|
|
||||||||
The Journal of Neurophysiology Vol. 82 No. 3 September 1999, pp. 1590-1598
Copyright ©1999 by the American Physiological Society
Neurological and Urological Diseases Research, Pharmaceutical Products Division, Abbott Laboratories, Abbott Park, Illinois 60064-3500
| |
ABSTRACT |
|---|
|
|
|---|
Burgard, Edward C.,
Wende Niforatos,
Tim van Biesen,
Kevin J. Lynch,
Edward Touma,
Randy E. Metzger,
Elizabeth A. Kowaluk, and
Michael F. Jarvis.
P2X Receptor-Mediated Ionic Currents in Dorsal Root Ganglion
Neurons.
J. Neurophysiol. 82: 1590-1598, 1999.
Nociceptive neurons in the dorsal root ganglia (DRG) are
activated by extracellular ATP, implicating P2X receptors as potential mediators of painful stimuli. However, the P2X receptor subtype(s) underlying this activity remain in question. Using electrophysiological techniques, the effects of P2X receptor agonists and antagonists were
examined on acutely dissociated adult rat lumbar DRG neurons. Putative
P2X-expressing nociceptors were identified by labeling neurons with the
lectin IB4. These neurons could be grouped into three categories based
on response kinetics to extracellularly applied ATP. Some DRG responses
(slow DRG) were relatively slowly activating, nondesensitizing, and
activated by the ATP analogue
,
-meATP. These responses resembled
those recorded from 1321N1 cells expressing recombinant
heteromultimeric rat P2X2/3 receptors. Other responses
(fast DRG) were rapidly activating and desensitized almost completely
during agonist application. These responses had properties similar to
those recorded from 1321N1 cells expressing recombinant rat
P2X3 receptors. A third group (mixed DRG) activated and
desensitized rapidly (P2X3-like), but also had a slow,
nondesensitizing component that functionally prolonged the current.
Like the fast component, the slow component was activated by both ATP
and
,
-meATP and was blocked by the P2X antagonist TNP-ATP. But
unlike the fast component, the slow component could follow
high-frequency activation by agonist, and its amplitude was potentiated
under acidic conditions. These characteristics most closely resemble those of rat P2X2/3 receptors. These data suggest that
there are at least two populations of P2X receptors present on adult
DRG nociceptive neurons, P2X3 and P2X2/3. These
receptors are expressed either separately or together on individual
neurons and may play a role in the processing of nociceptive
information from the periphery to the spinal cord.
| |
INTRODUCTION |
|---|
|
|
|---|
The dorsal root ganglion (DRG) contains the cell
bodies of primary afferent sensory neurons that relay nociceptive and
proprioceptive information from the periphery to the dorsal horn of the
spinal cord. Pharmacological modulation of neurotransmitter receptors involved in the propagation of pain signals via the DRG should therefore shift the threshold for nociception. In this context, P2X
receptors located on peripheral sensory neurons have been implicated in
the initiation of pain (Bland-Ward and Humphrey 1997
;
Burnstock 1996
; Cook et al. 1997
).
However, the P2X receptor subtypes underlying this phenomenon have not
been elucidated, nor has their subcellular localization or activation characteristics.
P2X receptors belong to a family of ligand-gated ion channels that are
activated by extracellular ATP (Ralevic and Burnstock 1998
). Seven distinct P2X receptors
(P2X1-P2X7) have been
identified and cloned, and six of these
(P2X1-P2X6) may be
expressed on the plasma membrane of neurons (Collo et al.
1996
; Lewis et al. 1995
; Valera et al.
1994
). Within the rat peripheral nervous system, localization
of P2X3 message was initially described in
neurons of the DRG (Chen et al. 1995
; Lewis et
al. 1995
). Although mRNA for other P2X receptors is present in
these neurons, colocalization of both P2X2 and
P2X3 receptor protein has been demonstrated in a
subset of DRG neurons (Vulchanova et al. 1997
). In rat
nodose ganglia, coexpressed P2X2 and
P2X3 receptor subtypes form functional heteromultimeric P2X2/3 receptors (Radford
et al. 1997
; Thomas et al. 1998
). From these
data, it is clear that native P2X receptors can exist as either hetero-
or homomultimeric complexes in sensory neurons.
Rat DRG are comprised of a variety of neuronal cell types that differ
in their intrinsic electrophysiological (Caffrey et al.
1992
; Harper and Lawson 1985b
; Scroggs
and Fox 1992
; Scroggs et al. 1994
) and
cytochemical (Dodd et al. 1984
; Schoenen et al. 1989
) properties. Among these, nociceptive C-fiber neurons
belong to a subset of small diameter cells located in the DRG
(Harper and Lawson 1985a
). The isolectin IB4 has been
shown to selectively label small-diameter DRG nociceptors that are
largely TrkA negative and nonpeptidergic (Molliver et al.
1995
). IB4-positive neurons also express the
P2X3 receptor (Vulchanova et al.
1998
), and expression patterns suggest that it is colocalized
with the P2X2 receptor in some DRG neurons
(Vulchanova et al. 1997
). A subset of
capsaicin-sensitive, peripherin-positive C-fiber neurons also contains
P2X3 receptor mRNA (Chen et al.
1995
). Taken together, it appears that
P2X3 receptors are expressed primarily on
nociceptive DRG neurons.
It is known that P2X2 and
P2X3 receptors are expressed on the surface of
rat DRG neurons, but it is not known in what proportions functional
homomeric P2X2, P2X3, or
heteromeric P2X2/3 receptors are expressed.
Rapidly desensitizing ATP- or
,
-methylene ATP-evoked responses
have been described in neonatal rat DRG (Jahr and Jessell 1983
; Rae et al. 1998
; Robertson et al.
1996
). Although these response properties fit those for either
P2X1 or P2X3 receptors, the
pharmacological profile of rat DRG responses suggests that the rapidly
desensitizing response is mediated by P2X3, and
not P2X1 receptors (Rae et al.
1998
). However, there appear to be some species differences
with respect to P2X receptor expression in DRG (Bean
1990
). Rat DRG response properties resemble those of
P2X3 receptors (Chen et al. 1995
),
whereas the nondesensitizing properties of bullfrog DRG neurons
(Bean 1990
; Li et al. 1993
) resemble
P2X2 or P2X2/3 receptor
activation (Brake et al. 1994
; Lewis et al.
1995
).
Many behavioral studies concerning the function of primary afferent
neurons in various pain models are conducted in the adult rat. Because
of possible species differences, potential developmental changes, or
influences of long-term culture conditions on P2X receptor expression,
the present study was designed to characterize P2X responses in acutely
dissociated adult rat DRG neurons. Based on pharmacological and kinetic
profiles, the data presented here support the existence of at least two
distinct P2X receptor subtypes in adult DRG neurons,
P2X3 and P2X2/3.
Preliminary results from these studies have appeared in abstract form
(Burgard et al. 1998
).
| |
METHODS |
|---|
|
|
|---|
Neuronal cultures
Adult male Sprague-Dawley rats (~8 wk old, 250-300 g) were deeply anesthetized with CO2 anesthesia and killed by decapitation. Lumbar (L4-L6) DRG were dissected from the vertebral column and placed in Dulbecco's modified Eagles medium (DMEM, Hyclone, Logan, UT) containing 0.3% collagenase B (Boehringer Mannheim, Indianapolis, IN) for 60 min at 37°C. The collagenase was replaced with 0.25% trypsin (GIBCO-BRL, Grand Island, NY) in Ca2+/Mg2+-free Dulbecco's phosphate-buffered saline, and further digested for 30 min at 37°C. After washing in fresh DMEM, ganglia were dissociated by trituration using a fire-polished Pasteur pipette. Cells were washed in fresh DMEM and triturated again using a smaller bore fire-polished pipette to obtain a single-cell suspension. DRG cells were then plated on polyethelenimine (PEI)-treated 12 mm glass coverslips. Cells were plated at a density of one DRG per coverslip in 1 ml DMEM supplemented with 10% FBS (Hyclone), NGF (50 ng/ml, Boehringer Mannheim), and 100 U/ml Pen/Strep. Experimental procedures involving rats were conducted under a protocol approved by an Institutional Animal Care and Use Committee.
To label cutaneous afferent neurons, the fluorescent carbocyanine dye fast DiI (DiI, Molecular Probes, Eugene, OR) was injected into the subplantar hindpaw region of 7- to 8-wk-old rats. Injections of 50 µl of a 20-mM solution in DMSO were administered 10-12 days before culture preparation. Labeled neurons were identified in vitro using fluorescence optics.
Neurons were used for electrophysiological recording within 4-48 h. In most experiments, the FITC-labeled plant lectin BSI-B4 (IB4, 10 µg/ml) was added to the culture medium at 37°C for 5 min before recording. The coverslip was then washed with extracellular recording solution for 1 min before being placed in the recording chamber, which was mounted on the stage of an Olympus IX70 microscope equipped with fluorescence optics. Digital images were captured using a SPOT-2 camera system (Diagnostic Instruments, Sterling Hts, MI).
Cloning and expression of recombinant rat P2X receptors
Primers were designed to regions encompassing the initiation and
termination codons of the rat P2X2 and
P2X3 cDNAs (Genbank accession numbers;
P2X2, U14114; P2X3,
X90651). A consensus Kozak sequence was designed into the 5' primer of
each primer pair to facilitate optimal translation efficiency
(Kozak 1984
).
To clone the rat P2X2 receptor, 100 ng of poly A+
RNA derived from rat total brain tissue (Clontech, Palo Alto, CA) was
used in a first-strand cDNA synthesis reaction using Superscript II reverse transcriptase and reagents from GIBCO BRL. One-tenth of the
reaction was used in a 50-µl amplification reaction with 10 picomoles
of each of the P2X2 primers (sense
P2X2,
5'CACCATGGTCCGGCGCTTGGCCCGGGGC3'; antisense
P2X2,
5'TCAAAGTTGGGCCAAACCTTTGGGGTCCG3'). Additional components of the reaction included 200 µM dNTPs, 1 × Pfu buffer (Stratagene, La Jolla, CA). The reaction was
incubated at 94°C for 1 min, then 80°C for 2 min during which 1.25 units Pfu polymerase (Stratagene) was added. The reaction
was then cycled 35 times in a Perkin Elmer Model 9600 thermocycler
(Perkin Elmer, Foster City, CA) under the following conditions: 94°C
for 20 s, 65°C for 20 s, and 72°C for 4 min. Reaction
products were separated by agarose gel electrophoresis; the major
product of ~1.5 kilobases was isolated and cloned into the pCRscript
vector (Stratagene) according to the manufacturer's instructions. The
insert was sequenced by dye-terminator chemistry on a Perkin Elmer
Model 310 genetic analyzer and found to be identical to the published
sequence for the rat P2X2 message (Brake
et al. 1994
). The cDNA was excised from the vector by digestion
with the restriction enzymes Bam HI and Not I and
ligated into the vector pIRES(hyg) vector (Clontech).
The P2X3 receptor cDNA was cloned from rat brain
poly A+ RNA essentially as described above. The primers used in the PCR
amplification reaction were as follows: sense
P2X3,
5'TTCTCACCATGAACTGTATATCAGACTTCTTC3'; antisense
P2X3,
5'AAGAGGCCCTAGTGACCAATAGAATAGGCCCC3'. Amplitaq thermopolymerase and buffers (Perkin Elmer) were used in
this amplification. The reaction was cycled 35 times under the
following conditions; 95°C for 30 s, 55°C for 30 s, and
72°C for 2 min. The major product of 1.3 kilobases was cloned into
the vector pCRII (Invitrogen, Carlsbad, CA) as per manufacturer's
instructions. The insert was sequenced and found to be identical to the
published rat P2X3 message (Chen et al.
1995
). The cDNA was excised from the vector and ligated into
the vector pIRES(neo) vector (Clontech).
Expression plasmids encoding rat P2X2 and
P2X3 receptor cDNAs were transfected individually
into 1321N1 human astrocytoma cells using Lipofectamine (GIBCO BRL).
After transfection (48 h), cells were subcultured in growth medium
containing 800 µg ml
1 G418
(rP2X3) or 100 µg ml
1
hygromycin (rP2X2). Surviving individual colonies
were isolated, screened for P2 receptor activity using a
fluorescence-based calcium imaging assay, and selected for further
characterization. The cell line expressing heteromeric
rP2X2/3 receptors was constructed by transfection
of the rP2X3 cDNA into
rP2X2-expressing 1321N1 cells. Positive clones
were isolated in growth medium containing 150 µg
ml
1 G418 and 75 µg
ml
1 hygromycin and selected based on their
sensitivity to
,
-meATP.
Cells expressing recombinant homomeric P2X3
receptors were maintained at 37°C in DMEM (with 4.5 mg
ml
1 glucose and 4 mM L-glutamine),
10% FBS and 300 µg ml
1 G418 or 100 µg
ml
1 hygromycin in a humidified 5%
CO2 atmosphere. Cells expressing rP2X2/3 receptors were maintained in growth
medium containing 150 µg ml
1 G418 and 75 µg
ml
1 hygromycin. Cells were plated onto
PEI-treated glass coverslips and used for recording at ~50% confluency.
Electrophysiology
Whole cell patch-clamp recordings were obtained from both DRG
neurons and stably transfected 1321N1 cells. Cells were maintained in
an extracellular recording solution (pH 7.4, 325 mosM) consisting of
(in mM) 155 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, and 12 glucose. Patch electrodes
were pulled from borosilicate glass and fire polished to 3-10 M
tip
resistance. Two internal pipette solutions (pH 7.3, 295 mosM) were used
for recording. The first was used for the majority of recordings, and
consisted of (in mM) 140 K-aspartate, 20 NaCl, 10 EGTA, and 5 HEPES.
The second consisted of (in mM) 135 Cs-acetate, 10 CsCl, 0.5 EGTA, and
10 HEPES. No differences in P2X responses were observed when using either intracellular solution. Cells were typically voltage clamped at
60 mV, and series resistance was compensated 90-95%. Currents were
recorded using an Axopatch 200B amplifier (Axon Instruments, Foster
City, CA) and digitized at 3 kHz for acquisition. For analysis, recordings were low-pass filtered at 1 kHz. Rise times of inward currents were measured between 10 and 90% peak. Exponential time constants of current desensitization (
) were estimated using a
Chebyshev curve-fitting algorithm. Most of the desensitizing currents
in this study were best fitted by two exponential functions. For DRG
neurons, resting membrane potential was measured immediately after
rupture of the cell membrane in whole-cell patch mode. Neuronal input
resistance was determined from the amplitude of the current response to
a 10-mV hyperpolarizing pulse from a holding potential of
60 mV. A
series of depolarizing voltage steps was applied to all neurons to
determine the threshold for activation of a fast sodium current
presumed to reflect firing of the action potential. For all cell types,
baseline responses were recorded for a minimum of 10 min to ensure that
the kinetics of the response were stable. A wash out or recovery period
usually followed pharmacological manipulation of the response.
Responses that exhibited long-lasting or irreversible changes in
kinetics during the experiment were considered unstable and were not
used for analysis. All data acquisition and analysis was performed
using pClamp software (Axon Instruments).
Cells were constantly perfused with extracellular solution at a rate of
0.5 ml/min in the recording chamber. Agonists were applied to
individual cells using a piezoelectric-driven rapid application system
(Burleigh Instruments, Fishers, NY). Extracellular solution perfused
the cell from one barrel of a glass theta tube positioned 100 µm
away. Agonist solution perfused the other barrel, and was applied by
rapidly moving the solution interface across the cell. The time
constant for solution exchange across the entire cell was 20 ms. This
was measured by recording from 1321N1 cells expressing a
nondesensitizing P2X receptor (rP2X2), eliciting a steady-state ATP (10 µM) current at
60 mV, rapidly switching from
a low (2 mM) to high (55 mM) potassium extracellular ATP (10 µM)
solution, and measuring the resulting current relaxation. This method
gave a more realistic measure of total cell exchange time than
measuring the exchange time across an open pipette tip. The pipette
open tip solution exchange time was on the order of 1-2 ms and was
checked after each cell recording to ensure proper agonist application.
Agonist applications were 400-800 ms in duration and were typically
given every 2-4 min. When the effects of pH were studied, cells were
maintained at pH 7.4, and agonist (at pH 6.6) was applied. In this
study, the P2X agonists ATP and
,
-methylene ATP (
,
-meATP),
and antagonists suramin (RBI, Natick, MA) and trinitrophenyl-ATP
(TNP-ATP, Molecular Probes, Eugene, OR) were used.
All reagents were purchased from Sigma Chemical (St. Louis, MO) unless otherwise noted. All data are expressed as means ± SE.
| |
RESULTS |
|---|
|
|
|---|
Basic properties of DRG neurons
The FITC-labeled lectin IB4 was used in initial experiments as a
live cell marker to identify putative P2X3
receptor-expressing nociceptive neurons (Vulchanova et al.
1998
). Approximately 75% of all cultured DRG neurons were
labeled by IB4 (Fig. 1), and 90% of
these neurons responded to ATP. Once it was determined that these
labeled cells would routinely respond to ATP, some subsequent
experiments were performed on untreated neurons. No differences in
neuronal membrane properties or P2X receptor-mediated responses were
observed between IB4-labeled cells and small-diameter cells in cultures
that were not treated with IB4.
|
Small (25-30 µm) neurons that were devoid of neurite extension had
resting membrane potentials of
52 ± 3 (SE) mV and input resistances of 489 ± 109 M
(n = 9). All
neurons generated an inward sodium current following membrane
depolarization to 0 mV (spike threshold
18 ± 2 mV,
n = 9). A typical fast inward current was recorded with
K-aspartate-filled pipettes. Intracellular Cs-acetate produced a
widening of the inward current duration and an appearance of a
prolonged plateau current resembling the prolonged action potential
duration of small nociceptive DRG neurons (Harper and Lawson
1985b
; McLean et al. 1988
). Other membrane
properties or ATP responses recorded with intracellular pipette
solutions containing Cs-acetate were not significantly different from
those recorded with K-aspartate-filled pipettes.
P2X responses in DRG neurons
Three general types of P2X responses were recorded from DRG
neurons after ATP application. The first was a slow, nondesensitizing response characterized by relatively slow activation and no
desensitization of current (slow DRG, Fig.
2A). Current responses to 10 µM ATP in six neurons showed relatively slow rise times (113 ± 23 ms) to peak currents of 319 ± 80 pA. Slow DRG currents were
nondesensitizing, because 97 ± 3% of peak current amplitude was
still present at the end of ATP application. The second type of P2X
response was fast, characterized by rapid current activation and fast
desensitization (fast DRG, Fig.
3A). Current responses to 10 µM ATP in the fast DRG group (n = 5) had fast rise
times (10 ± 2.0 ms) to peak currents of 536 ± 186 pA. In
the presence of agonist, current desensitization followed biexponential
kinetics. An initial fast component (
1 = 32 ± 2.7 ms) was followed by a smaller amplitude prolonged
component (
2 = 339 ± 64 ms). The
currents desensitized almost completely, because there was only
5.8 ± 2.1% of peak amplitude left as residual current at the end
of agonist application. The third type of response was a mixed response
(DRG-mixed, Fig. 3B) that also exhibited both fast and slow
desensitization kinetics, but the slow component was much more
prominent than that seen in fast DRG responses. Current responses to 10 µM ATP in this group (n = 5) had relatively fast rise
times (38 ± 19 ms) to peak currents of 228 ± 88 pA. Both
fast (
1 = 25 ± 2.0 ms) and slow
(
2 = 424 ± 173 ms) desensitizing components were observed, with residual currents at the end of agonist
application measuring 38 ± 4.8% of peak. Although the desensitization
values were not different between fast and mixed DRG responses, mixed DRG responses had significantly larger residual slow component amplitudes than did fast DRG responses (P < 0.05, unpaired t-test). All three types of responses could be
elicited by application of either ATP or the ATP analogue
,
-meATP. The three types of responses were observed with
approximately equal frequency.
|
|
Activation of P2X receptors by ATP in DRG neurons was verified by the
use of the P2X receptor antagonists suramin and TNP-ATP. Suramin (10 µM) produced a reversible inhibition of peak current to 48 ± 27% of control (n = 3) during coapplication with ATP
(10 µM, mixed DRG responses). Likewise, TNP-ATP (0.1 µM), a P2X
antagonist selective for P2X3,
P2X2/3, and P2X1 receptors
(Virginio et al. 1998
), inhibited mixed DRG peak
currents to 52 ± 7% of control when coapplied with ATP (10 µM,
n = 3). However, when TNP-ATP was preapplied for at
least 30 s before ATP application, both fast and slow P2X currents
were completely and reversibly blocked (n = 3, Fig.
7B). These results suggest that preapplication of antagonist
is necessary for optimal antagonism, and that the receptor subtypes
underlying DRG P2X responses are either P2X3,
P2X2/3, or P2X1.
Comparison of DRG responses to recombinant rat P2X responses
Because DRG P2X responses could be grouped as either fast
(desensitizing), slow (nondesensitizing), or mixed (fast and slow), the
P2X receptor subtype(s) underlying each type of response were investigated. To do this, DRG responses were compared with responses from recombinant P2X receptors expressed in 1321N1 cells that lack
endogenous expression of either P2X or P2Y receptors (Schachter and Harden 1997
; H. Yu, B. Bianchi, R. Metzger, K. J. Lynch, E. A. Kowaluk, M. F. Jarvis, and T. van Biesen,
unpublished observations).
Slow, nondesensitizing P2X currents were evoked in response to ATP
application in six DRG neurons.
,
-meATP (10 µM) was also applied to four of these neurons, and it evoked comparable currents that did not significantly differ in amplitude or kinetics from ATP
responses (Fig. 2, A and B). These
,
-meATP-induced currents in neurons had peak amplitudes of
342 ± 159 pA, rise times of 119 ± 23 ms, and exhibited no
desensitization. For comparison, the recombinant
rP2X2/3 receptor exhibited similar
,
-meATP
(10 µM) response kinetics to the slow DRG response (Fig.
2C). Recombinant rP2X2/3 -expressing
cells displayed peak amplitudes of 359 ± 93 pA, rise times of
73 ± 23 ms, and also did not desensitize.
,
-meATP was used
to specifically activate P2X2/3 receptors in all
cells, because we (Bianchi et al. 1999
) and others (Brake et al.
1994
) have observed that homomeric rP2X2
receptors are not activated by
,
-meATP. These results demonstrate
that the slow DRG response is not mediated by a
P2X2 receptor, but probably by a
P2X2/3 heteromeric receptor.
Approximately 70% of P2X responses in DRG neurons were desensitizing.
Fast DRG responses showed fast, almost complete desensitization (<15%
of peak current left at end of application) in the presence of agonist,
whereas mixed DRG responses displayed fast desensitization, but did not
desensitize completely (>15% of peak current left at end of
application, Fig. 3, A and B). For comparison,
the recombinant rP2X3 receptor exhibited kinetics
similar to both fast and mixed DRG responses (Fig. 3C).
Responses from rP2X3-expressing cells activated
rapidly (rise time = 8.7 ± 1.8 ms, n = 6) to
peak currents of 1089 ± 254 pA. Desensitization of these
receptors was best characterized by the sum of two exponential
functions (
1 = 39 ± 4.7,
2 = 239 ± 39 ms), similar to fast DRG
responses. In contrast to fast DRG responses, there was a significant
residual inward current left at the end of ATP application (23 ± 4.7% of peak amplitude, P < 0.05, unpaired t-test),
indicating that desensitization in recombinant
rP2X3 receptors was not complete. The relative ATP EC50 values for rP2X3
and DRG responses were 0.3 and 1.6 µM (n = 4), respectively.
The residual current seen at the end of ATP application to cells
expressing recombinant rP2X3 receptors prompted
the question of whether or not the plateau current seen in mixed DRG
responses was actually mediated by a separate nondesensitizing P2X
receptor. To address this issue, the agonist sensitivity of mixed DRG
responses was investigated. Both ATP and
,
-meATP were equally
effective in activating mixed DRG responses (Fig.
4). In five neurons exposed to both ATP
and
,
-meATP, both agonists produced peak amplitudes and
desensitization kinetics that were not significantly different (P > 0.05, paired t-test). The observation that both fast and slow components could be activated by both agonists indicated that
either P2X2/3 or incompletely desensitized
P2X3 receptors were involved in the slow
component of the mixed DRG response. The sensitivity to
,
-meATP
indicated that P2X2 receptors were not involved,
because rP2X2 receptors are insensitive to
,
-meATP (Brake et al. 1994
).
|
Because the recombinant rP2X3 receptor did not
desensitize completely, the possibility remained that the residual
current of mixed DRG responses was mediated by the same
P2X3 receptors underlying the fast component.
Desensitizing P2X receptors often enter a long-lasting desensitized
state following activation, whereas nondesensitizing P2X receptors do
not (Bean 1990
; Krishtal et al. 1983
).
The activation frequency dependence of the mixed DRG response was
therefore examined to determine whether or not DRG responses exhibited
long-lasting desensitization. In mixed DRG neurons, decreasing the
interapplication interval from 4 min to 30 s produced a selective
depression of the fast peak to 22% of control, but no depression of
the slow component (n = 3, Fig. 5A). Similar results were seen
when either ATP or
,
-meATP was used as an agonist (Fig.
7C). In contrast, the entire waveform of fast DRG responses
was depressed when application frequencies were increased
(n = 4, not shown). In these neurons, the peak response
was depressed to 13% of control, and the plateau responses were
already almost completely desensitized. Similar to fast DRG responses,
the entire rP2X3 waveform was depressed during
higher frequency applications (Fig. 5B), and responses
required a 2- to 4-min interapplication interval to recover to control
amplitude. Measurements taken at both peak and end of application
revealed that increasing the stimulus frequency to every 15-30 s
produced a depression of both peak (57 ± 7% of control) and end
of application amplitudes (45 ± 8% of control, n = 5). In contrast, the nondesensitizing rP2X2/3
receptor could follow agonist application frequencies as fast as every
5 s without a decrease in amplitude or change in kinetics
(n = 3, Fig. 5C). It is clear that mixed DRG
responses have two components that show different long-lasting
desensitization properties. The ability of the slow component of mixed
DRG responses to follow increased application frequencies indicates the
involvement of P2X2/3 in the plateau (slow)
phase.
|
To further differentiate the components of mixed DRG responses, the
modulatory effects of extracellular protons were studied. Differential
modulation of rP2X3 and
rP2X2/3 receptors by pH has been previously
demonstrated (Stoop et al. 1997
), where recombinant rP2X3-mediated currents were inhibited and
rP2X2/3 currents were potentiated by decreasing
extracellular pH. In the present study, DRG neurons showed differential
pH modulation of response amplitudes (Fig.
6A). Fast peak amplitudes were
depressed by extracellular protons (52 ± 11% of control,
n = 4), consistent with P2X3
receptor activation. However, the plateau (end of application)
amplitude was potentiated in mixed or slow DRG neurons (189 ± 15% of control, n = 3). In agreement with previous
reports, decreasing the extracellular pH decreased both the peak (67%
of control) and end of application amplitude (68%, n = 2) of recombinant rP2X3 responses (Fig.
6B), so that the entire waveform was depressed. In contrast,
the recombinant rP2X2/3 response was potentiated
by extracellular protons (Fig. 6C). Decreasing the pH of the
agonist solution to 6.6 produced an increase in
rP2X2/3 peak amplitude to 153% of control
(n = 2). Acidic extracellular recording solution alone
had no effect on rP2X-transfected 1321N1 cells. DRG neurons have
additional proton-activated inward currents, but the amplitudes of
currents elicited by acidic solution alone were <25% of the
proton-potentiated P2X currents in DRG neurons (n = 3).
Although proton currents appeared to be activated, they were very small
and their amplitude contributed only a small proportion to the entire
potentiation of the plateau current. This differential modulation of
fast and slow P2X components in DRG neurons suggests activation of a
mixed population of both P2X3 and
P2X2/3 receptors.
|
To test whether or not cutaneous afferents that innervate the rat hindpaw express P2X3 or P2X2/3 receptors, subplantar injections of the fluorescent tracer DiI were performed in three rats to label sensory afferents projecting to the hindpaw. Corresponding DRG neurons were then selected in culture based on DiI fluorescence. In lumbar cultures prepared from DRG ipsilateral to the injection site, one to two percent of neurons were labeled with DiI. Figure 7 shows the P2X responses of a DRG nociceptor co-labeled with DiI and IB4. This mixed DRG response exhibited both fast and slow components. The entire P2X response was blocked by TNP-ATP (100 nM, Fig. 7B). However, increasing the agonist application frequency produced a selective inhibition of the fast component, leaving the slow component intact (Fig. 7C). Responses from six neurons co-labeled with DiI and IB4 indicated that slow (n = 1), fast (n = 2), and mixed (n = 3) P2X responses were present in cutaneous afferents. Based on response kinetics, TNP-ATP sensitivity and long-lasting desensitization, it appears that both P2X3 and P2X2/3 receptors can be expressed on these particular neurons. The subcellular distribution and physiological function of these receptor subtypes remains to be determined.
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study has shown that identified rat DRG neurons respond to P2X receptor agonists with either slow nondesensitizing kinetics, fast desensitizing kinetics, or a combination of fast and slow kinetics. The rapidly desensitizing responses were similar to P2X3 receptor responses, and the nondesensitizing responses had properties indicative of P2X2/3 receptor activation.
Putative P2X3-containing nociceptors were
identified by labeling neurons in culture with fluorescent isolectin
IB4 (Vulchanova et al. 1998
). Approximately 75% of
neurons in culture were identified as expressing IB4 binding proteins.
This is in general agreement with the percentage of IB4-labeled neurons
in fixed rat DRG sections (67%) (Molliver et al. 1995
).
Of the IB4-positive neurons in culture, 90% exhibited a
P2X3 or P2X2/3-like
response to ATP. This relatively high percentage of cells that appear
to have functional P2X3-containing receptors
contrasts to the smaller percentage (30-40%) of
P2X3-positive neurons in intact DRG identified by
either in situ hybridization or immunohistochemical methods
(Chen et al. 1995
; Vulchanova et al.
1997
). Although the reason for this is unclear, the possibility exists that the acute dissociation methods used here select for a high
percentage of P2X3-positive neurons in culture.
P2X responses in sensory ganglia are diverse, yet it appears that
P2X2, P2X3, and
P2X2/3 receptors are expressed on many sensory neurons. These receptors all function as nonspecific cation-selective channels, and most show strong inward rectification, yet they may vary
in their agonist selectivity and desensitization kinetics. Trigeminal
nociceptors appear to express fast P2X3-like
receptors, as well as slow nondesensitizing
P2X2/3-like receptors (Cook et al.
1997
). In nodose ganglia (Lewis et al. 1995
;
Thomas et al. 1998
), ATP responses are nondesensitizing
and mediated by P2X2 and
P2X2/3 receptors. In the DRG, early studies
(Bean 1990
; Jahr and Jessell 1983
;
Krishtal et al. 1983
) reported the existence of both
fast desensitizing and nondesensitizing responses to ATP. However, some
of these responses may be species dependent. Amphibian DRG neurons
routinely respond to ATP with nondesensitizing kinetics (Bean
1990
; Li et al. 1993
), whereas the response
kinetics of mammalian DRG neurons are often rapidly desensitizing.
Studies using cultured neonatal rat DRG neurons (Rae et al.
1998
; Robertson et al. 1996
) demonstrate that
these neurons respond to P2X agonists exclusively with fast kinetics.
The present data confirm previous reports demonstrating that many DRG
neurons show fast desensitizing kinetics and extends these observations
to include other neurons that respond with either mixed or
nondesensitizing kinetics. The discrepancies between the present adult
DRG responses and the neonatal responses of Robertson et al.
(1996)
could be explained by developmental differences in P2X
receptor expression, although this possibility has not been investigated.
Desensitization kinetics and agonist sensitivity are often used to
broadly discriminate between P2X receptor subtypes. In this context,
two distinct forms of desensitization, acute and long-lasting, were
examined. Acute desensitization refers to the decrease in response
amplitude in the presence of agonist, and long-lasting desensitization
refers to the decrease in amplitude of the second of a pair of
responses. In the latter case, channels have entered a desensitized
state from which they cannot be activated for periods of up to minutes.
While the rP2X3 receptor responds to both ATP and
,
-meATP with fast acute desensitization kinetics, the
rP2X2 receptor is insensitive to
,
-meATP
and responds to ATP with nondesensitizing kinetics (Brake et al.
1994
; Chen et al. 1995
). The
rP2X2/3 receptor has a novel profile, being
,
-meATP-sensitive, yet having nondesensitizing kinetics
(Lewis et al. 1995
). The present study found that both
rP2X3 and fast DRG responses were activated by
either ATP or
,
-meATP, displayed biphasic acute desensitization
kinetics, and required prolonged interapplication intervals (minutes)
to recover from long-lasting desensitization. Although the responses
always desensitized in the presence of agonist, acute desensitization
was not always complete, and a plateau current was often present at the
end of the application. Shorter interapplication intervals produced a
subsequent depression of the entire rP2X3 or fast
DRG waveform, not just the peak. Similarly, both
rP2X2/3 and slow DRG responses were activated by
either ATP or
,
-meATP. However, there was no acute
desensitization, and responses could easily follow interapplication
intervals as fast as 5 s without a decrease in response amplitude.
The differences in long-lasting desensitization were used as
discriminators when interpreting the receptor subtypes underlying mixed
DRG responses. Applications of either ATP or
,
-meATP elicited
mixed DRG responses characterized by both fast and slow response
kinetics. When short interapplication intervals were used, only the
fast peak of mixed DRG responses was depressed, and the slow plateau
amplitude was left unaffected. This response profile indicates
activation of P2X3 in the fast phase, and
P2X2/3 receptors in the slow plateau phase.
The fast DRG components responded to all pharmacological manipulations
similarly to rP2X3 receptor responses. ATP and
,
-meATP were relatively equipotent at eliciting this response.
The fast response was also blocked by the nonspecific P2X receptor
antagonist suramin, as well as the more selective antagonist TNP-ATP.
At nanomolar concentrations, TNP-ATP has been shown to be a selective antagonist for P2X1, P2X3,
and P2X2/3 receptors (Virginio et al. 1998
). The entire waveform of the fast DRG response was also
depressed by lowering external pH, an effect attributed to proton
modulation of the P2X3 receptor (Stoop et
al. 1997
). Interestingly, P2X1 receptors
also share this pharmacological profile. However, previous results
based on selectivity of
,
-meATP isomers have indicated that fast
DRG responses are P2X3, and not
P2X1 mediated (Rae et al. 1998
).
The pharmacological similarities between fast DRG responses in the
present study and those of Rae et al. (1998)
also
implicate the involvement of P2X3 receptors.
The fact that both ATP and
,
-meATP elicited slow DRG responses
implicates P2X2/3, and not
P2X2, receptor activation. Although the present
study did not specifically address the existence of P2X2 homomeric receptors, a consistent
observation was that comparable slow DRG currents were elicited by
either agonist in the same neuron, indicating that homomeric
P2X2 receptors were not activated. The P2X
antagonist TNP-ATP is relatively insensitive at
P2X2 receptors, yet it completely blocked slow
DRG responses, consistent with a preferential expression of
P2X2/3 over P2X2. The slow
component of mixed DRG responses was increased in amplitude under
acidic extracellular conditions and could follow short interapplication intervals. These effects are opposite to those seen with fast DRG
responses under identical conditions, further emphasizing that fast and
slow components of mixed DRG responses are mediated by separate P2X receptors.
The precise role of P2X receptors on nociceptive afferents is not
known. However, increasing evidence supports the idea that P2X
receptors can increase sensory neuron excitability. Subplantar administration of
,
-meATP produces a nociceptive response in rats
(Bland-Ward and Humphrey 1997
), consistent with
functional involvement of P2X receptors in the periphery (Cook
et al. 1997
). Gu and MacDermott (1997)
have
demonstrated that presynaptic P2X receptors located on DRG terminals
can increase glutamatergic neurotransmission at DRG-dorsal horn
synapses in culture. Similar results have been obtained from recordings
in brain stem slices (Khakh and Henderson 1998
). A
presynaptic facilitatory role for P2X receptors at central dorsal horn
synapses could enhance neurotransmission, leading to an increase in
pain sensation. The present study has demonstrated that two P2X
receptors could mediate this effect, a fast, transient
P2X3 receptor as well as a slow, sustained
P2X2/3 receptor. The purpose of each receptor
subtype in this pathway remains unknown, but it appears that there
exist two distinct P2 receptor subtypes at which pharmacological agents
could potentially be targeted for the treatment of pain.
| |
FOOTNOTES |
|---|
Address for reprint requests: E. C. Burgard, Neurological and Urological Diseases Research, Dept. 4PM, Bldg. AP10, Abbott Laboratories, Abbott Park, IL 60064-3500.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 2 March 1999; accepted in final form 23 April 1999.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Li, J. Lu, Z. Gao, S. Koba, J. Xing, N. King, and L. Sinoway Spinal P2X receptor modulates muscle pressor reflex via glutamate J Appl Physiol, March 1, 2009; 106(3): 865 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Binshtok, H. Wang, K. Zimmermann, F. Amaya, D. Vardeh, L. Shi, G. J. Brenner, R.-R. Ji, B. P. Bean, C. J. Woolf, et al. Nociceptors Are Interleukin-1{beta} Sensors J. Neurosci., December 24, 2008; 28(52): 14062 - 14073. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Gerevich, Z. S. Zadori, L. Koles, L. Kopp, D. Milius, K. Wirkner, K. Gyires, and P. Illes Dual Effect of Acid pH on Purinergic P2X3 Receptors Depends on the Histidine 206 Residue J. Biol. Chem., November 23, 2007; 282(47): 33949 - 33957. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wang, Y. Gu, G.-W. Li, and L.-Y. M. Huang A critical role of the cAMP sensor Epac in switching protein kinase signalling in prostaglandin E2-induced potentiation of P2X3 receptor currents in inflamed rats J. Physiol., October 1, 2007; 584(1): 191 - 203. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D'Arco, R. Giniatullin, M. Simonetti, A. Fabbro, A. Nair, A. Nistri, and E. Fabbretti Neutralization of Nerve Growth Factor Induces Plasticity of ATP-Sensitive P2X3 Receptors of Nociceptive Trigeminal Ganglion Neurons J. Neurosci., August 1, 2007; 27(31): 8190 - 8201. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Burnstock Physiology and Pathophysiology of Purinergic Neurotransmission Physiol Rev, April 1, 2007; 87(2): 659 - 797. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sokolova, A. Skorinkin, I. Moiseev, A. Agrachev, A. Nistri, and R. Giniatullin Experimental and Modeling Studies of Desensitization of P2X3 Receptors Mol. Pharmacol., July 1, 2006; 70(1): 373 - 382. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Z. Ruan, L. A. Birder, Z. Xiang, B. Chopra, T. Buffington, C. Tai, J. R. Roppolo, W. C. de Groat, and G. Burnstock Expression of P2X and P2Y receptors in the intramural parasympathetic ganglia of the cat urinary bladder Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1143 - F1152. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Z. Ruan, L. A. Birder, W. C. de Groat, C. Tai, J. Roppolo, C. A. Buffington, and G. Burnstock Localization of P2X and P2Y Receptors in Dorsal Root Ganglia of the Cat J. Histochem. Cytochem., October 1, 2005; 53(10): 1273 - 1282. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Cockayne, P. M. Dunn, Y. Zhong, W. Rong, S. G. Hamilton, G. E. Knight, H.-Z. Ruan, B. Ma, P. Yip, P. Nunn, et al. P2X2 knockout mice and P2X2/P2X3 double knockout mice reveal a role for the P2X2 receptor subunit in mediating multiple sensory effects of ATP J. Physiol., September 1, 2005; 567(2): 621 - 639. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kennedy P2X Receptors: Targets for Novel Analgesics? Neuroscientist, August 1, 2005; 11(4): 345 - 356. [Abstract] [PDF] |
||||
![]() |
K. Dang, K. Bielfeldt, K. Lamb, and G. F. Gebhart Gastric Ulcers Evoke Hyperexcitability and Enhance P2X Receptor Function in Rat Gastric Sensory Neurons J Neurophysiol, June 1, 2005; 93(6): 3112 - 3119. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Jarvis, B. Bianchi, J. T. Uchic, J. Cartmell, C.-H. Lee, M. Williams, and C. Faltynek [3H]A-317491, a Novel High-Affinity Non-Nucleotide Antagonist That Specifically Labels Human P2X2/3 and P2X3 Receptors J. Pharmacol. Exp. Ther., July 1, 2004; 310(1): 407 - 416. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Gerevich, S. J. Borvendeg, W. Schroder, H. Franke, K. Wirkner, W. Norenberg, S. Furst, C. Gillen, and P. Illes Inhibition of N-Type Voltage-Activated Calcium Channels in Rat Dorsal Root Ganglion Neurons by P2Y Receptors Is a Possible Mechanism of ADP-Induced Analgesia J. Neurosci., January 28, 2004; 24(4): 797 - 807. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. North P2X3 receptors and peripheral pain mechanisms J. Physiol., January 15, 2004; 554(2): 301 - 308. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Calvert and R. J. Evans Heterogeneity of P2X Receptors in Sympathetic Neurons: Contribution of Neuronal P2X1 Receptors Revealed Using Knockout Mice Mol. Pharmacol., January 1, 2004; 65(1): 139 - 148. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Kennedy, T S Assis, A J Currie, and E G Rowan Crossing the pain barrier: P2 receptors as targets for novel analgesics J. Physiol., December 15, 2003; 553(3): 683 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Gu P2X Receptor-Mediated Modulation of Sensory Transmission to the Spinal Cord Dorsal Horn Neuroscientist, October 1, 2003; 9(5): 370 - 378. [Abstract] [PDF] |
||||
![]() |
L.-H. Jiang, M. Kim, V. Spelta, X. Bo, A. Surprenant, and R. A. North Subunit Arrangement in P2X Receptors J. Neurosci., October 1, 2003; 23(26): 8903 - 8910. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. De Roo, J.-L. Rodeau, and R. Schlichter Dehydroepiandrosterone Potentiates Native Ionotropic ATP Receptors Containing the P2X2 Subunit in Rat Sensory Neurones J. Physiol., October 1, 2003; 552(1): 59 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tsuzuki, A. Ase, P. Seguela, T. Nakatsuka, C.-Y. Wang, J.-X. She, and J. G. Gu TNP-ATP-Resistant P2X Ionic Current on the Central Terminals and Somata of Rat Primary Sensory Neurons J Neurophysiol, June 1, 2003; 89(6): 3235 - 3242. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakatsuka, K. Tsuzuki, J. X. Ling, H. Sonobe, and J. G. Gu Distinct Roles of P2X Receptors in Modulating Glutamate Release at Different Primary Sensory Synapses in Rat Spinal Cord J Neurophysiol, June 1, 2003; 89(6): 3243 - 3252. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Labrakakis, C.-K. Tong, T. Weissman, C. Torsney, and A. B MacDermott Localization and function of ATP and GABAA receptors expressed by nociceptors and other postnatal sensory neurons in rat J. Physiol., May 15, 2003; 549(1): 131 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Jarvis, E. C. Burgard, S. McGaraughty, P. Honore, K. Lynch, T. J. Brennan, A. Subieta, T. van Biesen, J. Cartmell, B. Bianchi, et al. A-317491, a novel potent and selective non-nucleotide antagonist of P2X3 and P2X2/3 receptors, reduces chronic inflammatory and neuropathic pain in the rat PNAS, December 24, 2002; 99(26): 17179 - 17184. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. North Molecular Physiology of P2X Receptors Physiol Rev, October 1, 2002; 82(4): 1013 - 1067. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Drew, J. N. Wood, and P. Cesare Distinct Mechanosensitive Properties of Capsaicin-Sensitive and -Insensitive Sensory Neurons J. Neurosci., May 31, 2002; (2002) 20026459. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-Y. Xu and L.-Y. M. Huang Peripheral Inflammation Sensitizes P2X Receptor-Mediated Responses in Rat Dorsal Root Ganglion Neurons J. Neurosci., January 1, 2002; 22(1): 93 - 102. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Chizh and P. Illes P2X Receptors and Nociception Pharmacol. Rev., December 1, 2001; 53(4): 553 - 568. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakatsuka and J. G. Gu ATP P2X Receptor-Mediated Enhancement of Glutamate Release and Evoked EPSCs in Dorsal Horn Neurons of the Rat Spinal Cord J. Neurosci., September 1, 2001; 21(17): 6522 - 6531. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sokolova, A. Nistri, and R. Giniatullin Negative Cross Talk between Anionic GABAA and Cationic P2X Ionotropic Receptors of Rat Dorsal Root Ganglion Neurons J. Neurosci., July 15, 2001; 21(14): 4958 - 4968. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Burgard, W. Niforatos, T. van Biesen, K. J. Lynch, K. L. Kage, E. Touma, E. A. Kowaluk, and M. F. Jarvis Competitive Antagonism of Recombinant P2X2/3 Receptors by 2',3'-O-(2,4,6-Trinitrophenyl) Adenosine 5'-Triphosphate (TNP-ATP) Mol. Pharmacol., April 13, 2001; 58(6): 1502 - 1510. [Abstract] [Full Text] |
||||
![]() |
M. Liu, B. F. King, P. M. Dunn, W. Rong, A. Townsend-Nicholson, and G. Burnstock Coexpression of P2X3 and P2X2 Receptor Subunits in Varying Amounts Generates Heterogeneous Populations of P2X Receptors That Evoke a Spectrum of Agonist Responses Comparable to That Seen in Sensory Neurons J. Pharmacol. Exp. Ther., March 1, 2001; 296(3): 1043 - 1050. [Abstract] [Full Text] |
||||
![]() |
B. S. Khakh, G. Burnstock, C. Kennedy, B. F. King, R. A. North, P. Seguela, M. Voigt, and P. P. A. Humphrey International Union of Pharmacology. XXIV. Current Status of the Nomenclature and Properties of P2X Receptors and Their Subunits Pharmacol. Rev., March 1, 2001; 53(1): 107 - 118. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Petruska, J. Napaporn, R. D. Johnson, J. G. Gu, and B. Y. Cooper Subclassified Acutely Dissociated Cells of Rat DRG: Histochemistry and Patterns of Capsaicin-, Proton-, and ATP-Activated Currents J Neurophysiol, November 1, 2000; 84(5): 2365 - 2379. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Alexander, W. Niforatos, B. Bianchi, E. C. Burgard, K. J. Lynch, E. A. Kowaluk, M. F. Jarvis, and T. van Biesen Allosteric Modulation and Accelerated Resensitization of Human P2X3 Receptors by Cibacron Blue J. Pharmacol. Exp. Ther., December 1, 1999; 291(3): 1135 - 1142. [Abstract] [Full Text] |
||||
![]() |
M. Paukert, R. Osteroth, H.-S. Geisler, U. Brandle, E. Glowatzki, J. P. Ruppersberg, and S. Grunder Inflammatory Mediators Potentiate ATP-gated Channels through the P2X3 Subunit J. Biol. Chem., June 8, 2001; 276(24): 21077 - 21082. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |