoxin (CTX), had no effect on beta cell
glucose-stimulated electrical activity or action potential
repolarization (Kukuljan et al. 1991
). The consequences of blockade of BK channels by quinine were discounted because quinine
also blocks other K+ channels (Fatherazi and Cook
1991
; Mancilla and Rojas 1990
). With the
emergence of work demonstrating the central role of ATP-regulated K+ channels in the response to glucose (rev. by Dukes and
Philipson 1996
), further work on the possible roles of BK channels in
beta cells has diminished except for some interest in the possible role
of Ca2+-dependent K+ current in
acetylcholine-mediated regulation of secretion (e.g., Ammala et al.
1991
).
Recently we observed that cells from rat pancreatic islets express both
inactivating and noninactivating variants of BK channel (Lingle
et al. 1996
). Furthermore there are other suggestions in
earlier work that inactivation may be a common feature of rat beta cell
BK channels. For example, both cell-attached recordings of single BK
channels and whole cell Ca2+- and voltage-dependent
K+ currents exhibit inactivation (Satin et al.
1989
; Smith et al. 1990
), although the
conditions of the earlier results allowed the possibility that the
apparent inactivation may have been secondary to changes in submembrane
Ca2+. In addition, the dependence of BK channel activation
on Ca2+ in rat beta cells is unusually flat
(Tabcharani and Misler 1989
), a result expected for
inactivating BK channels. Thus the previously described difference in
Ca2+ sensitivity between BK channels in HIT and RIN cells
(Eddlestone et al. 1989
) may have resulted, in part,
from the presence of inactivating BK channels in RIN cells.
Here we have reexamined RIN and HIT cell BK channels to determine
whether some fundamental difference in inactivation behavior may
account for the apparent difference in Ca2+ sensitivity.
Our results indicate that RIN cells almost exclusively express the
inactivating BKi channel, whereas only noninactivating BK
channels are found in HIT cells. However, the basic Ca2+
dependence of activation does not appear to differ among the two
variants. The inactivation behavior of BKi channels in RIN cells appears essentially indistinguishable from the behavior of
BKi channels in rat chromaffin cells (Lingle et al.
1996
; Solaro and Lingle 1992
; Solaro et
al. 1995
, 1997
).
| |
METHODS |
|---|
|
|
|---|
Preparation of RIN and HIT cell cultures
RIN m5F cells [obtained from the American Type Culture Collection (ATCC) and from the Washington University Tissue Culture Center] were grown in RPMI 1640 medium containing 1% glucose, 1% sodium pyruvate, 1% nonessential amino acids, and 10% fetal calf serum. HIT cells (also obtained from the Washington University Tissue Culture Center) were grown in Ham's F12 K medium with 2.5% fetal calf serum and 10% dialyzed horse serum. Cells were passaged when confluent using a 0.05% trypsin-0.02% EDTA solution and kept under an atmosphere of 5% CO2 at 37°C. RIN cells were used at a passage number between 20 and 30. For HIT cells, the passage number was between 60 and 70.
Electrophysiological methods
Whole cell and single-channel currents were recorded with
standard techniques (Hamill et al. 1981
) as reported
previously (Herrington et al. 1995
; Solaro and
Lingle 1992
; Solaro et al. 1997
). In whole cell
experiments, uncompensated series resistance (Rs) was typically 1.5-5 M
of which 80-95%
was electronically compensated. In perforated-patch experiments
(Horn and Marty 1988
), amphotericin was used as the
permeabilizing agent as described (Herrington et al.
1995
). Values for Rs in perforated-patch
experiments were in the range of 8-15 M
of which 80-95% was
electronically compensated.
Solutions
The extracellular solution contained the following (in mM): 140 NaCl, 5.4 KCl, 10 N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES), 1.8 CaCl2, and 2.0 MgCl2, pH
7.4, adjusted with N-methylglucamine (NMG). When BK current
was recorded with elevated pipette Ca2+, the extracellular
solution bathing the cell contained (in mM) 150 NaCl, 5.4 KCl, 4 MgCl2, and 10 HEPES, adjusted to pH 7.4 with NaOH. For
whole cell recording, the pipette solution contained the following (in
mM): 160 KCl, 10 HEPES, and 10 mM
N-hydroxyethylethylene-diaminetriacetic acid (HEDTA) with
added Ca2+ to make 10 µM free Ca2+ as defined
by the EGTAETC program (E. McCleskey, Vollum Institute, Portland, OR),
with pH adjusted to 7.0. In some cases, KCl was removed partially from
intracellular solutions with equimolar substitution of NaCl and/or CsCl
to reduce the magnitude of BK current. When used, trypsin (0.5 mg/ml;
porcine pancreatic type IX, Sigma, St. Louis, MO) was added to
the normal 10 µM Ca2+ cytosolic solution. Trypsin
digestions were limited to brief 3- to 5-s applications to inside-out
patches. After exposure to trypsin, periods of
10 s of wash with
normal 10 µM Ca2+ cytosolic solution without trypsin
preceded the acquisition of ensemble currents.
For all solutions, osmolarity was measured by dew point (Wescor
Osmometer) and adjusted within 3% (internal saline, 290; external saline: 305). Although we have not explicitly tested for the presence of SK currents in these cells, 200 nM apamin was added routinely to
extracellular solutions to minimize any possible contamination by SK
currents (Neely and Lingle 1992
). Similarly, 1 mM
4-aminopyridine (4-AP) was included to reduce possible contamination by
voltage-dependent K+ current. Tetrodotoxin (TTX; 200 nM)
was used to reduce voltage-dependent Na+ current. For whole
cell recordings, no correction was made for the +3 mV liquid junction
potential that arose when chloride-based pipette salines were used for
introducing 10 µM [Ca2+] into cells.
For recordings of channel activity in patches, cells were bathed in the
extracellular saline used for whole cell recordings. Just before patch
excision, the solution bathing the cell was changed to the 0 Ca2+ saline (described next). For inside-out single-channel
recordings, the pipette saline contained (in mM) 140 KCl, 20 KOH, 2 MgCl2, 10 HEPES, pH 7.0, adjusted with 1 N HCl. Apamin (200 nM) also was included in the pipette solution. The cytosolic saline
used during excised inside-out patch recordings was the following (in mM): 140 KCl, 20 KOH, 10 HEPES, and 5 HEDTA with added
CaCl2 to make 10 µM free [Ca2+], with pH
7.0, adjusted with 1 N HCl. Estimates of free [Ca2+] were
determined as described previously (Herrington et al.
1995
; Solaro and Lingle 1992
).
No attempts were made to block the activity of K-ATP channels in either inside-out patches or in whole cell recordings. However, as seen in the traces of Figs. 1, 5, and 6, under the conditions of our experiments, such contamination appears to be minor in inside-out patches.
Solution exchange and drug applications were accomplished as described
previously (Herrington et al. 1995
). Chemicals were from
Aldrich or Sigma.
Data analysis
Analysis of whole cell and single-channel currents was done
either with Clampfit (Axon Instruments, Foster City, CA) or with our
own software. Currents or extracted data were fitted using a
Levenberg-Marquardt search algorithm to obtain nonlinear least-squares estimates of function parameters. Estimates of the apparent CTX dissociation constant were made by fitting the complete time course of
blockade at one or more drug concentrations to a first-order blocking
reaction as described (Saito et al. 1997
).
Conductance-voltage (G-V) and fractional availability curves
were fit with the following form of a Boltzmann equation
|
(1) |
G-V curves were generated by measuring the maximal current at any command potential and converting that to a conductance assuming a reversal potential of 0 mV (symmetric K+). This method has limitations but is sufficient for providing a qualitative comparison of the HIT and RIN cells currents under study here. In general, the use of tail currents measured at a fixed potential after current activation at different potentials would provide a better measure of conductance because the tail current method would correct for any nonlinearities in the single-channel current or errors due to voltage-dependent channel block. However, given the inactivating nature of BKi current, the time of peak current activation varies considerably at different activation potentials such that repolarization at a fixed time would inherently underestimate the maximal conductance at some potentials. Furthermore tail currents at negative potentials were not sufficiently well resolved to be reliable for conductance estimates.
Extraction of total RNA and the reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA was isolated by a modified Chomczynski and Sacchi method (TRIzol Reagent, Life Technologies, Grand Island, NY). A monolayer of cells from a single 35-mm culture dish (~107) was used for RIN cell and HIT cell RNA preparation. Total RNA from chromaffin cells was extracted from freshly isolated adrenal glands (50-100 mg tissue). Comparable amounts of RNA were used to synthesize first strand cDNA (Superscript II, Life Technologies) using oligo(dT) primers. One microliter of the product of the reverse transcriptase reaction was used in a PCR reaction using primers flanking the splice junction 2 to detect the presence of alternatively spliced variants. Two sets of primer sequences were used in different experiments to examine splice junction 2 variability. The first primer sequences (termed mSlo 3 and 4) were TACTGCAAGGCCTGTCATGATGACC(sense) and GGTGTTGGGCGAGTTCCTCATGCC(antisense). The second set of primer sequences (termed mSlo 14 and 15) was as follows: CATCGCAAGTGATGCCAAAG (sense) and CGACTACTCCGTACTGGGGAAC (antisense).
Identification of splice site 2 variants
Products of the RT-PCR reaction were run out on 2% agarose gels to purify the bands of interest. Because Pfu polymerase was used for the RT-PCR, the fragments were blunt-ended and could be subcloned into pZero-1 (Invitrogen, Carlsbad, CA), which had been digested with EcoRV (New England Biolabs, Beverly, MA). PCR screening was carried out using the same primers as in the RT-PCR reaction. Those subclones, which had an insert, were sequenced using the dideoxy method of DNA sequencing (Sequenase Version 2.0, Amersham, Arlington Heights, IL). Primers used were SP6 and T7, which were vector-specific forward and reverse primers, respectively.
| |
RESULTS |
|---|
|
|
|---|
BK channels in RIN cells exhibit inactivation, whereas HIT cell channels are noninactivating
Previous studies of BK channels in beta cell patches have
generally used recordings at a fixed holding potential and submembrane Ca2+. This procedure will obscure any rapid time- and
voltage-dependent gating behavior. Here, inside-out patches were held
at
40 mV with 10 µM Ca2+ bathing the cytosolic face of
the patch. Figure 1A
illustrates the typical behavior of BK channels in a RIN cell patch.
After a 100- or 200-ms step to
80 mV, a subsequent step to +80 mV was used to activate BK channels before returning to
40 mV. An interval of 2 or 3 s separated each step to +80 mV. BK channels exhibit rapid activation followed by a slower, but complete, inactivation. The
inactivation time constant (
i) from exponential fits to
the decay phase of the ensemble current was ~20-30 ms at +80 mV and 10 µM Ca2+ (e.g., Fig. 1B). In contrast, when
BK channels from patches for HIT cells were studied using identical
procedures, no indication of inactivation was observed (Fig.
1C; 139 patches).
|
In the following sections we examine the properties of inactivation of
BK channels in RIN cells to determine to what extent this inactivation
process is similar to the previously described BKi channels
in rat chromaffin cells (Ding et al. 1998
; Solaro and Lingle 1992
; Solaro et al. 1995
, 1997
).
Onset and recovery of inactivation of RIN cell BK channels
Ensembles of BK channel openings were generated at a single
command potential over a range of submembrane [Ca2+]
(Fig. 2A) and at a single
submembrane [Ca2+] ([Ca2+]i)
over a range of activation voltages (Fig. 2C).
i decreases both with increases in
[Ca2+]i and with stronger depolarizations.
When
i is examined as a function of
[Ca2+]i at a single activation voltage, a
limiting
i is reached indicative that any intrinsic
Ca2+ dependence in the inactivation process is saturated
(Fig. 2B). Similarly, when
i is examined at a
single [Ca2+]i over a range of activation
potentials,
i approaches a limiting value indicating
that the underlying inactivation process exhibits little intrinsic
voltage dependence (Fig. 2D). The absolute values of
i under the different conditions of voltage and
[Ca2+] are quite comparable with those observed for
BKi channels in rat chromaffin cells studied under
identical conditions (Solaro and Lingle 1992
;
Solaro et al. 1995
).
|
The time course of the recovery from inactivation of RIN cell
BKi channels was examined in inside-out patches bathed with 10 µM Ca2+. After an initial 160-ms step to
140 mV, a
400-ms step to +60 was used to first activate and then inactivate
BKi channels. After a variable recovery period at
120 mV,
the patch was again stepped to +60 mV to determine the fraction of
channels that recovered from inactivation during the recovery period.
Examples of ensemble currents generated by this protocol are shown in
Fig. 3A, and the fractional
recovery time course for a set of patches is plotted in Fig.
3B. At this recovery potential with 10 µM
Ca2+, the time constant was ~15 ms, comparable with the
time constant of recovery of chromaffin cell BKi channels
examined under similar conditions (Ding et al. 1996
;
Ding and Lingle, unpublished data).
|
The voltage dependence of BKi channel availability also was
studied with 10 µM Ca2+. Ensembles of channels activated
at +60 mV were generated after conditioning steps of variable length to
potentials between
200 and
10 mV. The duration at any conditioning
potential was adjusted to allow near steady-state conditions to be
achieved. Examples of ensemble currents for one patch and the resulting
average fractional availability curve for five patches are shown in
Fig. 3, C and D. At 10 µM Ca2+,
BKi channels in RIN cells are half inactivated at
67.3 ± 1.4 mV, with a voltage dependence of 20.0 ± 1.2 mV. These values are comparable with those from chromaffin cell BK
channels studied in a similar fashion (Ding et al. 1996
;
Ding and Lingle, unpublished results).
Inactivation of BKi channels in RIN cells involves multiple trypsin-sensitive, cytosolic domains
Gomez-Lagunas and Armstrong (1995)
have used the
introduction of trypsin into cells transfected with Shaker
K+ channels to show that the progressive removal of
inactivation by trypsin is consistent with there being four
inactivation domains per channel. Similarly, inactivation of
BKi channels in rat chromaffin cells appears to involve
multiple, cytosolic trypsin-sensitive domains (Lingle et al.
1996
) but with the difference that, on average, BKi
channels in chromaffin cells contain less than a full four inactivation
domains per channel (Ding et al. 1998
), perhaps because
of heteromultimeric assembly of inactivation-competent and
noninactivating subunits.
The effect of cytosolic applications of trypsin on inactivation of BK
channels in RIN cells was examined by similar procedures. Ensemble
current averages were generated with repeated voltage steps to +60 mV
after a 200-ms conditioning step to
140 mV to remove resting
inactivation. Each ensemble was interspersed with a brief application
of trypsin. Figure 4A shows 11 separate ensemble averages during such an experiment in which trypsin
application eventually resulted in complete removal of inactivation.
Partial digestion by trypsin resulted in a slowing of inactivation and an increase in the fraction of maximal BK current, which was
noninactivating. This slowing of inactivation is consistent with an
inactivation mechanism mediated by multiple, trypsin sensitive
inactivation domains (Gonoi and Hille 1987
). The
prolongation of inactivation time constant as a function of the
fraction of maximal current that is noninactivating
(fss) provides an indication of the number of
inactivation domains that may participate in the inactivation process
(Ding et al. 1998
; MacKinnon et al.
1993
). The relationship between the prolongation in
i as a function of fss is plotted in Fig. 4B for the cell shown in Fig. 4A along
with theoretical predictions for the relationship based on the
assumption of an initial average number of inactivation domains per
channel of 3.2-4.0 (see Ding et al. 1998
). Similar results also are
plotted for three other patches (Fig. 4B) in which removal
of inactivation by trypsin was almost complete. The results suggest
that in RIN cells BKi channels contain, on average, close
to four inactivation domains per channel.
|
Native inactivation process is not slowed by cytosolic blockers of BK channels
Rapid inactivation of the Shaker family of
voltage-dependent K+ channels involves an N-terminal domain
that is thought to occlude the cytosolic mouth of the ion permeation
pathway (Hoshi et al. 1990
). Supporting this view,
cytosolic blockers of Shaker K+ channels slow
the native inactivation process (Choi et al. 1993
), presumably by competing with the native inactivation domain for an
overlapping binding site. In contrast, inactivation of BKi channels in chromaffin cells is not slowed by a number of different cytosolic blockers of BK channels, including tetraethylammonium, QX-314, and the ShakerB ball peptide (Lingle
et al. 1996
; Solaro et al. 1997
). Here, we have
examined the ability of QX-314 to influence the inactivation process of
inactivating BK channels in RIN cells (Fig.
5). If a cytosolic blocker competes with
the normal inactivation domain for a site in the channel, this
competition can be described by the following kinetic scheme where B is
the QX-314 blocked state, O is the open state, and I is the inactivated state
|
i is the channel inactivation rate,
f* is the rate of association of drug (D), and
b is the rate of dissociation. In accordance with this
scheme, if the properties of the blocking reaction are rapid relative
to the rate of current inactivation (
i), the slowing of
the apparent inactivation rate will exhibit a simple inverse dependence
on the fractional reduction in ensemble average current amplitude
(Choi et al. 1993
QX = 1/(k *
i) and IQX = k * Ictrl where
QX
is the current decay time constant in the presence of QX-314,
IQX and Ictrl are peak
ensemble current amplitudes in QX-314 and control salines, and
k is the fraction of unblocked channels given by
b/(b + f[QX]).
|
QX-314 is a relatively bulky cytosolic blocker of BK channels
(Oda et al. 1992
) and produces a rapid,
time-averaged reduction of the BK single-channel current amplitude. As
indicated in Fig. 5, an ~60% reduction of the ensemble average
current amplitude correlates well with an ~67% reduction in the
apparent single-channel current amplitude. This correlation indicates
that QX-314 meets the criterion that the kinetics of the blocking
reaction are rapid, relative to the onset of inactivation. Therefore,
if QX-314 competes with the native inactivation process, any
x-fold reduction in the ensemble average current is expected
to be associated with an x-fold prolongation of the
inactivation time course. As shown in Fig. 5, QX-314 has no effect on
the time course of the inactivation process even at a concentration
producing a more than twofold reduction in peak current. We conclude
that occupancy of a cytosolic binding site at the internal mouth of the
permeation pathway does not hinder the native inactivation process.
Frequency of occurrence of BKi channels in RIN cell patches
In rat adrenal chromaffin cells, although most patches express
exclusively inactivating BKi channels, there is some
likelihood that noninactivating BKs channels will be
observed in patches with BKi channels (Ding et al.
1998
). We have proposed that BKi channels in rat
chromaffin cells arise from heteromultimeric assembly of two BK
subunits, an inactivation-competent bki subunit
and an inactivation-null bks subunit
(Ding et al. 1998
). The overall frequency of occurrence
of BKs channels in patches with BKi channels is
consistent with a stoichiometry of about two to three
bki subunits per channel with a probability of
observing a BKs channel being about 1/16 to 1/256. Here we
have attempted to place some limits on the possible frequency of
occurrence of BKs channels in RIN cell patches.
Because of the large number of BKi channels in most of the patches we have obtained from RIN cell membranes, we only can provide rough estimates of the number of BKi channels in many patches. As the criterion for the presence of a BKs channel, we have required that a channel be open at the end of a 200-ms voltage step to +80 mV in >80% of the voltage steps. By choosing a depolarizing voltage-step duration that is sufficiently long relative to the mean inactivation time constant of BKi channels, one can define conditions where it is unlikely that a BKi channel will be open at the end of any voltage sweep. Having defined those conditions, one then can determine the number of BKs channels in a patch simply from the number of BK channels that remain active at the end of the voltage step in >80% of a set of voltage steps.
Figure 6 illustrates this approach for
one patch, which contained 14 BKi channels. Three criteria
were used to establish the number of channels in this patch. First, the
maximal number of channels observed in any individual sweep was 14. Under conditions where the probability of a channel being open is high,
this number provides a reasonable estimate of the number of channels in
a patch (Horn 1991
). Second, the mean number of open
channels in a set of 30 sweeps and the variance was used to calculate
the number of channels in this patch. This method of moments estimate (Horn 1991
) yielded a value of 13.6. Finally, a fit of a
binomial function to the binned distribution of number of occurrences
of n channels for a set of 30 trials yielded a value for
N, the number of channels in the population of 12.3 with a
peak average open probability of 0.82. Thus under the conditions of
these experiments, i.e., after a hyperpolarizing prepulse to
140 mV
to remove most channels from inactivation, this analysis indicates that
the maximum number of open channels observed in a set of sweeps
provides a reasonable estimate of the number of channels in the patch.
Furthermore despite the fact that there are 14 channels present in the
patch of Fig. 6, once all channels have inactivated, the percentage of
sweeps with openings at the end of the 400-ms voltage step is small.
Thus this patch shows no evidence of a channel that would be considered
a BKs channel.
|
To evaluate the relative frequency of occurrence of BKi and
BKs channels in RIN cell patches, we have estimated the
maximal number of BK channels from 57 patches during 400-ms steps to
+80 mV after a 160-ms step to
140 mV. The maximal peak current for this set of patches ranged from 21 to ~332 pA (143.1 ± 91.3 pA, mean ± SD). This is consistent with there being at least 1 to ~15 channels in each patch (6.7 ± 4.7 channels), with a
single-channel current amplitude of ~22.8 pA. The actual channel
number in patches with large peak currents probably is underestimated.
For this set of 57 patches, the total number of BK channels was
384.
In only one of these 57 patches was there any indication of a BK channel that appeared to remain open during the 400-ms depolarizing voltage steps. This channel occurred in a patch with a total of 12 BK
channels. In 21 of 100 steps to +80 mV, 1 of the 12 channels remained
active during the entire voltage step. The occurrence of the
noninactivating behavior was nonstationary in that 15 of the sweeps
with a noninactivating channel were consecutive.
Let us assume that, for this set of 57 patches, 1 of 384 channels was
of a BKs phenotype. This frequency of occurrence of BKs channels in RIN cell patches is substantially less than
what has been observed previously in rat chromaffin cells (Ding
et al. 1998
). If, as has been proposed for chromaffin cells, BK
channels in RIN cells can arise from the random, independent assembly
of inactivation-competent (bki) and
noninactivating (bks) subunits in which one
bki subunit is sufficient to confer inactivation on a channel (Ding et al. 1998
), the relative occurrence
of BKs channels would provide some information about the
relative abundance of bki and
bks subunits in these cells. Even at a ratio of
4 bki subunits to 1 bks
subunit, random, independent assembly into tetrameric channels would
predict that only 1 of 500 BK channels would be noninactivating. At a
ratio of 3 bki subunits to 1 bks subunit, this model predicts that 1 of 256 BK channels would be noninactivating. Thus even with only 1 possible
BKs channel of 384 channels, the actual mole-fraction of
bks subunits still may be appreciable. This
would be consistent with the idea that BKi channels in RIN cells may contain a reasonable number of bks
subunits, perhaps consistent with some variability in inactivation
rates we have observed for these patches and with the trypsin digestion
experiments (Fig. 4). On the other hand, given the uncertainty about
the noninactivating nature of the one putative BKs channel,
our estimate of the frequency of occurrence of the putative
bks subunit may be high.
Ca2+ dependence of BK channel activation is similar in RIN and HIT
Previous estimates of Ca2+ dependence of BK activation
in RIN cells used steady-state measurements of channel open probability (Eddlestone et al. 1989
). Here, to define the
Ca2+-dependence of BK activation in patches from RIN cell
membranes, ensemble average currents were generated with 10 and 60 µM
Ca2+ at different command potentials before and after
removal of inactivation by trypsin. For comparison, similar currents
were generated for BK channels in patches from HIT cell membranes. Peak
current was converted to estimates of normalized membrane conductance
assuming a 0-mV reversal potential. In Fig.
7A, G-V curves
calculated from the peak current values for BKi channels in
RIN cell patches and BKs channels in HIT cell patches are
plotted for 10 and 60 µM Ca2+. Increases in
[Ca2+]i result in the typical leftward shift
of the G-V curve to more negative potentials. At 10 µM
Ca2+, values for V0.5 were 42.9 and
22.7 mV for RIN and HIT cells, respectively. At 60 µM
Ca2+, values for V0.5 were
47.5
and
37.3 mV for RIN and HIT cells, respectively. The HIT cell
G-V curves were somewhat more voltage dependent than the RIN
cell curves with values for voltage dependence given in the legend.
|
Because of the inactivating nature of the BKi channels,
inactivation before the time of peak current may differ at different activation potentials, thereby distorting the shape of the true G-V relationship. Therefore, in a separate set of patches,
G-V curves were determined with 10 µM Ca2+
both before and after removal of inactivation with trypsin. The V0.5 before trypsin was indistinguishable from
the previous set of patches (45.0 mV) and, after removal of
inactivation by trypsin, the V0.5 was shifted to
11.8 mV. As indicated by the values given in the figure legend, removal
of inactivation by trypsin also resulted in an increase in the
steepness of the G-V curves. The G-V curves
before and after trypsin are compared with the G-V obtained
for the set of HIT cell patches in Fig. 7B. These results do
not allow us to determine whether this shift after trypsin application
is due simply to removal of inactivation or to some other effect of
trypsin on BK gating. In previous work, no clear effect of trypsin on
activation of BKi channels was observed (Solaro et
al. 1995
). Trypsin also was introduced into three HIT cells to
test for nonspecific effects on BK gating. In each case, the V0.5 after trypsin was within 10 mV of the
V0.5 before trypsin, with a noticeable increase
in leak current in each case.
Overall, the differences seen here between the G-Vs measured
for HIT cells and RIN cells are rather minor in comparison with the
large differences reported in earlier work (Eddlestone et al.
1989
). In fact, the G-Vs at 60 µM are essentially
indistinguishable, whereas at 10 µM the RIN cell G-Vs
measured either with inactivation intact or inactivation removed
bracket the G-V obtained from the HIT cell patches. Thus on
balance, any differences in the intrinsic Ca2+ dependence
of activation between the BKi channels of the RIN cells and
the BKs channels of the HIT cells seem inconsequential.
CTX-sensitivity of BKi channels in RIN cells is less than of BKs channels in HIT cells
Earlier studies have indicated that noninactivating BK channels in
beta cells (Kukuljan et al. 1991
) exhibit a CTX
sensitivity comparable with that of other systems. Because
BKi channels in chromaffin cells exhibit a reduced
sensitivity to CTX (Ding et al. 1998
), inactivating BK
channels in RIN cells also may exhibit a reduced sensitivity to CTX
that might complicate interpretation of previous results with CTX. To
address this issue, BK current was elicited in whole cell recordings by
voltage steps to +90 mV with 10 µM pipette Ca2+. This
protocol activates a prominent transient outward current and a
sustained voltage-dependent K+ current. In the absence of
pipette Ca2+, any inactivating voltage-dependent outward
current decays with a much slower time course than the inactivating
current in the presence of 10 µM pipette Ca2+. Thus the
rapidly inactivating current appears to be solely BK current.
Application of CTX produces a reduction of the transient outward
current with small or negligible effects on the sustained outward
current (Fig. 8A). The time
course of onset of block by CTX and recovery from block were fit with a
simple blocking model (see METHODS) to provide an estimate
of the apparent IC50 of block (Fig. 8B).
Assuming that the persistent noninactivating current defines the zero
BK current level, the example shown results in an IC50 of
17.9 nM. This estimate is largely determined by the time course of
block onset and recovery and less influenced by the steady-state level
of block. For five RIN cells with macroscopic inactivation time
constants of
30 ms, the mean IC50 was 27.9 ± 9.5 nM. Figure 8C illustrates a similar experiment from a HIT cell. No transient outward current is observed with 10 µM pipette Ca2+. CTX produces a more rapid block of outward current.
For the HIT cells, the steady-state level of block with 100 nM CTX was used to estimate the zero BK current level. From a fit to the time
course of onset and recovery from block by 20 nM CTX, the IC50 for blockade of this HIT cell BK current was ~2.4
nM. For four HIT cells, the IC50 = 2.7 ± 0.2 nM. Thus
BK current in RIN cells is more resistant to blockade by CTX than BK
current in HIT cells, although the procedure yields less certainty
about the exact concentration dependence of the RIN cell BK current.
|
Activation of BK current and its participation in electrical activity of RIN cells
Comparison of Fig. 8, A and C, suggests that with 10 µM pipette Ca2+, the peak amount of BK current activated in RIN and HIT cells is comparable. However, on average this is not the case. For eight RIN cells studied with the method of Fig. 8, peak BK current in RIN cells at +90 mV was 254.2 ± 124.0 pA/pF. In contrast, for four HIT cells, peak BK current was 640.9 ± 161.8 pA/pF. Given the different properties of activation of BK channels between RIN and HIT cells, we next wished to address two issues: the extent to which Ca2+ influx may trigger BK current activation in the two cell types and the extent to which BK channels may participate in controlling normal electrical activity.
As a first step, we examined the ability of Ca2+ influx to elicit BK current activation in RIN cells. A protocol was used in which Ca2+ influx was first elicited by a voltage step to +10 mV (Fig. 9A, bottom). A subsequent step to +90 mV then was used to terminate Ca2+ influx but allow examination of the amount of BK current activated during the influx step. Currents were elicited either in the presence of 2 mM Ca2+ or without. Little Ca2+-dependent current was evident at +10 mV, but the step to +90 mV reveals activation of an inactivating Ca2+-dependent current (Fig. 9A, top). The difference between traces in 2 mM Ca2+ and 0 Ca2+ reveals exclusively the Ca2+-dependent component of current (Fig. 9A, middle). The result indicates that Ca2+ influx produces some activation of BK current, but at modest activation potentials (+10 mV), Ca2+-independent currents appear to dominate the outward current. A similar experiment for a HIT cell is shown in Fig. 9B. In this case, appreciable Ca2+-dependent outward current is activated during the voltage step to +10 mV and during the subsequent step to +90 mV.
|
We next examined whether BK current activation may occur during normal action potential waveforms. This issue was addressed using the perforated-patch recording method to maintain a more normal intracellular milieu. An action potential waveform, recorded from a RIN cell, was used as a voltage-clamp command (Fig. 10C) both for RIN cells (Fig. 10A) and for HIT cells (Fig. 10B). It should be noted that we could not elicit directly any action potentials in HIT cells using depolarizing voltage steps, presumably because of the minimal voltage-dependent Na+ current present in these cells (see Fig. 9B). During action potential clamp experiments, inward Na+ current was blocked with TTX; apamin and 4-AP were used to block different components of outward current. Currents resulting from the action potential clamp waveform were recorded both with and without 1.8 mM extracellular Ca2+ (Fig. 10, Aa and Ba) and with and without 100 nM CTX (Fig. 10, Ac and Bc). Despite the resistance of BKi current in RIN cells to CTX, 100 nM CTX should block most BKi current. Difference currents between control and 0 Ca2+ traces provide an approximation of the current resulting solely from Ca2+ and BK channels (Fig. 10, Ab and Bb). Difference currents between control and CTX traces provide an approximation of the BK current activated during individual action potentials (Fig. 10, Ad and Bd). Subtraction of the BK current from the traces containing Ca2+ and BK currents yields an estimate of the time course of Ca2+ current during the action potential waveform (Fig. 10, Ae and Be).
|
In the RIN cells, either removal of Ca2+ or addition of CTX produced only small changes in the total outward current activated during normal action potential waveforms. Yet it is clear that there is some Ca2+-sensitive current and CTX-sensitive current that are activated both during the upstroke of the action potential and during the action potential repolarization. This is revealed most clearly in the difference currents between the control and test conditions (for removal of Ca2+, Fig. 10Ab; for CTX, Fig. 10Ad). This argues that some BK current can be activated during normal RIN cell action potentials, although the BK current is only a minor contributor to the total outward current. However, in marked contrast to the RIN cells, there is a robust activation of BK current in HIT cells using the same action potential clamp waveform. Furthermore in HIT cells BK current appears to be the major contributor to outward current during the action potential. Interestingly, despite the differences in BK current activation between the RIN and HIT cells shown in Fig. 10, the amount and time course of Ca2+ current activation in the two cases is remarkably similar (Fig. 10, Ae and Be). Results similar to those shown in Fig. 10 were obtained from two other RIN cells and four other HIT cells. In both cell types, the total amount of Ca2+ current activated during action potential waveforms was similar.
To examine the role of BK current activation in normal electrical
activity, two procedures were used: first the effect of CTX on
glucose-induced action potential firing in RIN cells and second the
effect of CTX on depolarization-elicited action potentials. Although
previous work has shown that 10 and 20 nM CTX has little effect on such
activity (Kukuljan et al. 1991
), we wanted to determine whether a more complete block of BK current might reveal some role of
BK current. As a consequence, after 20 mM glucose was used to elicit
burst activity in RIN cells (Fig.
11A), 200 nM CTX was applied
for
5 min. Similar to previous work (Kukuljan et al.
1991
), we observed no significant effect of CTX on electrical activity initiated by glucose application. In Fig. 11B, an
expanded time base trace of action potentials with glucose alone and
after CTX application reveal no clear differences. Furthermore, the peak action potential amplitude and the peak afterhyperpolarization after individual action potentials were unaffected by CTX (Fig. 11C). Similar results were obtained in four cells, although
in two cases slight effects on afterhyperpolarization amplitude were observed.
|
Action potentials also were elicited by sustained depolarizing current injections (Fig. 10D). Such depolarizations elicited action potentials at frequencies of up to ~5-10 Hz. A 5-min application of 100 nM CTX produced no clear alteration in the electrical activity. Specifically, firing frequency was relatively unchanged, and there was no change in the properties of afterpolarizations following action potentials. In HIT cells, depolarizing current injection failed to elicit any action potentials.
Slo splice variants in HIT and RIN cells
BK channels are encoded by the Slo gene product
(Butler et al. 1993
), and RNA from rat chromaffin cells
contains an alternative splice Slo variant encoding a unique
59-amino-acid cysteine-rich domain (Saito et al. 1997
).
This alternative splice variant to the Slo splice site 2 is
similar to a variant also found in human pancreatic islets
(Ferrer et al. 1996
), although some amino acid differences occur between the two forms. Because of the presence of the
59-amino-acid insert in chromaffin cells, a possible role of this
insert in contributing to the inactivating phenotype has been
considered (Saito et al. 1997
). Because RIN and HIT
cells exhibit contrasting BK current phenotypes, we wished to determine whether the presence or absence of the 59-amino-acid insert might correlate with a particular current phenotype.
Here, we therefore have examined splice site 2 variants in RIN and HIT
cells. Primer set Slo 3,4 flanking the splice site 2 region
was used first to generate PCR products from RIN cell, HIT cell, and
rat chromaffin cell RNA. Products were separated on agarose gels. From
all three RNA sources, bands of ~130 bp were observed; this
corresponds to the expected size of the splice site 2 variants
containing either no added amino acids or a 3-amino-acid, IYF,
insert found in brain and endocrine cells (Adelman et al. 1992
; Butler et al. 1993
; Tseng-Crank et
al. 1994
). In addition, in all three cell types, a single or
pair of bands at ~310 bp was observed. The 310-bp bands correspond
approximately to those expected for the previously observed
59-amino-acid insert. The resulting 310-bp band from RIN cells
therefore was subcloned and multiple clones subsequently were
sequenced. In 21 of 25 subclones from RIN cells, the resulting subclone
encoded an amino acid sequence identical to that of the insert found in
rat adrenal chromaffin cells. Furthermore, in 4 of the 25 clones from
the RIN cells, a second splice variant of 62 amino acids was observed
(Table 1). An identical insert also has
been reported in rat adrenal chromaffin cells (Xie and McCobb
1998
). The splice site 2 variation also was examined further
using a second set of primers (Slo 14,15) flanking the
splice site. These primers yielded bands of ~222 and 402 bp,
corresponding approximately to the sizes expected for the null insert
and the 59- or 62-amino-acid insert. The 402-bp band obtained from HIT
cells was subcloned further to determine whether multiple variants of
similar size might be present in the HIT cells. In eight subclones, all
encoded the 59-amino-acid insert, which differed in 3 amino acids from
the rat 59-amino-acid insert (Table 2).
No variant corresponding to the 62-amino-acid insert was found in the
HIT cells. The presence of the 59-amino-acid insert in both RIN and HIT
cells suggests that the function of this insert is unlikely to be
related to the ability of the BK channel to inactivate.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Inactivating BK current in beta cells
The present results establish that rat insulinoma tumor cells express a large-conductance, Ca2+- and voltage-dependent BK-type K+ channel, which exhibits rapid inactivation. This inactivating BK channel, termed BKi, is the predominant BK variant expressed in the RIN cells we have studied. In contrast, HIT cells express exclusively a noninactivating BKs variant.
Several aspects of the results are of particular significance. First,
the presence of the inactivating BK variant in RIN cells establishes
that the BKi phenotype may be present in a variety of cell
types and have broader functional significance than yet has been
appreciated. Second, once inactivation is taken into account, the
results indicate that the Ca2+ dependence of activation of
HIT and RIN cell BK channels is essentially identical in contrast to
the interpretation arising from previous work (Eddlestone et al.
1989
). Third, the presence of Slo variants containing a novel 59-amino-acid insert in both RIN and HIT cells indicates that this insert is not strictly associated with the inactivating BK phenotype. Fourth, the results confirm that BK current
in RIN cells plays little role in electrical activity initiated by
depolarization or by glucose, although a more substantial role of BK
current in HIT cells cannot be excluded. Although the present results
do not reveal a specific functional role of BKi channels,
the possibility must be considered that there may be particular
physiological conditions that might increase the relative importance of
BKi current in some aspect of RIN cell or beta cell excitability.
Why have inactivating BK currents been overlooked in previous studies?
Several studies of whole cell Ca2+-dependent currents in
both native and clonal beta cell lines, in fact, have suggested the
presence of an inactivating component of Ca2+-dependent
current (Satin et al. 1989
; Smith et al.
1990
), but the significance of such observations in terms of
the behavior of single BK channels never has been described explicitly.
At the single-channel level, one reason for difficulty in observing BKi variant is the following. Studies with excised patches
from beta cell membranes typically have used steady-state measurements of BK activity at single potentials (Cook et al. 1984
;
Eddlestone et al. 1989
; Tabcharani and Misler
1989
; Kukuljan et al. 1991
). Under such
conditions, the recordings will be dominated by noninactivating BKs channels because BKi channels, if present,
already will be inactivated. At positive potentials, the time between
reopenings of the BKi variant may be many seconds. As a
consequence, patches with BKi channels may appear to have
few BK channels at all or, if there are some noninactivating BK
channels present, the BKi channels would contribute
negligibly to the records. For example, the last 200 ms of the traces
in Fig. 6 provide an indication of the steady-state activity of 14 BKi channels with 10 µM Ca2+ at +60 mV. Yet
under normal resting conditions, BKi channels would be
available for activation and then could contribute substantially to
Ca2+-dependent current during depolarization.
Although our results suggest that the BKi variant is the
predominant or only BK variant present in the RIN cells we have used, the situation in normal pancreatic beta cells remains unclear. Both
BKi and BKs channels have been observed in
normal rat pancreatic beta cells (Lingle et al. 1996
).
In addition, other work indicates that noninactivating BKs
variants are, to some extent, present in either RIN cells
(Eddlestone et al. 1989
) and neonatal rat beta cells
(Cook et al. 1984
). It seems possible that particular BK
channel phenotypes are associated with particular subtypes of beta
cells with particular functional roles. In rat chromaffin cells, each
phenotypic variant is segregated largely among different cells, such
that ~15-20% of chromaffin cells express predominantly BKs currents while a larger fraction (80%) expresses
predominantly BKi currents (Ding et al.
1998
; Solaro et al. 1995
). The functional significance of such segregation remains unknown. If a similar segregation occurred in beta cells, such segregation of particular BK
current variants among different cell types might contribute to
particular functional roles of a given cell subtype.
Our results also raise the possibility that, even within different
subclones or passages of an insulinoma tumor line, BK variants may
differ. The earlier work on the RINm5f line (Eddlestone et al.
1989
) indicated that the occurrence of BK channels in patches was rare, perhaps consistent with the presence of BKi
channels in such patches. However, the increase in BK channel open
probability versus pCa in the same study using steady-state
measurements of channel activity seems more consistent with the
presence of at least some BKs channels. Thus it probably
cannot be excluded that changes in expression of particular proteins
may occur in different subclones, leading to some of the differences
observed between our work and earlier studies.
Inactivation mechanisms and structural components of BKi channels
The properties of inactivation of the BKi variant in
RIN cells appear indistinguishable from that of the BKi
variant in rat chromaffin cells. The rates of inactivation and
dependence of those rates on voltage and Ca2+ are similar
to those from BKi channels in the two cell types (Solaro and Lingle 1992
; Solaro et al.
1995
). The rates of recovery from inactivation and the
steady-state availability of BKi current for activation at
10 µM Ca2+ are comparable (Ding et al.
1996
; Ding and Lingle, unpublished data). The slowing of
inactivation by trypsin and the lack of effect of the cytosolic channel
blocker, QX-314, are also identical for BKi currents in the
two cell types (Solaro et al. 1997
). Thus functionally
and mechanistically, the channels in the two cell types seem identical.
The present results add no new information about the nature of the
underlying inactivation mechanism. Although inactivation appears to
involve multiple, trypsin-sensitive cytosolic inactivation domains,
unlike the inactivating Shaker channel (Choi et al.
1993
) no evidence yet supports the idea that the inactivation domains directly occlude the ion permeation pathway.
In addition to the functional similarities of the beta cell and
chromaffin cell BKi variants, both beta cells and
chromaffin cells share expression of an interesting alternatively
spliced variant of the Slo subunit that encodes BK channels
(Ferrer et al. 1996
; Saito et al. 1997
).
The splice variant found in human islets (Ferrer et al.
1996
) differs in two amino acids from that found in rat
chromaffin cells (Saito et al. 1997
). Our results indicate that the variant found in rat beta cells is, in fact, identical to that found in rat chromaffin cells. Despite the presence of this unique alternative splice variant in RIN cells and chromaffin cells, this variant per se does not result in formation of inactivating BK channels when expressed in Xenopus oocytes (Saito
et al. 1997
). Furthermore its presence in HIT cells in which no
inactivating BK channels have been observed also argues that its
function is unrelated to BK channel inactivation.
Significance of BK channels in beta cell function
Secretion of insulin from beta cells can be regulated by
modulation of any of a number of physiological targets. For example, reduction of Ca2+ current (Satin et al.
1994
), pharmacological activation of K-ATP channels
(Dukes and Philipson 1996
; Ribalet et al.
1988
), or alteration of nucleotide metabolism (Nichols
et al. 1996
) are just three of many ways that the secretion of
insulin can be regulated. Earlier work has failed to define a critical
physiological role of BK current in beta cell function (Kukuljan
et al. 1991
). The present results raise the possibility that
the roles of BK channels may have been overlooked because a key
functional property of beta cell BK channels, namely inactivation, has
not been considered. The present results do, in fact, show that BK
current is, to some extent, activated during action potential clamp
waveforms. However, in RIN cells BK current remains only a minor
contributor to total outward current activated during action potentials
and action potential repolarization. Thus our results are generally
consistent with previous results from RIN cells, which suggest that the
role of BK current is minor. The relatively minor role of BK current in
RIN cell excitability also is underscored by our results with CTX.
Despite the relatively weaker sensitivity of BKi current in
RIN cells to CTX, in agreement with earlier work (Kukuljan et
al. 1991
) our results indicate that blockade of BK current by
100 nM CTX, a concentration sufficient to block >90% of either inactivating or noninactivating BK current, has only minor effects on
depolarization-elicited repetitive firing in RIN cells. Similarly, 100 nM CTX has no clear effect on action potential firing initiated by
glucose.
In contrast to RIN cells, a robust BK current can be activated by
action potential waveforms in HIT cells. Although we did not observe
either spontaneous action potentials or depolarization-elicited action
potentials in the HIT cells we have examined, spontaneous action
potentials in HIT cells have been observed by others (Keahey et
al. 1989
). Our results would suggest that BK current could be
the primary repolarizing current in such cells. The differences in BK
current activation by action potential waveforms between HIT and RIN
cells seem somewhat surprising given that the BK current densities do
not seem profoundly different. Furthermore although we have not
examined this point in detail, the relative amounts of Ca2+
currents in the two cells are similar when activated under identical conditions (e.g., Fig. 10). The difference between HIT and RIN cells in
the ability of comparable amounts of Ca2+ influx to
activate BK current raises the possibility that there may be some
difference in how Ca2+ influx is coupled to BK current
activation. One possible explanation might be that the resting
inactivation of BKi current in RIN cells under
perforated-patch conditions is severe, such that the BK current
available for activation in RIN cells is quite small. However, this
seems an unlikely explanation, because at normal resting
Ca2+ levels BKi current inactivation is minor.
Another possible explanation is that some differences may exist between
the two cell lines in how tightly coupled BK channels are to sites of
Ca2+ influx. For example in rat adrenal chromaffin cells,
activation of BK current during action potential repolarization appears
to require selective coupling of BK channels to particular
Ca2+ channel variants, specifically L-type Ca2+
channels (Prakriya et al. 1996
; M. Prakriya and
C. J. Lingle, unpublished results). Thus a difference in the
ability of particular Ca2+ channels to colocalize with BK
channels between RIN and HIT cells might underlie the large differences
in the amount of Ca2+- and voltage-dependent K+
current activated by action potential waveforms.
There is some precedence from work on beta cells for the idea that
Ca2+ influx through particular Ca2+ channel
subtypes may be linked to particular Ca2+-dependent
targets. Specifically, Ca2+ influx through L-type
Ca2+ channel variants appears to be tightly coupled to the
secretory machinery in mouse pancreatic beta cells (Bokvist et
al. 1995
). Thus selective coupling of particular
Ca2+ channel subtypes to particular
Ca2+-dependent targets may be a critical factor
contributing to normal secretory cell function. In beta cells, such
coupling may play an important role in maintenance of the normal
stimulus-secretion process.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dr. C. Nichols, who raised the possibility that RIN cells may express BKi channels.
This work was supported in part by National Institute of Diabetes and Kidney Diseases Grants DK-46564 to C. J. Lingle and 2 P60 DK-20579 to the Diabetes Research and Training Center at Washington University School of Medicine.
| |
FOOTNOTES |
|---|
Address for reprint requests: C. Lingle, Dept. of Anesthesiology, Washington University School of Medicine, Box 8054, St. Louis, MO 63110.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 20 July 1998; accepted in final form 5 October 1998.
| |
REFERENCES |
|---|
|
|
|---|
cells.
J. Cell. Biochem.
55S:
54-65, 1994.
-cell line.
Diabetes
38:
188-193, 1989[Abstract].This article has been cited by other articles:
![]() |
C. Lv, M. Chen, G. Gan, L. Wang, T. Xu, and J. Ding Four-turn {alpha}-Helical Segment Prevents Surface Expression of the Auxiliary h{beta}2 Subunit of BK-type Channel J. Biol. Chem., February 1, 2008; 283(5): 2709 - 2715. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zeng, T. M. Weiger, H. Fei, and I. B. Levitan Mechanisms of Two Modulatory Actions of the Channel-binding Protein Slob on the Drosophila Slowpoke Calcium-dependent Potassium Channel J. Gen. Physiol., November 1, 2006; 128(5): 583 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zhang, K. Houamed, S. Kupershmidt, D. Roden, and L. S. Satin Pharmacological Properties and Functional Role of Kslow Current in Mouse Pancreatic {beta}-Cells: SK Channels Contribute to Kslow Tail Current and Modulate Insulin Secretion J. Gen. Physiol., September 26, 2005; 126(4): 353 - 363. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zeng, T. M. Weiger, H. Fei, A. M. Jaramillo, and I. B. Levitan The Amino Terminus of Slob, Slowpoke Channel Binding Protein, Critically Influences Its Modulation of the Channel J. Gen. Physiol., May 31, 2005; 125(6): 631 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hu, M. Z. Labuda, M. Pandolfo, G. G. Goss, H. E. McDermid, and D. W. Ali Variants of the KCNMB3 regulatory subunit of maxi BK channels affect channel inactivation Physiol Genomics, November 11, 2003; 15(3): 191 - 198. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Sun, X. Q. Gu, and G. G. Haddad Calcium Influx via L- and N-Type Calcium Channels Activates a Transient Large-Conductance Ca2+-Activated K+ Current in Mouse Neocortical Pyramidal Neurons J. Neurosci., May 1, 2003; 23(9): 3639 - 3648. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-W. Wang, J. P. Ding, X.-M. Xia, and C. J. Lingle Consequences of the Stoichiometry of Slo1alpha and Auxiliary beta Subunits on Functional Properties of Large-Conductance Ca2+-Activated K+ Channels J. Neurosci., March 1, 2002; 22(5): 1550 - 1561. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E Armstrong and W. M Roberts Rapidly inactivating and non-inactivating calcium-activated potassium currents in frog saccular hair cells J. Physiol., October 1, 2001; 536(1): 49 - 65. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-M. Xia, J.-P. Ding, X.-H. Zeng, K.-L. Duan, and C. J. Lingle Rectification and Rapid Activation at Low Ca2+ of Ca2+-Activated, Voltage-Dependent BK Currents: Consequences of Rapid Inactivation by a Novel beta Subunit J. Neurosci., July 1, 2000; 20(13): 4890 - 4903. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. V. Lovell, D. G. James, and D. P. McCobb Bovine Versus Rat Adrenal Chromaffin Cells: Big Differences in BK Potassium Channel Properties J Neurophysiol, June 1, 2000; 83(6): 3277 - 3286. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-M. Xia, J. P. Ding, and C. J. Lingle Molecular Basis for the Inactivation of Ca2+- and Voltage-Dependent BK Channels in Adrenal Chromaffin Cells and Rat Insulinoma Tumor Cells J. Neurosci., July 1, 1999; 19(13): 5255 - 5264. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |