|
|
||||||||
The Journal of Neurophysiology Vol. 82 No. 1 July 1999, pp. 50-59
Copyright ©1999 by the American Physiological Society
1Department of Neuroscience, University of Pittsburgh, Pittsburgh, Pennsylvania 15260; and 2Department of Molecular and Medical Pharmacology, UCLA School of Medicine, Los Angeles, California 90095
| |
ABSTRACT |
|---|
|
|
|---|
Poage, Robert E., Stephen D. Meriney, Cameron B. Gundersen, and Joy A. Umbach. Antibodies Against Cysteine String Proteins Inhibit Evoked Neurotransmitter Release at Xenopus Neuromuscular Junctions. J. Neurophysiol. 82: 50-59, 1999. Cysteine string proteins (CSPs) are evolutionarily conserved proteins that are associated with synaptic vesicles and other regulated secretory organelles. To investigate the role of CSPs in vertebrate neuromuscular transmission, we introduced anti-CSP antibodies into the cell bodies of Xenopus spinal motor neurons that form synapses with embryonic muscle cells in culture. These antibodies produced a rapid (within 3-6 min), and in most cases complete, inhibition of stimulus-dependent neurotransmitter secretion. However, spontaneous neurotransmitter release was stable (both in frequency and amplitude) throughout the period of antibody exposure. Several control experiments validated the specificity of the anti-CSP antibody effects. First, the anti-CSP antibody actions were not mimicked either by antibodies against another synaptic vesicle protein SV2, or by nonspecific immunoglobins. Second, heat treatment of the anti-CSP antibodies eliminated their effect on evoked secretion. Third, immunoblot experiments showed that the anti-CSP and anti-SV2 antibodies were highly selective for their respective antigens in these Xenopus cultures. We conclude from these results that CSPs are vital constituents of the pathway for regulated neurotransmitter release in vertebrates. Moreover, the selective inhibition of evoked, but not spontaneous transmitter release by anti-CSP antibodies indicates that there is a fundamental difference in the machinery that mediates these secretory processes.
| |
INTRODUCTION |
|---|
|
|
|---|
Appreciable progress has been made in identifying
and characterizing proteins that participate in regulated secretion at
nerve endings (Augustine et al. 1996
; Scheller
1995
; Sudhof 1995
). For instance, compelling
evidence indicates that proteins such as synaptotagmin, syntaxin,
vesicle-associated membrane protein (VAMP)/synaptobrevin and
synaptosomal-associated protein of 25 kDa (SNAP-25) play vital, although incompletely defined roles in the "synaptic vesicle cycle" (the cycle of exocytosis, endocytosis, and recycling of vesicles that
occurs locally at nerve terminals) (Augustine et al.
1996
; Scheller 1995
; Sudhof
1995
). Two strategies have figured prominently in efforts to
resolve more clearly the function of these and other membrane-trafficking proteins in rapid synaptic transmission. One
strategy involves the analysis of organisms with mutations in the
gene(s) encoding these proteins; the second approach uses specific
reagents (recombinant proteins, peptides, or antibodies) to alter
selectively the function of individual components of the secretory
machinery (Augustine et al. 1996
). Here we document the
use of affinity purified antibodies against cysteine string proteins
(CSPs) as perturbants of neurotransmitter release at Xenopus
neuromuscular junctions in vitro.
CSPs are synaptic vesicle proteins (Mastrogiacomo et al.
1994b
) that have been shown to be ubiquitously distributed at
nerve endings of the central and peripheral nervous system of fruit flies (Zinsmaier et al. 1990
) and rats (Kohan et
al. 1995
). CSPs are also associated with regulated secretory
organelles in a variety of nonneuronal cells (e.g., Braun and
Scheller 1995
; Chamberlain et al. 1996
;
Jacobsson and Meister 1996
; Kohan et al.
1995
; Pupier et al. 1997
). However, the precise
role of CSPs in regulated secretion has not been established
(Buchner and Gundersen 1997
). To date, most of the
information concerning CSP function has emerged from the analysis of
csp mutant alleles of Drosophila. These mutant alleles exhibit complex phenotypic changes that include
temperature-sensitive paralysis and premature death (Zinsmaier
et al. 1994
). The cellular basis of the temperature-sensitive
paralysis of csp mutant Drosophila is the
complete failure of action potentials to elicit the quantal release of
neurotransmitter (Umbach et al. 1994
). Additional
physiological and pharmacological evidence (Umbach et al.
1994
; Umbach and Gundersen 1997
; Ranjan
et al. 1998
) along with Ca-imaging results (Umbach et
al. 1998
) are compatible with the hypothesis that presynaptic Ca channels fail to open (or conduct) in these mutants at elevated temperatures. However, alternative proposals (such as a physical separation of synaptic vesicles from presynaptic Ca channels) have also
been advanced to explain the secretory disturbance in csp
mutant Drosophila (Heckmann et al. 1997
;
Ranjan et al. 1998
). Thus further work is needed to
clarify the molecular basis of the temperature-sensitive paralysis in
these organisms that lack the csp gene.
As an independent approach to assess CSP function, we used anti-CSP
antibodies as potential perturbants of CSP-mediated events in
Xenopus nerve-muscle cultures. This strategy complements
prior work done with csp mutant Drosophila and
avoids some of the complications of interpreting results from mutant
organisms (as discussed in Augustine et al. 1996
). Thus
the Xenopus system allows one to administer reagents
presynaptically and monitor their impact on secretory events that are
detected postsynaptically (Alder et al. 1992
;
Rettig et al. 1997
). We observed that intracellular application of anti-CSP antibodies into the presynaptic cell
specifically inhibited the stimulus-dependent secretion of
neurotransmitter without affecting spontaneous transmitter release.
These results indicate that CSPs are vital constituents of the evoked
secretory pathway at vertebrate fast synapses, and establish the
Xenopus co-culture system as a useful means to study the
function of CSPs.
| |
METHODS |
|---|
|
|
|---|
Nerve-muscle cultures
Cultures of spinal neurons and muscle cells were prepared
essentially as described by Tabti and Poo (1991)
and
Yazejian et al. (1997)
. Briefly, stage 19-22
Xenopus laevis embryos (Nieuwkoop and Faber
1967
) were dejellied and rinsed in sterile 10% normal frog
Ringer (NFR) solution (NFR is, in mM, 116 NaCl, 2 KCl, 1.8 CaCl2, 1 MgCl2, and 10 HEPES, pH 7.3), and the spinal cord and myotomes were removed and
dissociated in a divalent-cation-free solution (in mM: 116 NaCl, 2 KCl, 0.4 EDTA, and 10 HEPES, pH 7.3). After 60-90 min at room
temperature (20-22°C), disaggregated cells were plated on plastic
culture dishes and maintained (at 20-22°) in medium composed of 48%
NFR with 40% Isocoves (this and other medium constituents were from
Sigma, St. Louis, MO) and 12% H20 supplemented
with 25 ng/ml brain-derived neuronotrophic factor (Regeneron,
Tarrytown, NY), insulin (0.1 mg/ml), transferrin (0.6 mg/ml), sodium
selenite (0.7 mg/ml), and 50 units/ml penicillin-streptomycin. Motor
neurons form functional synaptic contacts with muscle cells within
24 h (Kidokoro and Yeh 1982
), and cultures were
used 1-3 days after plating.
Electrophysiological analysis of synaptic transmission
Conventional whole cell recording configurations were used to
measure transmembrane currents or voltages from neuronal somata or
muscle cells (at 20-22°). Patch pipettes (2-4 M
) were filled in
a two-step procedure: for muscle cells, the tip was first dipped in
solution A (in mM: 100 KCl, 1 CaCl2, 1 MgCl2, 11 EGTA, and 20 HEPES, pH 7.3). The tips
of pipettes for neurons were dipped with solution B (in mM:
110 KCl, 1 NaCl, 1 MgCl2, and 10 HEPES, pH 7.3).
Muscle pipettes were backfilled with solution A plus 5 mM of
the local anesthetic QX-314 (Alomone, Jerusalem, Israel) to block
muscle contraction. Neuronal pipettes were backfilled with
solution B plus 4 mM MgATP and 0.3 mM GTP along with any perturbant. The bath solution was NFR.
Action potentials were elicited (using pulses of 0.5 ms duration and
0.5-2 nA) in the neuron during whole cell recording in the
current-clamp mode. These action potentials normally evoked the quantal
release of transmitter from the presynaptic element, and this released
transmitter was detected postsynaptically with a second patch pipette
on the muscle cell (nerve-muscle pairs were chosen where the axon
showed minimal branching and the nerve terminal was <100 µm from the
cell body). Excitatory postsynaptic currents (EPSCs) were recorded
using a holding potential of
80 mV. We discarded experiments in which
any of the following parameters changed: 1) access
resistance: if the muscle patch pipette exhibited sustained changes of
access resistance, data were not analyzed; 2) action
potential waveform: if the neuronal action potential failed or if the
threshold for generating an action potential increased more than
threefold, the recording was terminated; 3) changes of
spontaneous transmitter release: if there was a trend (over several
minutes) toward a large (>4-fold) increase in the frequency of
spontaneous release events (miniature EPSCs, or mEPSCs), the data were
not used, because this was often a prelude to cell death.
EPSCs were elicited at low frequency (0.06 Hz), because there is greater variability of EPSC amplitude at higher stimulation frequencies. Spontaneous mEPSCs were recorded continuously between EPSCs. Data were stored and analyzed using pCLAMP 6.0 and Axograph 3.0 (Axon Instruments).
Antibody preparation and characterization
Antibodies were raised against a recombinant construct of rat
CSP from which the cysteine-string domain was deleted. Vertebrate CSPs
are highly conserved (Mastrogiacomo et al. 1998
), and we have found that antibodies against rat CSP efficiently cross-react with
CSPs of other species (Coppola and Gundersen 1996
;
Mastrogiacomo et al. 1998
). In addition, removal of the
cysteine string precludes the formation of thiol-linked multimers of
the recombinant protein (Gundersen, unpublished observations). Thus rat
CSP cDNA in Bluescript (see Mastrogiacomo and Gundersen
1995
) was treated with Sty I. This restriction
endonuclease excises a 96 nucleotide fragment from rat CSP cDNA that
leads to the deletion of amino acid residues from Lys107 through Lys
139. This region encompasses the entire cysteine string of rat CSP.
After ligation, this "C-free" construct was used as a template for
polymerase chain reaction (PCR) (sense primer:
CATATGGCTGACCAGAGG; antisense primer:
GGATCCTTAGTTGAACCCGTCGG). This PCR product was ligated into
the Eco RV site of Bluescript that had been treated with
Taq polymerase to generate a T overhang. This insert was
excised with Nde I and Bam HI and ligated into pET15b (Novagen, Madison, WI). The resulting construct encodes a
His6-tagged version of C-free rat CSP under control of the lac promoter. This plasmid was transformed into BL-21 cells, and after induction, recombinant protein was purified using Talon resin (Clontech, Palo Alto, CA) according to the supplier's protocols. This
His-tagged, C-free rat CSP was used to induce antibody production in
rabbit (performed by Babco, Richmond, CA). Antibodies specific for rat
CSP were purified from immune serum using Aminolink resin (Pierce,
Rockford, IL) to which we coupled the recombinant C-free protein that
had been treated with thrombin to remove the His-tag. These antibodies
exhibited high specificity for detection of rat CSP on immunoblot, as
judged by the same criteria in Mastrogiacomo et al.
(1994a)
. In addition, owing to the high degree of sequence conservation among vertebrate CSPs (see Mastrogiacomo et al.
1998
), these antibodies efficiently cross reacted with
Xenopus brain CSP (XCSP) as shown by Mastrogiacomo et
al. (1998)
. We verified that these antibodies recognized XCSP
in the Xenopus nerve-muscle cultures by solubilizing
cells on individual culture plates using 10 mM
3([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPS) in 0.1 M NaCl, 50 mM Tris, and 1 mM EDTA (pH 7.5) and extracting protein using an organic solvent extraction procedure (Wessell and Flügge 1984
). The recovered protein
was dissolved at 50°C in sample buffer (Laemmli 1970
)
with 5% SDS and 10 mM dithiothreitol and alkylated with 22 mM
iodoacetamide for 1-2 h in the dark. Samples were resolved on a 12.5%
SDS-polyacrylamide gel for immunoblot analysis as described before
(Mastrogiacomo et al. 1994a
,b
) except that we used
enhanced chemiluminescence detection (Amersham-Pharmacia, Arlington
Heights, IL).
Various control antibodies were prepared for these studies. First, we
used ammonium sulfate precipitation (Harlow and Lane 1988
) to recover immunoglobin (IgGs) from rabbit immune serum that had been depleted of CSP-specific antibodies by affinity chromatography (see above). At least 500 times more of these
"flow-through" IgGs were required to produce an equivalent
immunoblot signal to that obtained using 0.5 µg/ml of the affinity
purified anti-CSP IgG (data not shown). Thus these flow-through IgGs
(that did not bind to the CSP affinity matrix) were used to control for
nonspecific effects of IgGs in these experiments. Second, we used
monoclonal antibodies against the SV2 protein of
synaptic vesicles (Buckley and Kelly 1985
) (these
antibodies were a kind gift from Dr. E. Schweitzer, UCLA) that
recognize a cytosolic epitope of this protein. Third, we heat treated
(10 min at 70°C) the anti-CSP antibodies. In all cases, antibodies
were dialyzed against 0.1 M KCl, 10 mM HEPES, 0.1 mM EDTA (pH 7.5) and
adjusted to a concentration of 2 mg/ml before use in these experiments.
Antibodies were diluted to 0.02 mg/ml in the intracellular patch
pipette solution.
| |
RESULTS |
|---|
|
|
|---|
Characteristics of evoked and spontaneous neurotransmitter release at Xenopus nerve-muscle contacts
In our initial experiments, we monitored evoked and spontaneous
transmitter release in preparations that were not exposed to any
antibody. As illustrated in Fig.
1A, EPSCs can be elicited by
action potentials (Fig. 1C) initiated in the neuronal cell body. Although the amplitude of individual EPSCs fluctuated (as seen in
Fig. 1, A and D) during a recording session, the
mean EPSC amplitude in this experiment (Fig.
2A,
) did not deviate appreciably from the value in the first minute. In all experiments, we
monitored somatically evoked action potentials (Fig. 1C), to verify that stimulus generation was not affected by reagents in the
pipette.
|
|
Summaries of normalized EPSC recordings from three control preparations
are in Fig. 2A. These data show that, although there is
variability in the amplitude of individual EPSCs recorded during an
experiment, the mean amplitude of these EPSCs does not show any
consistent trend (to increase or decrease) throughout these recordings.
[Also, see the summary results in Fig. 8A in which we
normalized mean EPSC amplitude at the end of a recording episode to the
mean amplitude at the start of the recording. These data (Fig.
8A) show that there is no significant change over time of EPSC amplitude in these control experiments.] These results confirm observations of Alder and colleagues (1992)
that EPSC
amplitudes remain relatively stable in these preparations, when they
are subjected to low-frequency stimulation (<0.1 Hz). This stability of EPSC amplitude produced a reliable baseline for our evaluation of
the impact of anti-CSP antibodies on evoked transmitter secretion.
Figure 1B shows examples of mEPSCs recorded during the
intervals between the EPSCs of Fig. 1A. Mean mEPSC frequency
and amplitude do not change significantly throughout this recording
session (Fig. 1, E and F). However, it is
important to note (as can be seen in the mEPSC records of Fig.
1B, and as documented by the large standard deviation of
mEPSC amplitudes in Fig. 1E) that mEPSC amplitude varies
greatly in these Xenopus nerve-muscle preparations. The
highly skewed nature of the mEPSC amplitude distribution (data not
shown, but see Kidokoro et al. 1980
; Song et al.
1997
) precludes us from undertaking conventional quantal
analysis (because for any given evoked response it is not known which
size quanta contribute to that release event). As an alternative
approach to normalize data for comparison among different experiments,
we used the same normalization strategy alluded to above for EPSCs.
Thus Fig. 8 includes comparisons of mean mEPSC frequency and amplitude
at the beginning and end of each experiment. This enables us to
determine whether there are any consistent, time-dependent changes of
these parameters of secretion. For these control experiments (Fig. 8), neither mEPSC amplitude nor frequency showed any significant change over time, as judged by ANOVA. These findings are similar to those of
Alder and colleagues (1992)
, who also found that
spontaneous transmitter release was relatively stable in this preparation.
Anti-CSP IgG reduces evoked, but not spontaneous transmitter release
To investigate the effect of affinity purified anti-CSP
antibodies on transmitter release, we included 0.02 mg/ml of these antibodies in the motor neuron patch pipette and monitored EPSCs, mEPSCs, and action potentials as in the control experiments
of Figs. 1 and 2. In the example of Fig.
3, EPSC amplitude was initially stable,
but within 2 min a systematic decline of EPSC amplitude was observed,
and by 9 min action potentials (shown in Fig. 3C) no longer
elicited postsynaptic responses (Fig. 3, A and
D). This gradual decline of EPSC amplitude is consistent
with the hypothesis that the anti-CSP antibodies are migrating from
their site of introduction at the cell body to sites of transmitter
release where they interfere with a process that is vital for evoked
secretion of transmitter. Indeed, Popov and Poo (1992)
showed that macromolecules comparable in size to IgGs can transit from
the neuronal soma to the nerve terminal within a few minutes. However,
because action potential generation is unimpaired for the duration of
this experiment (Fig. 3C), it is unlikely that this antibody
effect is mediated via a general impairment of membrane excitability.
Indeed, because the anti-CSP antibodies were introduced in the cell
body, this is where changes in action potentials should have been most
prominent. The absence of an effect on action potentials indicates that
there is an alternative target of these antibodies.
|
In contrast to the decline of EPSC amplitude in Fig. 3A, there was no significant change in the frequency, mean amplitude, or time course of mEPSCs throughout this experiment (Fig. 3, B, E, and F). In other words, at the same time that stimulus-evoked responses could no longer be elicited, spontaneous quantal release events persisted (Fig. 3). These results show that presynaptic introduction of anti-CSP antibodies has no effect on the postsynaptic sensitivity to transmitter. In addition, these data indicate that CSP antibodies have a selective effect to inhibit evoked neurotransmitter secretion, but they do not simultaneously affect the secretory process that underlies mEPSCs.
Representative EPSC and mEPSC data for five additional experiments using anti-CSP antibodies are presented in Fig. 4. The results in Fig. 4A were chosen to illustrate the variability in the time course of the decline of EPSCs in these experiments. However, in all cases, EPSC amplitude is reduced to an extremely low level, or abolished, within 5-20 min. As in Fig. 3, we infer that part of the explanation for the different kinetics of EPSC blockade is that there are differences in the rate of transit of anti-CSP IgGs from the neuronal pipette to the nerve terminal. Nevertheless, in each instance, the effect of these IgGs is to inhibit evoked transmitter release (Fig. 4A).
|
In preparations exposed to anti-CSP IgGs, mEPSCs were detected
throughout the experiment (Fig. 4, B and C). The
summary records (Fig. 4, B and C) show that
mEPSCs are still present at times when EPSCs are either reduced to
extremely low amplitudes or abolished. This conclusion holds even in
the example (Fig. 4C,
) where mEPSC frequency exhibited a
statistically significant (P < 0.05 by ANOVA) decline
with time. However, this decline of mEPSC frequency was not a
consistent finding as documented in the other examples in Fig.
4C, and in the summary results of Fig. 8. These results
further illustrate the divergent effects of anti-CSP IgGs on EPSCs and mEPSCs.
Antibody control experiments
To control for the specificity of the effect of anti-CSP IgG on EPSCs, we first tested the action of IgG from the immune serum that had been depleted of CSP-specific IgG by affinity chromatography. These flow-through IgGs control for potential nonspecific effects of IgG in these experiments. Inclusion of this IgG fraction at 0.02 mg/ml into the motor neuron soma patch pipette showed no time-dependent effect to alter either evoked (EPSCs) or spontaneous (mEPSCs) transmitter release (Fig. 5). In contrast to the anti-CSP antibodies, there was no trend toward a decline of EPSC amplitude (Fig. 5, A and C) in this example, or in the additional seven trials using these IgGs (Fig. 8). A similar conclusion holds for mEPSC amplitude and frequency (Figs. 5 and 8). Thus there does not appear to be any nonspecific effect of this IgG fraction on evoked or spontaneous transmitter release.
|
To control for the possibility that IgG binding to synaptic
vesicles produces steric hindrance that inhibits secretion, we tested
the effects of IgG directed against a cytoplasmic portion of the
protein, SV2. This anti-SV2
IgG was chosen as a control, because SV2 is a
well-established synaptic vesicle protein (Buckley and Kelly
1985
; Sudhof 1995
), but there is no evidence
that SV2 is involved in any vital function
related to the regulation of vesicle fusion. A typical recording made
using anti-SV2 shows no consistent change of
either EPSCs or mEPSCs (Fig. 6). Summary data from a total of eight experiments using SV2
IgG are shown in Fig. 8. These data demonstrate that there are no
consistent effects on EPSCs or mEPSCs of this IgG at the concentration
used in these experiments.
|
As a final control for the specificity of anti-CSP IgGs on evoked secretion, we tested heat-treated antibodies. Anti-CSP IgG was heated to 70°C for 10 min before inclusion in the presynaptic patch pipette. After this treatment, anti-CSP IgG had no effect on EPSC amplitude (Fig. 7). As with untreated controls, or preparations exposed to flow-through IgG, or SV2 IgG, there was no consistent effect on either EPSCs or mEPSCs (Figs. 7 and 8). Thus the impact of anti-CSP IgG on EPSCs (Figs. 3 and 4) appears to be specific and can be eliminated by heat treatment that denatures these antibodies.
|
|
In Fig. 8, we summarize the impact of different empiric treatments on EPSC amplitude and mEPSC amplitude and frequency in these investigations. These results were obtained by normalizing the mean amplitude of the final five EPSCs of the recording to the mean amplitude of the first five EPSCs of the recording. We selected for inclusion in this figure all experiments that satisfied our criteria of stability (see METHODS). As is evident from these data (Fig. 8), EPSC amplitude does not change significantly relative to control (no antibody) in three of the experimental conditions (Flow, Heat, and SV2). However, there is a significant difference (P < 0.002 using a 1-way ANOVA with Tukey's post hoc test) between control and CSP IgG. This method of data analysis confirms the potent and selective inhibition of evoked secretion by anti-CSP IgG. At the same time, none of these treatments had any significant effect on mEPSC amplitude or frequency relative to control with no antibody (Fig. 8; significance was tested as for EPSCs using 1-way ANOVA). These results highlight the fact that the anti-CSP IgGs preferentially affect EPSCs, but not mEPSCs.
Immunoblot identification of CSP and SV2 in Xenopus nerve-muscle cultures
An important consideration for this work is the specificity
of antibody binding to CSP and SV2 in these
cultures. As shown in the immunoblots of Fig.
9, both the CSP and
SV2 antibodies identified single proteins of
~34 and 100 kDa, respectively. These masses are compatible with the
mass of CSP in Xenopus (Mastrogiacomo et al.
1998
) and with the mass of SV2 originally
detected in electric fish (Buckley and Kelly 1985
).
These data are consistent with the conclusion that these antibodies
selectively interact with the appropriate antigens in these
experiments.
|
| |
DISCUSSION |
|---|
|
|
|---|
The current investigations reveal that affinity purified antibodies against CSPs selectively abolish stimulus-dependent neurotransmitter release without affecting spontaneous transmitter release in Xenopus nerve-muscle cultures. Various control antibody preparations do not mimic this anti-CSP antibody effect. These results indicate that CSPs are vital components of the regulated secretory pathway in vertebrates, and they provide useful insights into the role of CSPs in secretory membrane trafficking at nerve terminals.
An important motivation for undertaking the current experiments was
that most of the information concerning CSP function had emerged from
studies of csp mutant Drosophila (Heckmann
et al. 1997
; Ranjan et al. 1998
; Umbach
et al. 1994
, 1998
; Umbach and Gundersen
1997
; Zinsmaier et al. 1994
). Although these
studies of the phenotype of csp mutant organisms have
considerably advanced our understanding of the role of CSPs, there were
certain constraints on the conclusions that could be drawn from these
investigations. For example, all of the functional studies of
csp mutant Drosophila have focused on a minor
subset of these organisms that escaped the developmental lethality of
mutating the csp gene. Indeed, Zinsmaier and
colleagues (1994)
reported that the survival of their
csp mutant alleles during development ranged between ~1 and 15%. Thus the full spectrum of phenotypic changes of these csp mutants remains to be established. As an independent
approach to investigate CSP function, we chose an antibody-perturbation strategy using Xenopus nerve-muscle cultures.
Antibodies have been widely used as probes of regulated secretion
(Alder et al. 1992
; Ali et al. 1989
;
Elferink et al. 1993
; Kenigsberg and Trifaro
1985
; Mikoshiba et al. 1995
; Mochida et al. 1995
; Perrin et al. 1987
; Pieribone
et al. 1995
; Schweizer et al. 1989
;
Skehel et al. 1995
; Walent et al. 1992
).
We address three important considerations that are relevant to the
design and interpretation of such experiments (also see comments in the preceding cited papers and Augustine et al. 1996
).
First, one needs highly selective antibodies. Second, one needs to
control for the possibility that antibody binding produces steric
occlusion of events (such as vesicle docking at the plasma membrane),
rather than interfering more specifically with a function mediated by the antigen. And third, one needs to control for nonspecific
consequences of antibody cross-linking of target antigens.
The first issue concerns antibody selectivity. The anti-CSP antibodies
used here were affinity purified, and, based on immunoblot analysis,
they were highly selective for CSP in Xenopus nerve-muscle cultures. These results are comparable with findings made using other
preparations of affinity purified anti-CSP antibodies (Kohan et
al. 1995
; Mastrogiacomo et al. 1994a
,b
;
Mastrogiacomo and Gundersen 1995
), and they are
identical to results reported for the immunoblot detection of CSP in
adult Xenopus brain (Mastrogiacomo et al. 1998
). Moreover, the differential action of the anti-CSP
antibodies on evoked versus spontaneous transmitter release further
supports the argument for the selectivity of these antibodies. We
conclude that the effects of the anti-CSP antibodies are mediated via
antibody binding to CSP.
Two arguments diminish the likelihood that steric hindrance accounts
for the effects of the anti-CSP antibodies. First, if steric hindrance
were involved, antibodies against other synaptic vesicle proteins
should also have inhibited transmitter release. Instead, we found that
monoclonal antibodies targeted to a cytosolic domain of the synaptic
vesicle protein SV2 (Buckley and Kelly 1985
) had no effect on secretion. Our observations are
reminiscent of results of Elferink and co-workers
(1993)
, who reported that SV2 antibodies
did not affect secretion in PC-12 cells. Indeed, Elferink and
colleagues (1993)
found that antibodies against two other
synaptic vesicle proteins (synaptobrevin and synaptophysin) also had no
impact on secretion in the PC-12 system. These data indicate that
antibody binding to secretory vesicle antigens does not universally
impair transmitter release, as would be expected if steric hindrance
mediated the antibody effect.
The second argument against steric hindrance is that we observed a
selective inhibition of evoked, but not spontaneous transmitter release. Had steric hindrance been an issue, we would have expected to
record a decline of both spontaneous and evoked secretion. Because this
is not what we observed, we conclude provisionally that the blockade of
evoked transmitter release is not mediated via steric hindrance. The
only caveat here is that there have been recent indications that the
machinery underlying regulated and constitutive secretion may involve
distinctive macromolecular components at nerve terminals. For instance,
Deitcher and colleagues (1998)
reported the complete
loss of stimulus-dependent transmitter release in mutant alleles of
Drosophila that lacked neuronal synaptobrevin (n-syb). In
these n-syb mutants, spontaneous transmitter secretion persisted (albeit at a rate lower than observed in wild-type controls). This led to the conclusion that these spontaneous release events were
supported by a protein complex that was distinct from the complex
required for stimulus-dependent secretion (Deitcher et al.
1998
). Independently, work using clostridial neurotoxins has yielded a similar conclusion for the role of synaptobrevin in secretory
events at crayfish nerve endings (Hua et al. 1998
). Interestingly, we had also observed that spontaneous transmitter release continued unabated in csp mutant
Drosophila, even when evoked transmitter secretion was
abolished (Umbach et al. 1994
). Thus synaptic
transmission in csp mutant Drosophila exhibits
interesting parallels to the effects of anti-CSP antibodies in
Xenopus nerve-muscle cultures. Together, these data point to
a crucial role of CSPs in stimulus-secretion coupling at both
vertebrate and invertebrate nerve terminals. What remains unresolved at
this time is the mechanism of the selective sparing of spontaneous
secretion in these widely divergent experimental paradigms
(Xenopus cultures and mutant Drosophila larvae).
Among the explanations for our observations in the current experiments
are as follows: separate populations of vesicles that mediate
constitutive or evoked secretion, differential sensitivity of the
release machineries to anti-CSP antibodies (as would occur if the
antibodies interfered with a CSP-Ca channel link), or the presence of a
form of CSP that is not recognized or affected by these antibodies.
Regardless of which explanation is correct, it is evident that the
selective occlusion by anti-CSP antibodies of evoked transmitter
release makes these reagents useful probes that should help us to
understand the underlying differences between the evoked and
constitutive secretory pathways.
The third consideration for the interpretation of our findings is the
issue of antigen cross-linking. Here the arguments are very similar to
those raised for steric hindrance. Thus the failure of
anti-SV2 antibodies to block secretion argues
that even if cross-linking occurs between vesicular antigens, it does
not obstruct transmitter release. An obvious concern here is that
monoclonal anti-SV2 antibodies are less likely to
cross-link antigens than the polyclonal anti-CSP antibodies. In spite
of this, the selective impact of anti-CSP antibodies on evoked, but not
spontaneous secretion is also incompatible with the idea that
cross-linking generally immobilizes the synaptic vesicle pool or
distorts the vesicle surface. In this same context, an independent
approach that is commonly used to exclude antigen cross-linking is to
assess the effect of monovalent Fab fragments of antibodies (e.g., see
Alder et al. 1992
; Perrin et al. 1987
).
In our hands, preparation of Fab fragments led to decline in the
threshold for CSP detection on immunoblots and a concomitant loss of
the antibody effect on evoked transmitter secretion (data not shown).
Thus, although we cannot unequivocally exclude antigen cross-linking as
contributing to our results, the foregoing arguments vitiate this explanation.
Another perspective on this work emerges from a comparison of our
results with those of Alder and colleagues (1992)
, who
administered anti-synaptophysin antibodies presynaptically in this same
preparation. The prominent difference is that anti-synaptophysin
antibodies depressed both spontaneous and evoked secretion
(Alder et al. 1992
). Because of this effect,
Alder and colleagues (1992)
could not exclude the
possibility of steric hindrance as an underlying explanation for their
results. This contrasts with the selective inhibition of evoked
secretion by anti-CSP antibodies and further emphasizes the potential
value of resolving the molecular basis of the differential effects of
these antibodies on the constitutive and evoked secretory pathways.
Another striking feature of our results was the relative rapidity with
which the anti-CSP antibodies blocked transmitter release. Popov
and Poo (1992)
previously demonstrated that molecules as large
as antibodies were transported within minutes to nerve terminals in
this preparation. Thus, from our results showing that the blockade of
EPSCs could occur within minutes, we infer that anti-CSP antibodies act
swiftly to occlude evoked secretion once they reach the nerve terminal.
This time course of antibody action is incompatible with a depletion of
synaptic vesicles or any similarly slow process and suggests instead
that these antibodies interfere directly with an event that is vital
for evoked transmitter release. Given past studies that implicate CSPs
in the modulation of presynaptic calcium channels (Gundersen and
Umbach 1992
; Leveque et al. 1998
; Ranjan
et al. 1998
; Umbach et al. 1994
,
1995
, 1998
; Umbach and Gundersen
1997
), it is likely that anti-CSP antibodies interfere with
this modulatory interaction and selectively block evoked transmitter
release. However, CSPs have also been postulated to contribute to other
steps in the regulated secretory pathway (Buchner and Gundersen
1997
), and additional work will be needed to exclude an
antibody effect on these steps. It is in this context that the
Xenopus nerve-muscle system is particularly advantageous, because it was recently shown that one can record both presynaptic calcium channel currents and rapid calcium transients in this preparation (DiGregorio and Vergara 1997
;
Yazejian et al. 1997
). Thus an important future
direction for this work will be to assess the impact of anti-CSP
antibodies on the behavior of presynaptic calcium channels, because
this will provide mechanistic insight into the inhibition of evoked
secretion presented here.
| |
ACKNOWLEDGMENTS |
|---|
We thank W. Labeikovsky for help with data analysis, Dr. A. Mastrogiacomo for help with antibody preparation, Dr. E. Schweitzer for SV2 antibodies, and N. Britton for preparing the manuscript.
This work was supported by National Institutes of Health Grants NS-32345 (to S. D. Meriney), MH-18723 (to R. E. Poage), and NS-31934 (to J. A. Umbach).
| |
FOOTNOTES |
|---|
Address for reprint requests: J. A. Umbach, Dept. of Molecular and Medical Pharmacology, UCLA School of Medicine, Los Angeles, CA 90095.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 1 December 1998; accepted in final form 11 March 1999.
| |
REFERENCES |
|---|
|
|
|---|
1A subunit of the P/Q-type calcium channel.
J. Biol. Chem.
273:
13488-13492, 1998
-fodrin inhibits secretion from permeabilized chromaffin cells.
Nature
326:
498-501, 1987[Medline].This article has been cited by other articles:
![]() |
C. Schietroma, H.-Y. Yu, M. C. Wagner, J. A. Umbach, W. M. Bement, and C. B. Gundersen A Role for Myosin 1e in Cortical Granule Exocytosis in Xenopus Oocytes J. Biol. Chem., October 5, 2007; 282(40): 29504 - 29513. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. Smith, J. A. Umbach, A. Hirano, and C. B. Gundersen Interaction between Constitutively Expressed Heat Shock Protein, Hsc 70, and Cysteine String Protein Is Important for Cortical Granule Exocytosis in Xenopus Oocytes J. Biol. Chem., September 23, 2005; 280(38): 32669 - 32675. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. van Weeren, A. M. de Graaff, J. D. Jamieson, J. J. Batenburg, and J. A. Valentijn Rab3D and Actin Reveal Distinct Lamellar Body Subpopulations in Alveolar Epithelial Type II Cells Am. J. Respir. Cell Mol. Biol., March 1, 2004; 30(3): 288 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, K. W. Peters, F. Sun, C. R. Marino, J. Lang, R. D. Burgoyne, and R. A. Frizzell Cysteine String Protein Interacts with and Modulates the Maturation of the Cystic Fibrosis Transmembrane Conductance Regulator J. Biol. Chem., August 2, 2002; 277(32): 28948 - 28958. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Dawson-Scully, P. Bronk, H. L. Atwood, and K. E. Zinsmaier Cysteine-String Protein Increases the Calcium Sensitivity of Neurotransmitter Exocytosis in Drosophila J. Neurosci., August 15, 2000; 20(16): 6039 - 6047. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Nie, R. Ranjan, J. J. Wenniger, S. N. Hong, P. Bronk, and K. E. Zinsmaier Overexpression of Cysteine-String Proteins in Drosophila Reveals Interactions with Syntaxin J. Neurosci., December 1, 1999; 19(23): 10270 - 10279. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||