|
|
||||||||
The Journal of Neurophysiology Vol. 81 No. 3 March 1999, pp. 1391-1403
Copyright ©1999 by the American Physiological Society
Department of Pharmacological and Physiological Sciences, The University of Chicago, Chicago, Illinois 60637
| |
ABSTRACT |
|---|
|
|
|---|
Sun, Lihjen and Richard J. Miller. Multiple neuropeptide Y receptors regulate potassium and calcium channels in acutely isolated neurons from the arcuate nucleus of the rat. We examined the effects of neuropeptide Y (NPY) and related peptides on Ca2+ and K+ currents in acutely isolated neurons from the arcuate nucleus of the rat. NPY analogues that activated all of the known NPY receptors (Y1-Y5), produced voltage-dependent inhibition of Ca2+ currents and activation of inwardly rectifying K+ currents in arcuate neurons. Both of these effects could occur simultaneously in the same cells. In some cells, activation of Y4 NPY receptors also caused oscillations in [Ca2+]i. NPY hyperpolarized arcuate neurons through the activation of a K+ conductance and increased the spike threshold. Molecular biological studies indicated that arcuate neurons possessed all of the previously cloned NPY receptor types (Y1, Y2, Y4, and Y5). Thus activation of multiple types NPY receptors on arcuate neurons can regulate both Ca2+ and K+ conductances leading to a reduction in neuronal excitability and a suppression of neurotransmitter release.
| |
INTRODUCTION |
|---|
|
|
|---|
Neuropeptide Y (NPY), peptide YY (PYY), and
pancreatic polypeptide (PP) constitute a family of homologous
neuropeptides that have been suggested as having numerous functions
throughout the central and peripheral nervous systems (Colmers
and Wahlestedt 1993
; Dumont et al. 1992
;
Tatemoto et al. 1982
). One area of considerable current
interest is the control of hypothalamic function by these peptides and
the regulation of eating behavior in particular (Beck et al.
1993
; Jhanwar-Uniyal et al. 1993
; Kalra
1997
; Miller and Bell 1996
; Stanley et
al. 1985
, 1986
; Tomaszuk et al. 1996
). Injection of NPY and its analogues into various hypothalamic nuclei strongly stimulates eating, even in previously satiated animals (Stanley and Leibowitz 1985
; Stanley et al. 1986
). For
this and other reasons, it is thought that NPY-containing neurons
operating within the hypothalamus normally play a central role in the
control of eating behavior.
NPY produces its effects by activating G-protein-linked NPY receptors
of which at least five types exist in the rat (Y1-Y5) (Bard et
al. 1995
; Gerald et al. 1995
, 1996
; Hu et
al. 1996
; Larhammar et al. 1992
; Lundell
et al. 1996
). Activation of these receptors produces effects on
[Ca2+]i, adenylate cyclase, and a number of
ion channels (Colmers and Bleakman 1994
). Much interest
has centered on the identity of the NPY receptor subtype(s) that is
responsible for mediating the effects of NPY on eating. Some
controversy exists on this point, and data indicating a role for Y1,
Y5, or some as-yet uncharacterized NPY receptor type have been
forthcoming (Gerald et al. 1996
; Kanatani et al.
1996
; Lopez-Valpuesta et al. 1996
;
O'Shea et al. 1997
; Schaffhauser et al.
1997
).
Most of the NPY-containing neurons within the hypothalamus
originate in the arcuate nucleus and innervate the paraventricular (PVN) and other nuclei as well as extending collateral connections into
the arcuate (Bai et al. 1985
; Billington and
Levine 1992
; Kalra 1997
; Meister et al.
1989
). This organization suggests that NPY may regulate
synaptic communication in different hypothalamic nuclei, including the
arcuate nucleus itself. We previously demonstrated with a rat
hypothalamic slice preparation that NPY analogues targeting different
types of NPY receptors could inhibit both excitatory (glutamate) and
inhibitory (GABA)-mediated synaptic transmission in the arcuate nucleus
(Glaum et al. 1996
; Rhim et al. 1997
). In
the former case, we demonstrated that activation of all of the major
types of NPY receptors could inhibit the evoked release of glutamate.
Furthermore activation of postsynaptic Y1 receptors was shown to
activate a K+ conductance in arcuate neurons in
hypothalamic slices.
To further define mechanisms of NPY action within the arcuate nucleus, we have now examined the effects of NPY on acutely isolated arcuate neurons. We demonstrate that NPY can regulate both Ca2+ and K+ currents in these neurons and also that this regulation produces a change in the pattern of electrical signaling by these cells.
| |
METHODS |
|---|
|
|
|---|
Acute isolation of arcuate neurons
Arcuate neurons were isolated using the techniques modified from
Rhim et al. (Rhim and Miller 1994
). Rats, aged 10-20
day postnatal, were anesthetized and decapitated. The brain was removed in ice-cold artificial cerebrospinal fluid (ACSF) solution [containing (in mM) 126 NaCl, 3 KCl, 2.5 CaCl2, 1.5 MgSO4,
1 NaH2PO4, 26.2 NaHCO3, and 10 glucose, pH 7.4; osmolarity
310 mOsm] gassed with 95%
O2-5% CO2. The transverse slices (375-mm
thick) where the third ventricle extended laterally over the median
eminence and infundibular stem were cut coronally using a vibrating
tissue chopper (Vibratome) and kept in a holding chamber filled with 31°C ACSF gassed with 95% O2-5% CO2. Three
to four slices of the hypothalamus arcuate region usually were obtained
from one rat.
Slices were treated enzymatically with 15 U/ml papain (preactivated in
a Ca2+- and Mg2+-free ACSF with 3 mM ETDA and
0.16 mg/ml L-cysteine for 30 min) at 31°C for 1 h.
After incubation, the slices were rinsed twice with ACSF containing
ovamucoid (trypsin inhibitor). The slices were kept in the holding
chamber containing ACSF bubbled with 95% O2-5%
CO2 for
1 h before dissociation. When needed, slices were
taken out, and the areas of the arcuate nucleus were micropunched under
the dissecting microscope and placed on coverslips. The cells were
triturated in plating media (Dulbecco's modified Eagle's medium with
10% fetal bovine serum and 1% 10,000 µg streptomycin/10,000 U
penicillin, pH 7.4, osmolarity
305) using progressive smaller capillary pipettes. The dissociated neurons were allowed to settle at
37°C for 30 min before recording.
The neurons were heterogeneous in shape and size. The majority of the cells were round, oval, or spindle shaped and measured 12-20 mm in diameter (Fig. 1). Some cells maintained their original morphological features, such as dendritic processes. Most of the recordings were made on cells without long processes.
|
Electrophysiological recordings of Ca2+ currents
The method used for electrophysiological recordings was
similar to that previously described (Toth et al. 1996
).
Recording of Ca2+ currents was made using the whole cell
voltage-clamp technique. Data were acquired using a Axopatch 1D (Axon
Instrument, Foster City, CA) amplifier, filtered at 2 kHz and stored in
the computer. Ca2+ currents were evoked every 20 s by
a 200-ms voltage step from
80 to +10 mV.
Patch electrodes were filled with CsCl-bis-(o-aminophenoxy)-N,N,N',N'-tetraacetic acid (BAPTA)-based internal solution [which contained (in mM) 100 CsCl, 1 MgCl2, 10 HEPES, 10 BAPTA, 5 phosphocreatinin, 2 MgATP, and 1 Tris-GTP plus 20 U/ml creatine phosphokinase]. The neurons first were perfused in 2 Na+-Ca2+ solution [which contained (in mM) 2 CaCl2, 138 NaCl, 1 MgCl2, 5 KCl, 10 HEPES, and 10 glucose, pH to 7.4 with NaOH, and osmolarity 305-310], then in a 5Ca2+-TEA solution [which contained (in mM) 5 CaCl2, 144 TEACl, 1 MgCl2, 10 HEPES, and 10 glucose, pH to 7.4 by TEAOH, and osmolarity 305-310) with and without NPY analogues. NPY (human), PYY (human), [Leu31Pro34]-NPY (human), hPP (human) (above from Sigma, St. Louis, MO or American Peptide, Sunnyvale, CA), rPP (rat), NPY 13-36 (human, rat), NPY 2-36 (human, rat), C2-NPY (porcine) and [D-Trp32]-NPY (human, rat) (above from Bachem, King of Prussia, PA) were tested.
Intracellular Ca2+ measurement
The method used to measure changes in
[Ca2+]i was similar to that previously
described (Rhim and Miller 1994
). The
acetoxymethyl-ester form of fura-2 (fura-2/AM; Molecular Probes,
Eugene, OR) was used as a Ca2+ indicator. Acutely
dissociated arcuate neurons were allowed to rest
40 min before the
fura-2 experiment. Neurons then were loaded with fura-2 (3 mM) for 25 min, rinsed and allowed 20 min to de-esterify the dye.
Intracellular-free Ca2+, [Ca2+]i,
was measured by digital video microfluorimetry using an intensified CCD
camera and Universal Imaging software. Cells were illuminated by a
150-W xenon lamp, and excitation wavelengths (340 and 380 nm) were
selected by a filter changer. The membrane potential was changed by an
application of 50 mM K+ solution (with KCl substituted for
an equimolar amount of NaCl) via an automatic fast U-tube system. The
effects on [Ca2+]i produced by different NPY
analogues were tested.
Electrophysiological recordings of K+ currents
The method used for recording of K+ currents
was modified from Sodickson and Bean (1996)
. Whole cell
voltage-clamp recordings were made using a ramp protocol from
120 or
140 mV to +60 mV of a 100-ms stimulation interval (see
Sodickson and Bean 1998
). The internal solution was
K-based [ it contained (in mM) 130 K-gluconate, 15 KCl, 5 MgCl2, 10 HEPES, 9 EGTA, 5 phosphocreatinin, 2 MgATP, and 1 Tris-GTP, and 20 U/ml creatine phosphokinase, pH 7.4; osmolarity
285). External solution was either 2 Na+-Ca2+ or 30 mM K+ solution (with
KCl substituted for an equimolar amount of NaCl) with 1 µM
tetrodotoxin (TTX) and 100 µM CdCl2. Different NPY
analogues were tested for their effects on K+ currents.
Recordings of Ca2+ and K+ currents in the same neuron
The internal solution used was a K+-based internal
solution described in the recording of K+ currents. The
external solution was alternated between a 5 Ca2+-TEA
solution to measure Ca2+ currents and 30 mM K+
solution with TTX and Cd2+ to measure K+
currents (Penington and Fox 1994
). The recording
protocols were identical as described above in the recording of
Ca2+ currents and recording of K+ currents.
Current-clamp recordings
Recordings were made using the whole cell current-clamp
method. A K+-based internal solution was used. Neurons were
current-clamped at a holding potential of
60 mV. Different current
injections (0.1, 0.2, 0.3, 0.4, 0.5, 1, 1.5, and 2 nA) were made. The
membrane potential was acquired at 5 kHz and filtered at 2 kHz. Changes in membrane potential produced by NPY analogues also were monitored using a chart recorder (RS 3400, Gould, Cleveland, OH).
Preparation of arcuate nucleus mRNA and first-strand DNA
Areas of the arcuate nucleus were punched out under a microscope
and quickly frozen in dry ice, and stored at
80°C. mRNA was
extracted (QuickPrep Micro mRNA Purification Kit, Pharmacia Biotech,
Piscataway, NJ), followed by first strand cDNA synthesis primed by
random hexamers (Superscript Preamplification System, GIBCO, Grand
Island, NY).
PCR-Southern hybridization
First-strand cDNA synthesized from arcuate nucleus mRNA as well as receptor cDNAs subcloned into Bluescript (Y1, Y2, and Y4 were generous gifts from Synaptic Pharmaceuticals; Y5 was cloned from a published sequence GenBank U56078) were used as templates in PCR. dNTP, PCR buffer (containing 15 µM MgCl2) and AmpliTaq DNA polymerase (5 U/ml) were all obtained from Perkin Elmer (Foster City, CA). The following oligonucleotide primer pairs (forward and reverse) were used.
Y1: 5' GAAGAACCCTAACAGTCCG 3', and 5' TCTCAGCAGCTTCAGATTT 3'; Y2: 5' ATGGGTCCATTAGGTGCAGA 3', and 5' ATTGGTAGCCTCTGAGAAAGA 3'; Y4: 5' TGAATACCTCTCATCTCATGG 3', and 5' CTACATGACGTTAGACTTGCT 3'; Y5: 5' TAATGGACGTCCTCTTCTT 3', and 5' CAGAGAGAATCATGACATGTGT 3'.
Arcuate nucleus cDNA, receptor cDNA (as a positive control), and water (as a negative control) were used as templates in separate PCR reactions for each NPY receptor. PCR conditions were 3 min at 94°C, followed by 30 cycles of 1 min at 94°C, 1 min at 57°C, and 1 min at 72°C, then 3 min at 72°C for Y1, Y2, and Y4; 3 min at 94°C, followed by 30 cycles of 1 min at 94°C, 30 s at 60°C, and 1 min at 72°C, then 3 min at 72°C for Y5.
Equal volumes of each PCR product were analyzed by agarose gel
electrophoresis. PCR products were transferred to a
Hybond-N+ membrane (Amersham, Arlington Heights, IL), then
hybridized at 42°C overnight with 32P-
-dCTP-labeled
receptor cDNA probes, which were made using random priming (Megaprime
DNA labeling system, Amersham), followed by purification on Sephadex
G-50 columns (NICK DNA grade, Pharmacia Biotech). After hybridization,
membranes were washed as previously described (Sambrook et al.
1989
; Toth et al. 1996
) and then exposed to
autoradiography films.
| |
RESULTS |
|---|
|
|
|---|
NPY modulation of Ca2+ channels
We examined the effects of NPY and its analogues (Table
1) on the Ca2+ currents in
acutely isolated arcuate neurons. In 97 of 202 cells tested, NPY
analogues reduced the peak amplitude of the Ca2+ currents
by an average of 31.1 ± 2.0% (mean ± SE; Fig.
2). All the peptides examined (see Table
1; concentration 100-300 nM) could inhibit reversibly the
Ca2+ currents to a similar extent (Table
2). Variable amounts of kinetic slowing
of the Ca2+ currents with each analogue also were observed.
In the case of each peptide tested, kinetic slowing was observed in
some cases but not others (Figs. 2 and
3). These results suggest that all the
known NPY receptors (Y1-Y5) may be present and able to couple to
Ca2+ channels in these neurons. The Ca2+
current that was inhibited by NPY analogues was predominantly N type as
indicated by its sensitivity to
-conotoxin GVIA (
-CTX). At a
concentration of 5-10 µM the toxin inhibited the Ca2+
current in arcuate neurons by 79.3 ± 12.2% (n = 4). When the Ca2+ current was preceded by a depolarizing
prepulse to +80 mV, the inhibition produced by NPY and its analogues
(PYY, [Leu31Pro34]-NPY, and NPY 13-36) was
reduced considerably (Fig. 3, 35.9 ± 13.5% inhibition without
prepulse, 11.3 ± 7.3% after a prepulse, n = 12, 2-5 cells for each peptide). The relief of inhibition for each of the
four peptides was similar, suggesting that they all inhibited the
Ca2+ current by a common mechanism.
|
|
|
|
We attempted to ascertain whether individual arcuate neurons expressed
different combinations of NPY receptors by applying a series of NPY
analogues sequentially to cells. The analogues used are shown in Table
1. Where possible all peptides were applied in random order to each
cell. In some instances, the effects of the selective Y1 antagonist
BIBP 3226 were also examined (Doods et al. 1995
;
Sun et al. 1998
; Wieland et al. 1995
). As
can be seen in Fig. 4, cells responded to
different combinations of agonists (n = 60). As also
can be seen (Fig. 4, A-C) the effects of the peptides were
dose dependent exhibiting half-maximal effects at ~1.2 nM for
[Leu31, Pro34]-NPY (n = 2),
8.3 nM for C2-NPY (n = 3) and 0.34 nM for rPP
(n = 2). Furthermore the effects of
[Leu31, Pro34]-NPY were blocked selectively
by BIBP 3226 (e.g., Fig. 4, A and B). Owing to
the selective nature of these compounds at the concentrations employed,
the presence of Y1, Y2, and Y4 receptors is clear. Furthermore, the
effects of [D-Trp32]-NPY also suggest the
presence of Y5. However, overall, there was no discernible pattern of
Ca2+ current inhibition by different NPY analogues.
Different neurons typically responded to one or more NPY analogues.
|
Intracellular-free Ca2+ concentration
We further examined the influence of NPY receptors on Ca2+ signaling in arcuate neurons. All NPY analogues tested were capable of suppressing the [Ca2+]i increase induced by 50 mM K+ (Fig. 5 and Table 3). These results are consistent with the electrophysiological studies on Ca2+ currents. Interestingly, however, of 69 cells tested, hPP increased the peak [Ca2+]i in 11 cells and induced oscillations in 18 cells. Oscillations in [Ca2+]i were not produced by any of the other agonists examined except by NPY itself in three instances (Fig. 5).
|
|
Modulation of K+ channels
We also studied the regulation of K+ currents by NPY
receptors in isolated arcuate neurons. In 82 of 166 cells tested, NPY analogues activated a current with the properties of an inwardly rectifying K+ current (Fig.
6). At a membrane potential of
120 mV,
the amplitude of this current was increased an average of 2.26 ± 0.16-fold. As with the modulation of Ca2+ currents, all NPY
analogues were capable of stimulating K+ currents to
similar extents (Table 2). Again, there was no consistent pattern
evident in the stimulation of K+ currents when different
NPY analogues were applied to single arcuate neurons (Fig.
7).
|
|
Modulation of both Ca2+ and K+ channels in the same neuron
We investigated whether NPY receptors could regulate Ca2+ and K+ currents in the same isolated arcuate neurons. By changing the external solution from one containing 30 mM K+ to a 5Ba-TEA solution, K+ current activation and inhibition of Ca2+ currents could be recorded sequentially in the same cell (Fig. 8). In 6 of 14 cells tested, NPY activated a K+ current and inhibited the Ca2+ current. In the remainder, we either could not record both K+ and Ca2+ currents or the cells were not sensitive to NPY analogues.
|
Changes in firing pattern produced by NPY analogues
How does NPY alter the electrophysiological behavior of
arcuate neurons and how are such changes related to the regulation of
K+ and Ca2+ currents? To answer these
questions, neurons were held at
60 mV and induced to fire action
potentials by current injection (n = 16). TTX-sensitive
Na+ spikes were induced normally on injecting 0.2- to
0.3-nA currents. With larger current injections (1-2 nA),
Cd2+-sensitive Ca2+ spikes also were generated.
On application of NPY, spiking activity was suppressed at lower
magnitude current injections. At higher magnitude current injections,
multiple Na+ spikes were observed, but Ca2+
spikes remained suppressed (Fig. 9).
|
Membrane potential changes induced by NPY analogues
The membrane potential of a series of cells was held at
different values ranging from
20 to
60 mV. In the absence of NPY analogues, cells often showed spontaneous activity including spikes and
plateau potentials. After peptide application, the membrane potential
hyperpolarized (14 of 25 cells tested) and spontaneous activity ceased
(Fig. 10A). The magnitude of
the membrane potential change varied from
20 mV to only
5 to
6
mV. In the presence of Cs+ (3-5 mM), the change in
membrane potential was blocked completely (n = 2) or
partially (n = 2). An example is shown in Fig.
10B. The effect of Cs+ suggests that the
hyperpolarization induced by NPY analogues might be due to the
activation of K+ currents.
|
Presence of NPY receptors in the arcuate nucleus
To determine which NPY receptor mRNAs are expressed in the rat arcuate nucleus, we carried out RT-PCR amplification using primers specific for Y1, Y2, Y4, and Y5, followed by Southern blot hybridization using specific probes for each NPY receptor subtype. The expression of all four NPY receptor subtypes (Y1, Y2, Y4, and Y5) could be clearly demonstrated (Fig. 11). Although it is not possible to say from these data whether multiple NPY receptors occur in each cell, it does confirm their presence in the arcuate nucleus as a whole.
|
| |
DISCUSSION |
|---|
|
|
|---|
The NPY family of neuropeptides has been shown to produce numerous
effects in the hypothalamus that are of great current interest. For
example, NPY has been shown to regulate the release of a large number
of hormones and to be involved in the control of diurnal rhythms,
eating, and other behaviors (Dumont et al. 1992
;
Grundemar and Hakanson 1994
; Huhman et al.
1996
; Leibowitz 1991
; Tomaszuk et al.
1996
). In most instances, however, the precise cellular and
anatomic basis for these effects are understood incompletely. The
hypothalamus contains large amounts of NPY (Allen et al.
1983
; Chronwall et al. 1985
; de Quidt and
Emson 1986
). Several hypothalamic nuclei including the arcuate,
suprachiasmatic, periventricular and paraventricular nuclei are densely
innervated by NPY immunoreactive fibers, whereas only the arcuate
contains a high concentration of NPY immunoreactive perikarya
(Allen et al. 1983
; Chronwall et al.
1985
). It has been established that arcuate NPY neurons innervate several other hypothalamic nuclei and also send collateral fibers into the arcuate itself (Bai et al. 1985
;
Billington and Levine 1992
; Kalra 1997
;
Meister et al. 1989
). Indeed, most of the NPY
innervation of the hypothalamus, including that of the arcuate, derives
from the arcuate NPY neurons themselves. There are exceptions to this
rule and some innervation of the hypothalamus also appears to originate
with NPY-containing neurons in the brain stem for example (Sahu
et al. 1988
; Sawchenko et al. 1985
).
Knowledge as to the precise distribution of NPY receptors in the
hypothalamus is even scantier. Although some evidence suggests that all
of the cloned NPY receptors (i.e., Y1, Y2, Y4, and Y5) are found in
this part of the brain (Broberger et al. 1997
;
Fuxe et al. 1977
; Gustafson et al. 1997
;
Mikkelsen and Larsen 1992
; Naveilhan et al.
1997
; Widdowson 1997
), not a lot is known about either their subcellular localization or individual functions. Some
information is available on the distribution of Y1 and Y2 receptors in
the arcuate nucleus (Broberger et al. 1997
). It
appears that, in general, Y1 receptors are localized to the
pro-opiomelanocortin (POMC)-containing perikarya in the ventrolateral
arcuate. In contrast, Y2 receptors appear to be primarily associated
with the NPY-containing cell bodies in the ventromedial portion of the
nucleus. NPY-containing nerve terminals also are associated with
arcuate POMC-containing cell bodies as well as others (Broberger
et al. 1997
; Garcia de Yebenes et al. 1995
). One
model therefore has proposed that NPY might act on postsynaptic Y1
receptors to regulate POMC neurons. In addition, the Y2 receptors found
in NPY-containing cells might represent presynaptic receptors that
regulate NPY release from the terminals of these neurons among other
things (Broberger et al. 1997
).
Electrophysiological data resulting from the present and previous
studies indicate that although this model may be partially correct, it
is certainly incomplete. We previously have demonstrated, using a rat
hypothalamic slice preparation, that NPY receptors of all types exist
presynaptically on both excitatory and inhibitory inputs into the
arcuate and that their activation can inhibit glutamate and
GABA-mediated synaptic transmission (Glaum et al. 1996
;
Rhim et al. 1997
). We also have shown that NPY can
stimulate Y1 receptors postsynaptically, resulting in the activation of an inwardly rectifying K+ current in a subgroup of arcuate
neurons. In our previous investigation, we did not observe postsynaptic
effects resulting from the activation of other NPY receptor types. In
contrast, we have now shown that all four types of cloned NPY receptors
exist postsynaptically on arcuate neurons and can couple to
K+ and Ca2+ currents. It is conceivable that Y3
receptors (which still have to be cloned) also are present, but there
is really no good way of telling. Activation of all of these receptors
results in the voltage-dependent inhibition of Ca2+
channels, which in this case are mostly of the N type, and in the
activation of K+ channels, which are presumably of the
G-protein-activated inwardly rectifying K+ channel (GIRK) family.
One question that arises from the present results is why we can observe
activation of K+ currents by all types of NPY receptors
using isolated arcuate neurons, when only Y1 agonists produced these
effects in the slice (Rhim et al. 1997
). One possibility
is that some of these receptors normally are located on cell processes
away from the cell soma and that these structures are reabsorbed into
the cell body on isolation. Another possibility is that our slice
recordings were restricted to a particular part of the arcuate (e.g.,
POMC-containing cells) where the Y1 receptor may be localized
selectively and that the isolated cells used in the current studies are
the result of a wider sampling of the nucleus. As discussed in the
preceding section, previous studies have suggested that different types of NPY receptors may be segregated on different subpopulations of
arcuate neurons, although we did not observe any obvious segregation of
receptors in the present studies. However, if the isolated cell
preparation we used does indeed represent the majority of neuronal
types in the arcuate, which is a very complex structure from the
neurochemical point of view, then any segregation might not be obvious
unless extremely large numbers of cells were examined. Nevertheless,
the data clearly show that all types of NPY receptors can exist
postsynaptically in the arcuate nucleus
a conclusion that is also
consistent with the molecular biological data.
The inhibition of Ca2+ channels we have demonstrated
now is a second type of response that would not have been evident from our previous slice studies. As with the K+ channel
response, all types of NPY receptors appeared capable of producing this
effect and these responses appeared to be "randomly" distributed
among cells, consistent with the data on K+ currents
discussed before. Indeed, as we now also have demonstrated, both of
these types of responses probably occur simultaneously in the same
cells. In some respects, such a result is not surprising given that the
activation of GIRKs and the voltage-dependent inhibition of N-type
Ca2+ channels (presumably the result of the neuronal
expression of
1B Ca2+ channel subunits) are
both mediated by the
/
subunits of heterotrimeric G proteins
(Herlitze et al. 1996
; Hille 1994
;
Huang et al. 1995
; Ikeda 1996
;
Krapivinsky et al. 1995
). These G-protein subunits presumably would be released on activation of any type of NPY receptor.
The fact that we observe both of these responses (i.e., Ca2+ current inhibition and K+ current
activation) together suggests that there is no higher level of
hierarchical control of these processes that might result in the
observation of one response or the other (Schreibmayer et al.
1996
). This potentially could result from the selective localization of some of the molecular elements involved in receptor/ion channel coupling. One caveat, however is that we do not know whether some such regulatory mechanism is disrupted and lost on cell isolation. Ca2+-imaging studies also revealed a further response that
seemed to be produced by activation of Y4 receptors. In these
instances, hPP produced oscillations in
[Ca2+]i, suggesting that additional signaling
pathways also may be activated by these receptors.
What is the physiological role of the inhibition of
Ca2+ currents and activation of K+ currents? It
is likely that some of the cells we recorded from are NPY-containing
neurons that project to different parts of the hypothalamus, including
the arcuate. The terminals of these neurons probably possess NPY
receptors that are important in feedback presynaptic inhibition of
transmitter release. Thus the events we have observed in the cell soma
may be a manifestation of events that occur in the terminals of these
neurons as well. Clearly, the inhibition of Ca2+ influx
and/or activation of K+ conductances may be important
mechanisms underlying presynaptic inhibition induced by activation of
G-protein-linked receptors (Miller 1998
). Inhibition of
Ca2+ currents by NPY receptors will directly suppress
Ca2+ influx into terminals. Second, activation of
K+ channels will increase the conductance of the terminal,
making incoming action potentials less effective in activating
Ca2+ channels. Similar events also may be involved in the
presynaptic inhibition of glutamate and GABA release produced by NPY
from the terminals of excitatory and inhibitory inputs into the arcuate nucleus (Glaum et al. 1996
; Rhim et al.
1997
). As we now also have demonstrated, NPY activation of
K+ currents in the cell bodies of arcuate neurons has a
profound inhibitory effect, completely suppressing spiking activity.
Thus activation of NPY receptors suppresses arcuate neurons in two ways. First, the excitability of neurons is reduced and then, if spikes
do fire, transmitter release from the terminals of the neurons also
would be reduced.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by National Institutes of Health Grants DA-02121, DA-02575, MH-40165, NS-33502, DK-42086, and DK-44840.
| |
FOOTNOTES |
|---|
Address for reprint requests: R. J. Miller, Dept. of Pharmacological and Physiological Sciences, The University of Chicago, 947 E. 58th St. (MC 0926), Chicago, IL 60637.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 21 July 1998; accepted in final form 9 November 1998.
| |
REFERENCES |
|---|
|
|
|---|
/
subunits.
Nature
380:
258-262, 1996[Medline].
a novel brain peptide with structural similarities to peptide YY and pancreatic polypeptide.
Nature
296:
659-660, 1982[Medline].This article has been cited by other articles:
![]() |
J. Xu, M. A. Kirigiti, M. A. Cowley, K. L. Grove, and M. S. Smith Suppression of Basal Spontaneous Gonadotropin-Releasing Hormone Neuronal Activity during Lactation: Role of Inhibitory Effects of Neuropeptide Y Endocrinology, January 1, 2009; 150(1): 333 - 340. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Acuna-Goycolea and A. N. van den Pol Peptide YY3-36 Inhibits Both Anorexigenic Proopiomelanocortin and Orexigenic Neuropeptide Y Neurons: Implications for Hypothalamic Regulation of Energy Homeostasis J. Neurosci., November 9, 2005; 25(45): 10510 - 10519. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Acuna-Goycolea, N. Tamamaki, Y. Yanagawa, K. Obata, and A. N. van den Pol Mechanisms of Neuropeptide Y, Peptide YY, and Pancreatic Polypeptide Inhibition of Identified Green Fluorescent Protein-Expressing GABA Neurons in the Hypothalamic Neuroendocrine Arcuate Nucleus J. Neurosci., August 10, 2005; 25(32): 7406 - 7419. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Moran, W. F. Colmers, and P. A. Smith Opioid-Like Actions of Neuropeptide Y in Rat Substantia Gelatinosa: Y1 Suppression of Inhibition and Y2 Suppression of Excitation J Neurophysiol, December 1, 2004; 92(6): 3266 - 3275. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-Y. Fu, C. Acuna-Goycolea, and A. N. van den Pol Neuropeptide Y Inhibits Hypocretin/Orexin Neurons by Multiple Presynaptic and Postsynaptic Mechanisms: Tonic Depression of the Hypothalamic Arousal System J. Neurosci., October 6, 2004; 24(40): 8741 - 8751. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Galas, M.-C. Tonon, D. Beaujean, R. Fredriksson, D. Larhammar, I. Lihrmann, S. Jegou, A. Fournier, N. Chartrel, and H. Vaudry Neuropeptide Y Inhibits Spontaneous {alpha}-Melanocyte-Stimulating Hormone ({alpha}-MSH) Release via a Y5 Receptor and Suppresses Thyrotropin-Releasing Hormone-Induced {alpha}-MSH Secretion via a Y1 Receptor in Frog Melanotrope Cells Endocrinology, May 1, 2002; 143(5): 1686 - 1694. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q.-Q. Sun, J. R Huguenard, and D. A Prince Neuropeptide Y receptors differentially modulate G-protein-activated inwardly rectifying K+ channels and high-voltage-activated Ca2+ channels in rat thalamic neurons J. Physiol., February 15, 2001; 531(1): 67 - 79. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |