JN Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Neurophysiol 85: 816-827, 2001;
0022-3077/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (68)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bell, D. C.
Right arrow Articles by Dolphin, A. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bell, D. C.
Right arrow Articles by Dolphin, A. C.

The Journal of Neurophysiology Vol. 85 No. 2 February 2001, pp. 816-827
Copyright ©2001 by the American Physiological Society

Biophysical Properties, Pharmacology, and Modulation of Human, Neuronal L-Type (alpha 1D, CaV1.3) Voltage-Dependent Calcium Currents

D. C. Bell,1 A. J. Butcher,1 N. S. Berrow,1 K. M. Page,1 P. F. Brust,2 A. Nesterova,2 K. A. Stauderman,2 G. R. Seabrook,3 B. Nürnberg,4 and A. C. Dolphin1

 1Department of Pharmacology, University College London, London WC1E 6BT, United Kingdom;  2Merck Research Laboratories, La Jolla, California 92307;  3Abteilung Pharmakologie und Toxikologie, Universität Ulm and Institut für Pharmakologie, Freie Universität, D-14195 Berlin, Germany; and  4Merck, Sharp and Dohme, Neuroscience Research Centre, Harlow CM20 2QR, United Kingdom


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Bell, D. C., A. J. Butcher, N. S. Berrow, K. M. Page, P. F. Brust, A. Nesterova, K. A. Stauderman, G. R. Seabrook, B. Nürnberg, and A. C. Dolphin. Biophysical Properties, Pharmacology, and Modulation of Human, Neuronal L-Type (alpha 1D, CaV1.3) Voltage-Dependent Calcium Currents. J. Neurophysiol. 85: 816-827, 2001. Voltage-dependent calcium channels (VDCCs) are multimeric complexes composed of a pore-forming alpha 1 subunit together with several accessory subunits, including alpha 2delta , beta , and, in some cases, gamma  subunits. A family of VDCCs known as the L-type channels are formed specifically from alpha 1S (skeletal muscle), alpha 1C (in heart and brain), alpha 1D (mainly in brain, heart, and endocrine tissue), and alpha 1F (retina). Neuroendocrine L-type currents have a significant role in the control of neurosecretion and can be inhibited by GTP-binding (G-) proteins. However, the subunit composition of the VDCCs underlying these G-protein-regulated neuroendocrine L-type currents is unknown. To investigate the biophysical and pharmacological properties and role of G-protein modulation of alpha 1D calcium channels, we have examined calcium channel currents formed by the human neuronal L-type alpha 1D subunit, co-expressed with alpha 2delta -1 and beta 3a, stably expressed in a human embryonic kidney (HEK) 293 cell line, using whole cell and perforated patch-clamp techniques. The alpha 1D-expressing cell line exhibited L-type currents with typical characteristics. The currents were high-voltage activated (peak at +20 mV in 20 mM Ba2+) and showed little inactivation in external Ba2+, while displaying rapid inactivation kinetics in external Ca2+. The L-type currents were inhibited by the 1,4 dihydropyridine (DHP) antagonists nifedipine and nicardipine and were enhanced by the DHP agonist BayK S-(-)8644. However, alpha 1D L-type currents were not modulated by activation of a number of G-protein pathways. Activation of endogenous somatostatin receptor subtype 2 (sst2) by somatostatin-14 or activation of transiently transfected rat D2 dopamine receptors (rD2long) by quinpirole had no effect. Direct activation of G-proteins by the nonhydrolyzable GTP analogue, guanosine 5'-0-(3-thiotriphospate) also had no effect on the alpha 1D currents. In contrast, in the same system, N-type currents, formed from transiently transfected alpha 1B/alpha 2delta -1/beta 3, showed strong G-protein-mediated inhibition. Furthermore, the I-II loop from the alpha 1D clone, expressed as a glutathione-S-transferase (GST) fusion protein, did not bind Gbeta gamma , unlike the alpha 1B I-II loop fusion protein. These data show that the biophysical and pharmacological properties of recombinant human alpha 1D L-type currents are similar to alpha 1C currents, and these currents are also resistant to modulation by Gi/o-linked G-protein-coupled receptors.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The L-type voltage-dependent calcium channels (VDCCs) are formed by one of four possible pore forming alpha 1 subunits: alpha 1S (found in skeletal muscle) (Tanabe et al. 1987), alpha 1C (mainly cardiac) (Mikami et al. 1989), alpha 1D (in neurons and neurosecretory cells and heart) (Seino et al. 1992; Williams et al. 1992; Wyatt et al. 1997; Yaney et al. 1992), or alpha 1F (retinal, not yet functionally expressed) (Strom et al. 1998). The VDCC family nomenclature was recently revised by Ertel et al. (2000): alpha 1S, alpha 1C, alpha 1D, and alpha 1F were renamed CaV1.1, CaV1.2, CaV1.3, and CaV1.4, respectively. The alpha 1 subunits are co-assembled with the accessory subunits beta , alpha 2delta (and gamma 1 in skeletal muscle). L-type currents have been defined pharmacologically by their sensitivity to low (nM to µM) concentrations of 1,4-dihydropyridine (DHP) antagonists (e.g., nifedipine and nicardipine) and agonists [e.g., S-(-)BayK8644] (Sanguinetti and Kass 1984). In addition, L-type channels exhibit the following biophysical characteristics: "long-lasting" currents that show little inactivation in Ba2+ (Nowycky et al. 1985); some selectivity for Ba2+ over Ca2+ and Ca2+-dependent inactivation (Soldatov et al. 1997).

GTP-binding (G-) proteins exist as heterotrimeric complexes, composed of a Galpha subunit and a Gbeta gamma dimer. On activation of a G-protein-coupled receptor (GPCR), the heterotrimer dissociates into free Galpha -GTP and Gbeta gamma dimers. It is these free Gbeta gamma subunits that are thought to be responsible for fast, membrane delimited, voltage-dependent G-protein inhibition of certain neuronal VDCCs, including alpha 1A, alpha 1B, and alpha 1E (Herlitze et al. 1996; Ikeda 1996; Page et al. 1998; for a review see Dolphin 1998). VDCCs undergoing voltage-dependent G-protein modulation display the following characteristics: a decrease in whole cell current, depolarizing shift in the current-voltage (I-V) relationship, and slowed activation kinetics (Bean 1989). Another characteristic is the loss of G-protein modulation at large depolarizations (Bean 1989); consequently a large depolarizing prepulse immediately before a test pulse transiently removes inhibition, and the activation kinetics become faster, a phenomenon termed prepulse facilitation (Bean 1989; Elmslie et al. 1990).

Native cardiac L-type channels have long been known to exhibit G-protein-induced stimulation via Galpha S and a cAMP-dependent protein kinase pathway (Reuter 1983). Recently stimulation of smooth muscle L-type currents by Gbeta gamma has also been reported via a phosphinositide 3 kinase pathway (Viard et al. 1999). Inhibition via activation of Galpha i/o, and subsequent inhibition of adenylyl cyclase, is another G-protein modulatory path that regulates cardiac L-type channels (Fischmeister and Hartzell 1986). In native endocrine and neurosecretory cells and cell lines, G-protein inhibition of L-type currents has also been observed (Degtiar et al. 1997; Gilon et al. 1997; Haws et al. 1993; Hernandez-Guijo et al. 1999; Kleuss et al. 1991; Mathie et al. 1992; Tallent et al. 1996). This is thought to be involved in the inhibitory modulation of secretion. However, the subtype(s) of VDCC alpha 1 subunit(s) involved and type of G-protein modulation observed for these L-type currents have not been fully defined (see Dolphin 1999, for review). In neuronal and neurosecretory tissue, L-type currents are formed from alpha 1D as well as alpha 1C subunits (Chin et al. 1992). alpha 1D has also been shown to be expressed in heart (Hell et al. 1993; Wyatt et al. 1997). The consensus of current research suggests that L-type currents resulting from expression of neuronal (Bourinet et al. 1996; Canti et al. 1999) or cardiac (Meza and Adams 1998) alpha 1C isoforms do not exhibit the voltage-dependent G-protein inhibition that is typical of N or P/Q currents. Nevertheless, in experiments where cloned alpha 1C has been co-expressed with accessory subunits in Xenopus laevis oocytes (Oz et al. 1998) and HEK 293 cells (Dai et al. 1999; Kamp et al. 2000), other forms of facilitation and second-messenger-based inhibition have been observed.

The existence of G-protein modulation of cloned alpha 1D L-type VDCCs has not yet been examined. Here we have used a stable HEK 293 cell line expressing the human alpha 1D subunit, together with the human accessory subunits alpha 2delta -1 and beta 3a, to establish the biophysical and pharmacological properties of the expressed current and whether the resultant current shows G-protein modulation.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Materials

The following compounds were stored at -20°C (stock concentration in mM unless stated, solvent, and source): nifedipine, NIF (3, ethanol, Sigma, St. Louis, MO); nicardipine, NIC (3, ethanol, Sigma); BayK S-(-)8644, BayK (3, ethanol, RBI, Natwick, MA); somatostatin-14, SST (0.1, deoxygenated double-distilled water, RBI, Natwick, MA); quinpirole, Quin (10, double-distilled water, RBI); forskolin (10, dimethyl sulfoxide, Sigma); geneticin G-418 sulfate (100 mg/ml, double-distilled water, Life Technologies, Paisley, Scotland); Zeocin (100 mg/ml, supplied in solution form, Invitrogen, Carlsbad, CA); and amphotericin-B (80 mg/ml, dimethyl sulfoxide, Sigma).

The following cDNAs were used in transient transfections: rabbit alpha 1B (GenBank accession number D14157), rat alpha 1E (rbEII, L15453), rat alpha 1E long (see below for details), rat beta 1b (Tomlinson et al. 1993), rat beta 3 (M88571), rat alpha 2delta -1 (neuronal splice variant, M86621), rat D2long receptor (rD2long, X17458, N5 right-arrow G), and mut-3 green fluorescent protein (GFP, U73901). All cDNAs were subcloned into the expression vector pRK5 except for the clones used in the alpha 1E long transient transfection study, which were subcloned into the expression vector pMT2 (Genetic Institute, Cambridge, MA) (see Swick et al. 1992). The rat alpha 1E (rbEII, L15453) clone has a truncated N-terminus, compared with other alpha 1E clones. Page et al. (1998) extended this clone using a rat alpha 1E N-terminal extension (AF057029). The resulting rat alpha 1E long clone used in this study has homology to published mouse (L29346), human (L27745), and rabbit (X67855) alpha 1E clones. The beta 1b subunit used in this study is that of Tomlinson et al. (1993). It is identical to the rat beta 1b clone defined in the GenBank database (X61394) except for two substitutions (R417 right-arrow S and V435 right-arrow A) and the deletion A431 (T. P. Snutch, personal communication).

alpha 1D Stable cell line (HEK 293 alpha 1D)

Standard techniques were used to transfect HEK 293 stably with human neuronal alpha 1D (M76558), alpha 2bdelta -1 (M76559) and beta 3a (not published); for clarity this cell line (#5D12-20) will subsequently be referred to as HEK 293 alpha 1D. The cloning of these VDCC subunits is discussed in Williams et al. (1992). The clonal alpha 1D cell line was established by transfecting HEK293 cells using a standard Ca2+ phosphate procedure (Brust et al. 1993) with 10, 5, and 5 µg of the alpha 1D, alpha 2bdelta -1, and beta 3a expression constructs, respectively. The alpha 1D subunit expression plasmid, pcDNA1alpha 1DRBS, does not contain an antibiotic resistance gene, whereas the alpha 2bdelta -1 and beta 3a subunit expression plasmids, pRc/CMValpha 2bdelta -1 and pZeoCMVbeta 3a, contain the neomycin and Zeocin resistance genes, respectively. Geneticin G-418 sulfate (final concentration 100 µg/ml, Life Technologies) and Zeocin (final concentration 40 µg/ml, Invitrogen) were used for selection of colonies. The selection medium was added to the cells 48 h after transfection. Antibiotic-resistant colonies were transferred to 96-well plates using cloning cylinders, 2-4 wk after selection was initiated. Cell lines containing functional channels were selected with a fluo3-based calcium flux assay.

Cell culture and transfection

The culture medium in which the HEK 293 alpha 1D and control HEK 293 cells were grown consisted of Dulbecco's modified Eagle's medium (DMEM) with 4.5-g glucose · l-1 (DMEM, Life Technologies). This was supplemented with 5% bovine calf serum (Hyclone, UT), penicillin (100 IU · ml-1) and streptomycin (100 µg · ml-1; Life Technologies) and the additional selection antibiotics for the HEK 293 alpha 1D cell line (as described above). The cells were grown in this medium at 37°C, 5% CO2, and passaged every 2-3 days.

For transient transfection of the alpha 1B, alpha 2delta -1, beta 3a VDCC subunits and mut-3 GFP expression marker into HEK 293 cells, a mixture was made containing, respectively, 15, 5, 5, and 1 µl of the cDNAs (at a concentration of 1 µg/µl). In experiments where the rD2long was used, 5 µg of this cDNA was added; in experiments where this D2 receptor pathway was not investigated, 5 µg of blank pRK5 vector was used to give a final cDNA amount of 31 µg. The same amounts were used for the transfection of alpha 1E, alpha 2delta -1, beta 1b, and mut-3 GFP (using 5 µg of blank pMT2 to make the mixture up to a final amount of 31 µg). For transfection, 10 µl of Geneporter reagent (Genetic Therapy Systems, San Diego, CA) and 2 µl of the cDNA mix were added to each 1 ml of DMEM (no supplements) and incubated at 20°C for 1 h before addition of 1 ml to each 35-mm-diam culture dish containing approximately 2 × 106 cells. Transfected cells were then grown at 37°C for 36 h and subsequently at 28°C for 36 h. This process of 37°C/28°C incubation was also the standard procedure for the stable alpha 1D cell line before electrophysiological experiments. In experiments on the HEK 293 alpha 1D cells where additional transient transfection of rD2long expression was required, the cDNA mix was formed of rD2long (5 µg) and mut-3 GFP (1 µg) cDNA, and made up to 31 µg with blank pRK5, with the transfection procedure being as described above (for alpha 1B and alpha 1E). Successful transfection was determined by expression of mut3-GFP.

Electrophysiology

The internal (pipette) and external solutions and recording techniques were similar to those previously described (Campbell et al. 1995). For whole cell patch-clamp recordings, the patch pipette solution contained (in mM) 140 Cs-aspartate, 5 EGTA, 2 MgCl2, 0.1 CaCl2, 2 K2ATP, 0.8 TrisGTP, 10 HEPES; pH 7.2, 310 mOsm with sucrose. In experiments where guanosine 5'-0-(3-thiotriphospate) (GTP-gamma S) and guanosine 5'-0-(2-thiodiphospate) (GDP-beta S) were used, the GTP was replaced with either 100 µM GTP-gamma S (Sigma) or 2 mM GDP-beta S (Boehringer, Mannheim, Germany). For perforated-patch clamp recordings the patch pipette solution contained (in mM) 100 CH3O3SCs, 25 CsCl, 3 MgCl2, 40 HEPES; pH 7. 3, and freshly supplemented (within 1 h of recording) with 240 µg/ml amphotericin-B. The external solution contained (in mM) 160 tetraethylammonium (TEA) bromide, 3 KCl, 1.0 NaHCO3, 1.0 MgCl2, 10 HEPES, 4 glucose, 10 or 20 BaCl2 or CaCl2; pH 7. 4, 320 mOsm with sucrose. The perfusion rate was 1-2 ml/min. Pipettes of resistance 2-5 MOmega were used. An Axon 200A or an Axopatch 1D amplifier (Axon Instruments, Foster City, CA) was used, and data were filtered at 1 kHz and digitized at 5-10 kHz using a Digidata 1200 interface (Axon Instruments). Membrane capacitance measurements were recorded from the amplifier following capacitance compensation. Analysis was performed using pClamp 6.02 (Axon Instruments) and Origin 5 (Microcal Software, Northampton, MA). Current records are shown following leak and residual capacitance current subtraction (P/4 or P/5 protocol). Data are expressed as means ± SE. Statistical analysis was performed using paired or unpaired Student's t-test, as appropriate, where significance was defined as P < 0. 05 (*) and P < 0. 01 (**). Where indicated, I-V relations were fitted with a combined Boltzmann and linear fit
<IT>I</IT><SUB><IT>V</IT></SUB><IT>=</IT><IT>G</IT><SUB><IT>max</IT></SUB>(<IT>V</IT><IT>−</IT><IT>V</IT><SUB><IT>rev</IT></SUB>)<IT>/</IT>{<IT>1+exp</IT>[−(<IT>V</IT><IT>−</IT><IT>V</IT><SUB><IT>50,act</IT></SUB>)<IT>/</IT><IT>k</IT>]} (1)
where IV is the current density at voltage V, Gmax is the maximum conductance · pF-1, V50,act is the mid-point of voltage dependence of activation, Vrev is the reversal potential, and k is the slope factor.

Steady-state inactivation data were fitted with a Boltzmann function of the form
<IT>I</IT><SUB><IT>V</IT></SUB><IT>/</IT><IT>I</IT><SUB><IT>max</IT></SUB><IT>=1/</IT>{<IT>1+exp</IT>[(<IT>V</IT><IT>−</IT><IT>V</IT><SUB><IT>50,inact</IT></SUB>)<IT>/</IT><IT>k</IT>]} (2)
where IV/Imax is the current normalized to maximum current, V50,inact is the mid-point of voltage dependence of inactivation, V is the conditioning potential, and k is the slope factor. Current activation was fitted with a similar Boltzmann function with IV/Imax substituted by GV/Gmax (normalized conductance) and V50,inact substituted by V50,act.

The holding potential was -80 mV, unless otherwise stated. Voltages were not corrected for liquid junction potential, measured using the method described in Neher (1995), which were up to -2.7 mV in whole cell recording solutions and -5.4 mV in perforated-patch solutions.

Construction, expression, and purification of proteins

The polymerase chain reaction (PCR) was used to amplify (from full length clones) regions of cDNA encoding the calcium channel I-II loops of the rabbit alpha 1B and human alpha 1D clones (M76558). As the full length clone of the human alpha 1D was unavailable for PCR, it was necessary to perform RT-PCR from the HEK 293 alpha 1D cell line. Approximately 105 HEK 293 alpha 1D cells were lysed using the QiaShredder and the total RNA extracted using the Qiagen RNEasy kit (Qiagen, Crawley, UK). After a further phenol/chloroform extraction and precipitation the total RNA was reverse transcribed using MMLV-Reverse Transcriptase (Life Technologies, Paisley, Scotland) and random hexamer primers (Promega, Southampton, UK). PCR was performed using either Pfu (Promega) or Pfx (Life Technologies) high-fidelity DNA polymerase in the supplied polymerase buffers. BamHI and EcoRI restriction sites (underlined) for directional, in-frame cloning of the resulting fragments into pGEX2T (Pharmacia, St. Albans, UK) were present in the primer sets as follows:

alpha 1B Forward: 5'CTCAGGATCCTTTGCTAAGGAGCG3'

Reverse: 5'AGAAGAATTCTGCCTTCACCATGC3'

alpha 1D Forward: 5'GTGGATCCTTCTCAAAGGAAAGAG3'

Reverse: 5'AGGAATTCGTGACAGACTTCAC3'

Amplification was for 30 cycles before the resulting products were separated by agarose gel electrophoresis, digested with BamHI and EcoRI and subcloned into pGEX2T (Pharmacia). The resulting constructs are GSTalpha 1BI-II loop and GSTalpha 1DI-II loop, respectively. The sequences of all the fusion protein constructs were verified by cycle sequencing (Sequitherm, Epicentre laboratories, Madison, WI) or automated sequencing, before use in protein expression studies.

Expression cultures of BL21(DE3)-Codon Plus-(RIL) Escherichia coli (Stratagene, Amsterdam, NL) were grown overnight at 37°C in LB medium supplemented with 34 µg/ml chloramphenicol, 50 µg/ml ampicillin, and 1% (wt/vol) glucose. The saturated cultures were diluted 10-fold in the same medium and grown for a further 2.5 h. before cooling to 25°C and induction with 0.1 mM isopropyl-thio-galactopyranoside. Induced cultures were grown at 25°C for a further 2.5 h before harvesting. All further purification steps were performed at 4°C. Cells were lysed by sonication in phosphate-buffered saline, pH 7.4 (PBS: 10 mM phosphate buffer, pH 7.4, 137 mM NaCl, 2.7 mM KCl) containing 1% sarcosyl, 25 mM EDTA, 0.5 mM dithiothreitol, and protease inhibitors (1 tablet per 50 ml of lysate, Complete EDTA-free, Roche Diagnostics, Lewes, UK) followed by a 10-min incubation at 4°C. TritonX-100 was then added to a final concentration of 2% and the lysate re-sonicated and incubated at 4°C for a further 10 min. before centrifugation at 20,000 × g for 15 min at 4°C. The resulting supernatant was then applied to a 1-ml GSTrap column (Pharmacia) and the column washed with 10 column volumes of binding buffer (PBS, pH 7.4 containing 0.1% Triton X100, 20 mM EDTA, 0.5 mM dithiothreitol and 1 protease inhibitor tablet per 200 ml). Bound GST-fusion proteins were then eluted from the column with elution buffer (binding buffer, at pH 8.0, supplemented with 5 mM reduced glutathione). Glutathione was removed from the fusion protein preparations by dialysis against HBS-EP buffer [10 mM HEPES, pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.005% (vol/vol) Tween 20] before samples were frozen in aliquots at -20°C.

Bovine brain G-proteins were purified to apparent homogeneity using conventional chromatographic techniques. Gbeta gamma dimers were then liberated from Galpha subunits in the presence of aluminum fluoride (Exner et al. 1999). Isolation and final purification of Gbeta gamma was achieved using a Mono Q FPLC column (Pharmacia). Gbeta gamma subunits were identified by their immunoreactivity and stored in aliquots at -80°C until required for use.

A full-length beta 1b with C-terminal hexa-histidine tag (H6Cbeta 1b) was produced by PCR (10 cycles) using Pfu polymerase (Stratagene, Amsterdam), beta 1b in pMT2 as template and the following primers:

Forward: 5'GGGAATTCATGGTCCAGAAGAGCG3'

Reverse: 5' GGGAATTCTCAATGATGATGATGATGATGGCGGATCTACACG 3'

The resulting PCR product (approximately 1.9k.b.) was digested with EcoRI and subcloned into the pKK233-3 vector (Amersham Pharmacia, Little Chalfont, UK). To maximize yields of the full-length H6Cbeta 1b protein the 600b.p. 3' NcoI-EcoRI fragment of H6Cbeta 1b and the 1.3k.b. 5'NcoI-NcoI fragment of beta 1b were subcloned into NcoI-EcoRI digested pET28b (Novagen, Nottingham, UK) to give H6Cbeta 1b-pET28b. BL21(DE3)-Codon Plus-(IRL) Escherichia coli (Stratagene) were transformed with H6Cbeta 1b-pET28b, and cultures were grown overnight to saturation at 37°C in LB (pH 5.5) supplemented with kanamycin (30 µg/ml), chloramphenicol (34 µg/ml) and 1% wt/vol glucose, diluted 1:10 with the same media and grown for a further 3 h before cooling to room temperature and induction with 0.5 mM isopropylthio-beta -D-galactoside (IPTG). The cultures were grown for 3 h postinduction at room temperature then harvested by centrifugation, pellets were stored at -70°C until required.

Escherichia coli pellets containing expressed H6Cbeta 1b protein were lysed at 4°C by sonication in 20 mM phosphate buffer (pH 7.4), containing 1 protease inhibitor tablet per liter of culture pelleted. Solid NaCl was added to the lysate to a final concentration of 1 M before the lysate was cleared at 20,000 × g at 4°C for 15 min. Imidazole solution (pH 7.4) was then added to the resulting supernatant to give a final concentration of 40 mM before loading onto a nickel-primed 5 ml HiTrap Chelating column (Amersham Pharmacia) equilibrated with loading buffer (20 mM phosphate buffer, pH 7.4, 1 M NaCl, 40 mM Imidazole, 0.15% wt/vol octylglucoside and 1 protease inhibitor tablet per 100 ml). The column was washed thoroughly with wash buffer (as load buffer but 70 mM imidazole) before H6Cbeta 1b was eluted from the column in elution buffer (as load buffer but 200 mM imidazole).

Peak UV280 absorbance fractions were rapidly buffer exchanged on a Sephadex G-25 (Amersham Pharmacia) column into IEX buffer (20 mM 2-[N-morpholino]ethanesulfonic acid, pH 6.0, 1 protease inhibitor tablet per 200 ml) supplemented with 500 mM NaCl, before dilution 1:10 with IEX buffer. The diluted sample was loaded onto a 1 ml SP-Sepahrose HP column (Amersham Pharmacia), the column was washed with IEX buffer before H6Cbeta 1b proteins were eluted in a linear gradient of 0 to 1 M NaCl in IEX buffer. Fractions containing H6Cbeta 1b were identified by SDS-PAGE analysis, with Coomassie blue staining, before dialysis against storage buffer (20 mM borate, pH 8.0, 500 mM NaCl, 1 mM EDTA, 1 protease inhibitor tablet per 200 ml). H6Cbeta 1b prepared in this manner was found to have a half-life in excess of 60 days at 4°C as judged by SDS-PAGE and Coomassie blue staining.

Surface plasmon resonance binding assay

All assays were performed on a Biacore 2000 (Biacore AB, Uppsala, Sweden) at 25°C in HBS-EP buffer (10 mM HEPES, pH 7.4; 150 mM NaCl, 3 mM EDTA, 0.005% vol/vol polysorbate 20) unless stated otherwise. Glutathione S-transferase (GST) fusion proteins were immobilized on CM5 dextran chips using an anti-GST monoclonal antibody kit according to the manufacturer's instructions (Biacore AB). To obtain identical molar loadings of the different molecular mass fusion proteins, the following resonance unit (RU) correction factors were used during immobilization (GST = 1, GSTalpha 1DI-II loop = 1.52, GSTalpha 1BI-II loop = 1.57). Gbeta gamma dimers were diluted in HBS-EP buffer before use, and Gbeta gamma injections were performed using a flow rate of 50 µl/min for 5 min. Experiments using H6Cbeta 1b were performed in modified HBS-EP buffer containing 500 mM NaCl, with the same flow rate and injection time used for the Gbeta gamma experiments.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

alpha 1D Sensitivity to DHPs

From electrophysiological recording of the HEK 293 alpha 1D (alpha 1D/alpha 2delta -1/beta 3a) cell line, 43% of cells were found to express calcium channel currents, and for those currents that were stable, the mean current density was -10 ± 2.1 pA/pF (mean ± SE, n = 21) in 20 mM Ba2+ at a test potential of +10 mV (and approximately half this value when recorded in 10 mM Ba2+). As expected, the alpha 1D currents displayed sensitivity to DHP antagonists. The effects of 3 and 10 µM nifedipine are shown in the time course in Fig. 1A, and the percentage inhibition of IBa by 3 µM nifedipine and nicardipine is shown in the bar chart in Fig. 1B. The 1,4-DHP antagonist block was also characterized by an increase in the inactivation kinetics of IBa during the test depolarization (+10 mV, Vt), which can be observed by comparing the inhibition at peak compared with the end of the 200-ms test pulse (open circle  and , respectively, in Fig. 1A, and  and  in Fig. 1B). However, alpha 1D IBa showed very similar inhibition by nifedipine at three different holding potentials (Vh = -80, -50, and -30 mV). At Vh = -50 mV, 3 µM nifedipine inhibited alpha 1D IBa by 62 ± 7% (at peak) and 94 ± 3% (at the end of 200 ms pulse, n = 5); at Vh = -30 mV the inhibition was similar, being 56 ± 7% (at peak) and 91 ± 3% (at 200 ms, n = 6).



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. The alpha 1D currents are sensitive to 1,4 dihydropyridines (DHPs). A: the alpha 1D currents show inhibition by the DHP antagonist nifedipine (NIF). Time course of currents measured at peak (open circle ) and at the end () of the 200-ms test pulse. Depolarizing test pulses (Vt = +10 mV) were given every 30 s from a holding potential (Vh) of -80 mV. Application of NIF (3 and 10 µM) are denoted by the horizontal bars. The inset shows example traces taken from the time course for control (CTRL, 10 mM Ba2+) and for 3 and 10 µM NIF; the test pulse protocol is above these example traces. B: bar graph depicting mean current inhibition (%) at peak () and end of the 200 ms test pulse () for nifedipine (NIF, 3 µM, n = 7) and nicardipine (NIC, 3 µM, n = 6). C: sensitivity of alpha 1D currents to the DHP agonist S(-)-BayK8644. An example time course of measured peak current (open circle ) recorded with step depolarizations from Vh = -80 mV to Vt = +10 mV, at 30-s intervals (see pulse protocol above inset of example traces). Application of S(-)-BayK8644 (3 µM) is denoted by the horizontal bar below time course. D: an example cell showing a family of current-voltage (I-V) traces in control (20 mM Ba2+; CTRL) and during S(-)-BayK8644 (3 µM; BayK) enhancement of the current. I-V families were formed by depolarizing from -80 mV to between -40 and +60 mV in 10-mV increments, every 5 s (see pulse protocol below the CTRL family of traces). For clarity example traces are shown for currents measured by stepping to -40, -20, 0, and +20 mV only. In each condition, peak current was measured and plotted as an I-V relationship (bottom; CTRL, ; with BayK, ) and fitted by a modified Boltzmann equation (Eq. 1, see METHODS).

The agonist BayK S-(-)8644 (3 µM) produced a marked enhancement of the current (325 ± 25% increase, n = 5, at Vt = +10 mV in 10 mM Ba2+; 680 ± 84% increase, n = 14, at Vt = +10 mV in 20 mM Ba2+; Fig. 1C). The onset of enhancement was rapid (reaching steady-state enhancement within 1-2 min of application, Fig. 1C) and was accompanied by a characteristic hyperpolarizing shift in the I-V relationship (Fig. 1D). In some recordings BayK S-(-)8644 enhanced alpha 1D currents also displayed the characteristic slowing of tail current deactivation (for an example, see the enhanced current trace in Fig. 6B).

Biophysical characteristics of the alpha 1D current

The activation and steady-state inactivation of alpha 1D currents are shown in Fig. 2A. Fitting the current activation gave a V50,act of +1.8 ± 1.2 mV. Examining the steady-state inactivation properties of the alpha 1D currents showed that at test potentials up to +30 mV the alpha 1D currents did not fully inactivate and had a relatively depolarized V50,inact of -13. 4 ± 1.8 mV (n = 6). The inactivation kinetics at Vt = +10 mV were very slow in Ba2+ (see examples of control traces in Fig. 1, A, C, and D). Single exponentials were fitted to the inactivating phase during long (1,200-1,600 ms) depolarizing steps, (e.g., the white line in the example trace shown in Fig. 2B). The tau inact was 439 ± 50 ms (n = 4). The inactivation kinetics with external Ca2+ rather than Ba2+ were far more rapid, shown by the overlaid example traces in Fig. 2C. Almost complete inactivation was observed during a 200-ms depolarizing pulse in Ca2+ (tau inact = 44.3 ± 1.1 ms, n = 7). Additionally, the peak current in 20 mM Ca2+ was smaller than in 20 mM Ba2+ (ICa was ~20% of IBa). The mean I-V relationship in 20 mM Ba2+ and 20 mM Ca2+ exemplifies these differences (Fig. 2D).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. Biophysical properties of alpha 1D currents. A: activation and steady-state inactivation curves of alpha 1D currents in 20 mM Ba2+. To determine the steady-state inactivation (black-triangle) a standard +10-mV test pulse for 40 ms was elicited from Vh = -80 mV, and was then preceded by a 5-s (steady-state) incremental depolarization from -70 to +30 mV every 20 s (depicted in the pulse protocol, which lies above an example family of traces for such a protocol; see inset traces). Peak currents were normalized to the current measured with no prepulse (mean ± SE; n = 6). The resulting steady-state inactivation curve was then fitted with a Boltzmann equation (Eq. 2, see METHODS). The fit gave the steady-state inactivation V50,inact = -13.4 ± 1.8 mV, and k = 11.9 ± 1.7 mV. The activation (sigma ) was calculated using the following equation GV = IV/(V - Vrev). GV and IV are the conductance and current measured at each voltage, V, in the I-V relationship pulse protocol (see Fig. 1D). The I-V relationships were fitted with a combined Boltzmann and linear fit (Eq. 1, see METHODS) to determine Vrev. The resulting GV values were normalized to the peak Gmax for each I-V relationship, and averaged (mean ± SE; n = 10). The resulting data points were fitted with a Boltzmann equation (Eq. 2, see METHODS). The fit gave the activation V50,act = +1.8 ± 1.2 mV, and k = 7.3 ± 1.1 mV. B-D: comparison of alpha 1D currents in 20 mM Ba2+ vs. 20 mM Ca2+. B: long test pulses (1,200-1,600 ms) were used to determine tau inact in Ba2+. An example of such a fit is shown for a trace recorded in 20 mM Ba2+ with a +10-mV, 1,200-ms test pulse; this gave a tau inact of 436 ms. C: example traces in Ba2+ and Ca2+ obtained by depolarizing the cells to Vt = +10 mV for 200 ms in each condition. By fitting a single exponential to the inactivation of the trace recorded in Ca2+, a tau inact of 39.1 ms was obtained. D: using the same I-V pulse protocol described in Fig. 1D (depolarizing from Vh = -80 mV to between Vt = -40 and +60 mV in 10-mV increments), I-V relationships from 6 cells were measured in 20 mM Ba2+ and then in 20 mM Ca2+. Measurements for Ba2+ (peak, ; end of pulse, ) and Ca2+ (peak, ; end of pulse, open circle ) were made and plotted against the Vt to give the I-V relationship.

alpha 1D Currents do not show G-protein-mediated inhibition

Having established some basic biophysical and pharmacological properties of alpha 1D currents, we then examined whether these currents displayed G-protein modulation. Initially the modulation of the alpha 1D currents was compared with that of alpha 1B currents (known to be G-protein modulated), transiently expressed in HEK 293 cells, by activating the endogenous somatostatin receptor subtype 2 (sst2). Application of somatostatin (SST, 100-500 nM, n = 8) had no effect on the alpha 1D current (Fig. 3A). Using the same endogenous receptor-based signaling pathway, application of SST (500 nM) caused a rapid inhibition of alpha 1B currents, observed in all cells tested (see Fig. 3B; mean inhibition, 40 ± 7%, n = 8).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 3. The lack of G-protein-coupled receptor (endogenous sst2) modulation of alpha 1D currents. A: a time course of peak alpha 1D currents from whole cell patch-clamp recording. Currents were evoked every 30 s from Vh = -80 mV to Vt = +10 mV () in alpha 1D expressing cells in 20 mM Ba2+. Somatostatin (SST; 500 nM) and NIF (3 µM) application are denoted by the horizontal bars. No response was observed in response to SST application (100-500 nM, n = 8). The insets show overlapping example traces observed in control (CTRL) and SST (500 nM). B: peak currents measured from whole cell patch-clamp recordings in alpha 1B/alpha 2delta -1/beta 3 expressing cells (Vh = -80 mV, Vt = +20 mV, every 30 s, ). SST (500 nM) application inhibited the current by 40 ± 7% (n = 8). Inset shows example traces in control and during SST inhibition. C: peak currents measured during an amphotericin-B perforated patch-clamp experiment. Time course of peak alpha 1D currents evoked in 20 mM Ba2+ by depolarizing from Vh = -80 mV to Vt = +10 mV every 30 s. Application of somatostatin (SST, 500 nM) is denoted by the hatched box area. During this time course I-V relationships were performed in CTRL, SST, and WASH conditions (denoted by "IV" during the time course). Below the time course are examples of families of traces evoked by the standard I-V pulse protocol (depolarizing from Vh = -80 mV to between -40 and +60 mV in 10-mV increments) for CTRL, SST, and WASH conditions (for clarity examples only from Vt = -40, -20, 0, and +20 mV are shown).

Due to the nature of whole cell patch clamping, the internal contents of the cell can be disrupted, resulting in loss of normal signaling pathways within the cell. Such "wash out" effects can be minimized by using the perforated-patch clamp technique (Horn and Marty 1988). To ensure that the loss of G-protein modulation was not due to such wash out, amphotericin-B perforated patches were also used; however, no modulation of alpha 1D currents by SST was observed at any test potential (n = 5, Fig. 3C). I-V relationship pulse protocols were performed during control, SST perfusion and wash conditions in a perforated patch-clamp recording (example traces from these I-V relationships are shown at the bottom of Fig. 3C). The results exemplify the lack of effect of SST with almost identical values for V50,act (CTRL = -6.1 mV; SST = -6.6 mV; WASH = -5.7 mV) and k (CTRL = 8.6 mV; SST = 8.2 mV; WASH = 8.4 mV).

To examine another G-protein-coupled receptor pathway, the rD2long receptor was transiently co-expressed with GFP as an expression marker in the alpha 1D cell line and was also transiently co-expressed with alpha 1B/alpha 2delta -1/beta 3 in HEK293 cells. However, application of the D2 agonist quinpirole (300 nM), had no effect on alpha 1D currents (n = 7, Fig. 4A), although a clear inhibitory effect was observed in 10/16 of the alpha 1B/alpha 2delta -1/beta 3 expressing cells (with a mean inhibition of 59 ± 7%, n = 10; Fig. 4B). This inhibition was greater than that produced by activation of the endogenous sst2 receptor, suggesting more efficient activation of this G-protein pathway by D2 receptors, but despite this, no inhibition of alpha 1D currents was observed (Fig. 4C).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4. The lack of G-protein-coupled receptor (transiently expressed rD2R) modulation of alpha 1D currents: whole cell recordings. A: alpha 1D expressing cells were co-transfected with rD2long receptor and GFP (expression marker); application of the D2 agonist quinpirole (Quin, 300 nM) had no effect on current (n = 7, ); test pulses (from Vh = -80 mV to Vt = +10 mV) were given every 15 s. Traces during Quin and control (CTRL) conditions are shown in the inset (overlapping). B: transient expression of alpha 1B/alpha 2delta -1/beta 3 and co-expression rD2long receptor: time course of measured peak current (same pulse protocol as in A, except Vt = +20 mV, ): application of Quin (300 nM) inhibited IBa in 10/16 cells tested. Example traces during CTRL and Quin application are shown in the inset. C: bar graph showing %inhibition (mean ± SE) for SST application on alpha 1D and alpha 1B currents (1st 2 columns), and for Quin on alpha 1D and alpha 1B currents (additionally co-transfected with rD2long receptor; 3rd and 4th columns, respectively).

The GTP analogue GTP-gamma S can be used as a more direct way of activating G-proteins since it is nonhydrolyzable and leads to their sustained activation. Conversely, the GDP analogue GDP-beta S can be used to block G-protein activation. Using these guanine nucleotide analogues, the existence of tonic modulation was examined with a prepulse (PP) protocol. Figure 5A depicts the ratio of current in the absence (no PP) or immediately following (+PP) a large depolarizing prepulse (+PP/no PP ratio) for control (CTRL, gray columns and associated example traces), with 100 µM GTP-gamma S (black columns and associated example traces) and with 2 mM GDP-beta S intracellularly (white columns and associated example traces). It can be seen in both the histogram and also in the example traces relating to these +PP/no PP ratios (Fig. 5A), that there was a small degree of facilitation (+PP/no PP ratio >1) in all of the intracellular conditions. Furthermore, the activation time to 90% peak (ttp 90%) was shorter for all +PP than no PP currents (Fig. 5B). However, the magnitude of prepulse facilitation, and the activation ttp 90%, were unaltered by inclusion of GTP-gamma S or GDP-beta S.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. Lack of G-protein modulation of alpha 1D via GTP-gamma S and GDP-beta S. The following shading is used in all histograms: control intracellular (CTRL, gray), with 100 µM GTP-gamma S (+GTP-gamma S, black) and with 2 mM GDP-beta S (+GDP-beta S, white). A and C: using the pulse protocol depicted in the top right, in which the test pulse was applied either preceded (+PP) or not (no PP) by a 100-ms prepulse to +120 mV. The measurements of (+PP/no PP) ratio were measured in CTRL, +GTP-gamma S, and +GDP-beta S for cells expressing alpha 1D (A) and alpha 1B (C). The +PP/no PP ratios were calculated by measuring the values of IBa at 20 ms after the start of the test pulse. Figures below columns denote the numbers of experiments. Statistical significance was determined by using an unpaired Student's t-test (**P < 0.01) between CTRL and experimental conditions. Example traces for no PP and +PP in alpha 1D with CTRL, +GTP-gamma S and +GDP-beta S intracellular conditions are shown at the top of A and in alpha 1B with CTRL and +GTP-gamma S intracellular conditions at the top of C. B and D: using the same cells used for the +PP/no PP determination in A and C, the ttp 90% was measured for both sets of currents. The ttp 90% values were measured by determining the maximum current amplitude, and measuring the time at which the current reached 90% of its maximum amplitude. Statistical significance was determined using a paired Student's t-test between the ttp90% for no PP (-) and + PP (+) currents, for each of the conditions (*P < 0.05, **P < 0.01).

In comparison, in recordings made from cells transfected with alpha 1B channels, there was no evidence of prepulse facilitation of alpha 1B currents using control intracellular pipette solution. However, following direct activation of G-proteins with GTP-gamma S (Fig. 5C), there was a marked facilitation of the +PP current compared with the no PP current. Under these recording conditions, the ttp 90% was also greater in the no PP current than in the current preceded by a prepulse, whereas in control conditions this was not apparent (Fig. 5D).

G-protein modulation of calcium currents can be also identified by a decrease in the current amplitude and a depolarizing shift of the I-V relationship with intracellular GTP-gamma S, while opposite effects (increase in current density and hyperpolarizing shift of the I-V relationship) are seen with GDP-beta S (due to removal of tonic G-protein modulation). However, in the HEK 293 alpha 1D cell line no difference was observed in the I-V relationships across the G-protein activating conditions (control, n = 21; +GTP-gamma S, n = 23; +GDP-beta S, n = 17; data not shown).

alpha 1D Currents are also resistant to G-protein modulation in the presence of a 1,4-DHP agonist

In a recent study by Hernandez-Guijo et al. (1999), a form of voltage-independent G-protein modulation was observed of rat chromaffin cell L-type currents. Inhibition was observed during perfusion of a cocktail of BayK S-(-)8644, by a combination of a number of receptor agonists including ATP, opioids with or without the additional inclusion of catecholamines. In Fig. 6, we investigated whether there was any G-protein modulation of the alpha 1D currents during BayK S-(-)8644 perfusion. The alpha 1D expressing cells were also transiently transfected with rD2long receptors, and after enhancement of the alpha 1D current by BayK S-(-)8644 (3 µM), a cocktail of BayK S-(-)8644 (3 µM), SST (500 nM), and quinpirole (300 nM) was applied. No effect was observed of this cocktail of drugs (n = 5, Figs. 6, A and B).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6. alpha 1D does not exhibit sensitivity to a cocktail of SST and Quin in the presence of a DHP agonist. A: time course of measured peak currents in alpha 1D expressing cells (Vh = -80 mV, Vt = +10 mV every 15 s). Application of BayK S-(-)8644 (BayK, 3 µM) and the receptor agonist cocktail are depicted by the horizontal bars. The cocktail consisted of BayK (3 mM), SST (500 nM), and Quin (300 nM) and had no effect on alpha 1D currents (n = 5). B: example traces taken from the time course are denoted by numbers (1-4); left: CTRL (1) vs. current enhanced by BayK (2); right: overlapping currents for BayK (3) vs. cocktail (4) application.

Selectivity of 1,4-DHP antagonists for L-type currents

Despite the lack of G-protein modulation of expressed alpha 1D channel currents in HEK 293 cells, several reports showing the modulation of 1,4-DHP-sensitive currents in neuroendocrine cells have appeared (Degtiar et al. 1997; Gilon et al. 1997; Haws et al. 1993; Hernandez-Guijo et al. 1999; Kleuss et al. 1991; Tallent et al. 1996). One possible explanation is that 1,4-DHPs may be blocking non-L-type currents, and it is these currents that exhibit the G-protein modulation. Previous research has shown that the selectivity of DHP antagonists for L-type channels may not be as absolute as previously thought (Diochot et al. 1995; Furukawa et al. 1999). To further examine this possibility of alpha 1E channels providing a G-protein-modulated, 1,4-DHP-sensitive current, we investigated currents resulting from transient expression of alpha 1E long/alpha 2delta -1/beta 1b. It was observed that these alpha 1E currents were inhibited by both nifedipine and nicardipine (10 µM), although the onset of inhibition is slower than for inhibition of alpha 1D currents (data not shown). The % inhibition was compared at the peak of the current and at the end of the 200-ms depolarizing test pulse. For nifedipine, there was 13 ± 4% inhibition of the peak current and 32 ± 9% inhibition at 200 ms (n = 9). For nicardipine, there was 63 ± 5% inhibition of the peak current and 87 ± 7% inhibition at 200 ms (n = 3). Thus the increased inactivation that was associated with 1,4-DHP inhibition of alpha 1D currents is also apparent for these alpha 1E currents.

Gbeta gamma and VDCC beta  subunit binding to alpha 1 I-II loops expressed as GST fusion proteins

To examine biochemically the basis for the lack of G-protein modulation of the alpha 1D VDCC, the cytoplasmic loops between transmembrane domains I-II of the human alpha 1D and rabbit alpha 1B clones used in this study were expressed in Escherichia coli as GST fusion proteins and purified as described in METHODS. The purified fusion proteins are shown after separation on 12.5% SDS-PAGE gels (Fig. 7A). The proteins were bound via the GST moiety to the Biacore 2000 CM5 sensor chip, as described, and GST itself was used as a control. Purified bovine brain Gbeta gamma subunits were then applied to the sensor chip surface at a rate of 50 µl/min, for 5 min. The sensorgram traces are shown in Fig. 7B, for three concentrations (10, 25, and 50 nM) of Gbeta gamma exposed to the alpha 1B I-II loop, and a single concentration of Gbeta gamma (100 nM) exposed to the alpha 1D I-II loop. In contrast to the data for the alpha 1B I-II loop, which showed concentration-dependent binding of Gbeta gamma , no binding of Gbeta gamma was observed to the alpha 1D I-II loop. A similar lack of binding was observed for up to 4 µM Gbeta gamma exposed to a fusion protein of the I-II loop from a rat pancreatic alpha 1D clone (D38101, results not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7. Lack of Gbeta gamma binding and binding of voltage-dependent calcium channel (VDCC) beta  subunit to alpha 1D I-II loop. A: silver-stained SDS gel (12.5%) (Brabet et al. 1988) of the proteins used in the surface plasmon resonance binding assays. Approximately 0.5 µg was loaded of the following proteins: GST, GSTalpha 1BI-II loop and GSTalpha 1DI-II loop, and VDCC beta 1b subunit, as indicated. The positions of molecular mass markers (Sigma) are shown for comparison in the outside lanes. B: Biacore 2000 sensorgrams. Approximately 4 fmol of each fusion protein was immobilized on an individual flow cell of a CM5 dextran sensor chip via an anti-GST monoclonal antibody according to the manufacturer's instructions. This corresponds to approximately 100 reference units (R.U.) of GST, 157 R.U. of GST alpha 1BI-II loop, and 152 R.U. of GSTalpha 1DI-II loop. Gbeta gamma dimers were diluted to the concentrations stated, in HBS-EP buffer before use and injected over all flow cells at a flow rate of 50 µl/min for 5 min. The resulting sensorgrams from the flow cell containing GST were subtracted from those containing the GSTalpha 1BI-II loop (solid line) and GSThalpha 1DI-II loop (dashed line) as a correction for bulk refractive index changes during Gbeta gamma perfusion and for nonspecific binding of the Gbeta gamma analyte to the GST moieties of the fusion proteins. C: Biacore 2000 sensorgrams for beta 1b binding to the alpha 1B and alpha 1D I-II loop GST fusion proteins immobilized as in B. beta 1b was applied at 10 nM to the alpha 1D I-II loop and 100 nM to the alpha 1B I-II loop in HBS-EP buffer containing 500 nM NaCl, at 50 µl/ml for 5 min. The data were subjected to the same subtraction procedure as described in B. Solid line, alpha 1B I-II loop; dashed line, alpha 1D I-II loop.

Kinetic analysis was performed for the lowest concentration of Gbeta gamma (10 nM) binding to the alpha 1B I-II loop. Single exponential fits were made to the binding and dissociation phases of the sensorgram (Fig. 7B). The observed on-rate [kon(obs)] for Gbeta gamma binding was 0.0121 s-1, and the off-rate (koff) after termination of Gbeta gamma perfusion was 0.0104 s-1. Assuming a unimolecular reaction in which
<IT>k</IT><SUB><IT>on</IT>(<IT>obs</IT>)</SUB><IT>=</IT><IT>k</IT><SUB><IT>on</IT></SUB>[<IT>G&bgr;&ggr;</IT>]<IT>+</IT><IT>k</IT><SUB><IT>off</IT></SUB>
and
<IT>K</IT><SUB><IT>D</IT></SUB><IT>=</IT><IT>k</IT><SUB><IT>off</IT></SUB><IT>/</IT><IT>k</IT><SUB><IT>on</IT></SUB>
the KD for Gbeta gamma binding was calculated to be 62.2 nM. This is very similar to the KD determined previously for Gbeta gamma binding to parts of the alpha 1A I-II loop (De Waard et al. 1997).

As a positive control for the integrity of the GST fusion proteins, the ability of purified H6Cbeta 1b (Fig. 7A) to bind to the same I-II loops was examined. Both alpha 1D and alpha 1B I-II loops bound H6Cbeta 1b reversibly (Fig. 7C), with the alpha 1D I-II loop demonstrating a higher binding affinity with a KD of 10 nM compared with 21 nM for alpha 1B, determined as above, using the Biacore kinetic analysis software with 1:1 interaction.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

L-type current characteristics exhibited by expression of the human neuronal alpha 1D clone

There are a number of key characteristics shown by the calcium channel currents expressed by the HEK 293 alpha 1D cells that are acknowledged as being traits of L-type currents. Sensitivity to the DHP antagonists (nifedipine and nicardipine) and an agonist [BayK S-(-)8644] were observed. The degree of inhibition and enhancement are comparable with other studies investigating the pharmacology of expressed cloned L-type channels (Tomlinson et al. 1993; Williams et al. 1992). In addition, the increased inactivation observed during DHP antagonist application that has been reported previously for native cardiac L-type channels (Lee and Tsien 1983) was also apparent for the alpha 1D currents. This effect of DHP antagonists on the inactivation kinetics was recently investigated by Handrock et al. (1999), who suggested that it is due to a second DHP binding site. However, care must be taken when using the characteristics of antagonism by DHPs, since, as was observed by the application of nifedipine and nicardipine to cells transiently expressing alpha 1E channels in this study, alpha 1E channels also exhibit inhibition by DHP antagonists (Stephens et al. 1997), including the characteristic increase in inactivation (compare peak inhibition with that at 200 ms into the depolarizing prepulse). More selective pharmacological definition of L-type over alpha 1E or other non-L-type currents might be obtained by using low micromolar concentrations of nifedipine (rather than the more promiscuous nicardipine; an effect also observed in oocytes) (Furukawa et al. 1999). However, in the present study, 10 µM nifedipine was required to completely inhibit alpha 1D currents. Enhancement by BayK S-(-)8644 remains a defining characteristic of L-type currents, since alpha 1E currents have previously been shown to be insensitive to BayK S-(-)8644 (Stephens et al. 1997).

Many of the biophysical characteristics expected of L-type currents are also observed for the alpha 1D currents. The I-V relationship in Fig. 2D shows that the currents activate at about -20 mV and with the peak at approximately +20 mV in 20 mM Ba2+, as also observed for other native L-type channels, and for alpha 1C currents (Lacinova et al. 1995). However, native alpha 1D currents observed in inner hair cells were shown to have I-V relationships approximately 20 mV negative to the I-V relationship observed in this study (Platzer et al. 2000); this difference may be partially accounted for by the lower external Ba2+ concentration used (10 mM). They also exhibit the ion selectivity (Ba2+ > Ca2+) typical of other native and cloned L-type channels (Kalman et al. 1988), with current density in 20 mM Ba2+ being approximately five-fold greater than that seen for 20 mM Ca2+. The activation observed for the alpha 1D currents expressed in this study (V50,act of +1.8 mV; see Fig. 2A) is very similar to expressed cardiac (Pérez-García et al. 1995) and neuronal (Tomlinson et al. 1993) alpha 1C L-type channel currents. The steady-state inactivation (V50,inact of -13.9 mV; see Fig. 2A), is also comparable to expressed cardiac alpha 1C L-type currents (Lacinova et al. 1995). The inactivation kinetics are also typical of "long-lasting" neuronal L-type currents (Nowycky et al. 1985). In 20 mM Ba2+, very little inactivation of alpha 1D currents was observed, while rapid and striking calcium-dependent inactivation was observed in 20 mM Ca2+ (see Fig. 2, B-D).

Another characteristic of the alpha 1D currents that correlates well with other studies of expressed alpha 1C channels (Dai et al. 1999; Kamp et al. 2000) is the small but reproducible facilitation following a large depolarizing prepulse (see Fig. 5). Such attributes are often indicative of G-protein modulation; however, for the alpha 1D current this effect was independent of G-protein modulation, as it was similar in the presence of GTP-gamma S and GDP-beta S.

As yet there are no biophysical characteristics or pharmacological tools that can differentiate between currents resulting from either native or expressed alpha 1C and alpha 1D channels. Previous research has shown that the block by DHP antagonists is voltage dependent, with greater inhibition being observed when the holding potential is more depolarized (Sanguinetti and Kass 1984). However, for the alpha 1D currents no such voltage dependence of block by DHP antagonists was observed, with similar block occurring (at both peak current and 200 ms) at all holding potentials examined. Another aspect that may prove to be different is the tau inact of alpha 1D currents in Ba2+. In a previous study examining the tau inact of alpha 1C when co-expressed with beta 3 in Xenopus laevis oocytes (Soldatov et al. 1997), slower rates of inactivation were observed (~1,300 ms) than seen here for alpha 1D currents. Nevertheless, care must be taken in interpreting such results since expression system (oocyte vs. HEK 293) and specific accessory subunit composition (particularly beta  subunits) will have marked effects on the inactivation properties.

Lack of G-protein modulation of alpha 1D currents

The preceding biophysical and pharmacological characterization clearly defined the alpha 1D currents as being L-type in nature. We then investigated the possibility of G-protein modulation of this L-type current. G-protein modulation was examined either by activation of the endogenous sst2 receptors or by transient expression of another GPCR, the rD2long receptor. However, no modulation was observed of alpha 1D currents via either pathway. To ensure that the G-protein pathways were intact and capable of coupling to calcium channels in the HEK 293 cells, both the endogenous sst2 and the transiently expressed exogenous rD2long receptors were stimulated via their respective agonists in HEK 293 cells expressing alpha 1B currents, which have been shown to be G-protein modulated by many groups (for review, see Dolphin 1998). These positive controls showed obvious G-protein modulation, confirming that modulation is possible by these pathways. Furthermore, the modulation of the alpha 1D current was also investigated during application of BayK S-(-)8644, since G-protein-mediated inhibition of L-type currents had been observed in native rat chromaffin cells, during enhancement by BayK S-(-)8644 (Hernandez-Guijo et al. 1999). However, a combination of BayK S-(-)8644, SST, and quinpirole did not reveal inhibitory G-protein modulation of BayK S-(-)8644-enhanced alpha 1D currents co-expressed with rD2long (see Fig. 6).

Another method to examine G-protein modulation is to use the nonhydrolyzable GTP and GDP analogues GTP-gamma S and GDP-beta S. The advantage of using these guanine nucleotide analogues is that they act directly on all G-proteins, producing sustained activation (in the case of GTP-gamma S) or blockade of activation (GDP-beta S) (Dolphin and Scott 1987). Using a standard large depolarizing (+120 mV) prepulse protocol to detect G-protein modulation, no GTP-gamma S-dependent effect was observed on alpha 1D currents, yet the alpha 1B currents do exhibit marked tonic G-protein modulation in these conditions.

The lack of G-protein modulation of this alpha 1D clone is corroborated by the lack of Gbeta gamma binding to a GST fusion protein of the alpha 1D I-II loop, whereas in parallel experiments, reversible binding of Gbeta gamma was observed to the alpha 1B I-II loop. In contrast, both the alpha 1D and alpha 1B I-II loops reversibly bound purified beta 1b subunit, indicating that they are probably folded in a native conformation (see Fig. 7C). While the I-II loop is not the only region of the alpha 1B calcium channel that is involved in its G-protein regulation (Canti et al. 1999; Page et al. 1998; Zhang et al. 1996), nevertheless it is certainly one of the key sequences contributing to the inhibition of neuronal calcium channels (De Waard et al. 1997).

Gs-protein modulation of L-type currents was also investigated by activation of the Gs-adenyl cyclase pathway with forskolin. No effect of forskolin was observed (n = 4, data not shown). Protein kinase A (PKA) modulation of channels has been shown to require A-kinase anchoring proteins (AKAPs) (Johnson et al. 1997). The presence of AKAPs was not examined in this study, although they are likely to be present since they are found in tsA-201 cells which are an HEK 293-derived cell line (Johnson et al. 1997).

From these results, the alpha 1D L-type clone used in the present study does not appear to be the molecular counterpart of the native neuronal and endocrine L-type channels that have been shown to exhibit G-protein modulation in several neuroendocrine preparations (Degtiar et al. 1997; Gilon et al. 1997; Haws et al. 1993; Hernandez-Guijo et al. 1999; Kleuss et al. 1991; Tallent et al. 1996).

Source of G-protein-modulated neuroendocrine L-type current?

Since we have shown that the alpha 1D/alpha 2delta -1/beta 3a currents do not exhibit inhibitory G-protein modulation, what is the molecular counterpart of the native L-type current in neuroendocrine cells that do exhibit G-protein modulation? L-type currents are generally identified by their sensitivity to DHP antagonists; however, we previously demonstrated DHP antagonist block of a rat alpha 1E isoform, rbEII (Stephens et al. 1997). Because this isoform has a 50 amino acid truncation of the N-terminus compared with alpha 1E clones from other species (Page et al. 1998), and may therefore not represent a native isoform in rat brain (Schramm et al. 1999), we have now confirmed and extended the finding of DHP sensitivity of alpha 1E currents, using alpha 1Elong, an isoform whose extended N-terminus is homologous to the cloned human (L27745), rabbit (X67855), and mouse (L29346) (Williams et al. 1994) alpha 1E sequences. The partial DHP sensitivity (particularly to nicardipine) of alpha 1E currents observed, as well as the DHP sensitivity of other cloned non-L-type currents observed recently (Furukawa et al. 1999) suggests the caveat that some studies apparently demonstrating G-protein modulation of "L-type" currents (according to their sensitivity to DHP antagonists) may need to be reviewed. However, this uncertainty over identification of L-type currents by DHP antagonist sensitivity may only be relevant to a few studies, and the significant bank of evidence for G-protein modulation of neuroendocrine L-type channels will be unaffected, particularly those studies in which L-type currents have been defined by S(-)-BayK8644 enhancement (Hernandez-Guijo et al. 1999).

Additional alpha 1D isoforms have been cloned from pancreatic beta -cells in rat (Ihara et al. 1995) and hamster (Yaney et al. 1992). There is little functional expression data available for these clones. Expression of alpha 1D clones appears to be problematic with relatively low current density yields (even in the clone used in this study, a low percentage of cells exhibited stable currents), a problem that has hindered research in this area and may indicate that the full-length clones currently available are not naturally occurring splice variants. A number of sequences within the alpha 1A, alpha 1B, and alpha 1E VDCC subunits have been shown to be important for Gbeta gamma binding and modulation of the channel. These important alpha 1 VDCC subunit sequences include the intracellular loop between domains I and II (De Waard et al. 1997), a region within the N-terminus (Canti et al. 1999; Page et al. 1998) and the C-terminus (Qin et al. 1997; Zhang et al. 1996). Two particularly relevant motifs present in the I-II loop (QQIER) (Zamponi et al. 1997) and the N-terminus (YKQSIAQRART) (Canti et al. 1999) of alpha 1B are not conserved in the alpha 1D clone used here. Furthermore, when comparing sequence alignments of the pancreatic beta -cell alpha 1D clones with the neuronal alpha 1D clone used in this study, most elements in putative regions pertinent to G-protein modulation are homologous to each other. This suggests that these additional published alpha 1D clones may also be predicted to exhibit no G-protein modulation. Indeed, similar results have been obtained regarding the lack of inhibitory G-protein modulation of another alpha 1D clone (Yaney et al. 1992) (A. Scholze, T. D. Plant, A. C. Dolphin, and B. Nürnberg, unpublished results). However, the alpha 1D sequences show least conservation in the C-terminal tails, with either long (as in the alpha 1D clone used here) or short C-terminus isoforms (as in Yaney et al. 1992) providing scope for the possibility that the C-terminus of alternative alpha 1D splice variants may provide a means of G-protein modulation of certain splice variants.

As further progress is made in the elucidation of neuroendocrine L-type channels, it is becoming clear that a sophisticated level of complexity is likely to exist. For example, in the GH3 (a rat pituitary derived) cell line alone, several mRNA transcripts encoding splice variants of the alpha 1D subunit have been reported (Safa et al. 1998). Further complexity of these channels will be added due to the differing combinations of accessory subunits. Although beta 3 appears to be a significant accessory subunit associated with neuronal L-type channels (Pichler et al. 1997), nevertheless, beta 4 is also prominently associated with neuronal L-type channels, and beta 1b and beta 2a are also associated with a small proportion of the channels (Pichler et al. 1997). Between beta  subunit isoforms there are also splice variants (for reviews see Birnbaumer et al. 1998; Castellano and Perez-Reyes 1994) that add to the channel subunit complexity. Among these combinations of alpha 1D splice variants and accessory subunits, there may be a sub-set that do exhibit the G-protein modulation observed in native neuroendocrine cells and derived cell lines. Alternatively, an as yet undiscovered accessory protein may be required for coupling of the neuronal L-type channels to G-protein inhibitory pathways, or modulation may involve Ca2+-dependent mechanisms (Mathie et al. 1992), a process not investigated in the present study.


    ACKNOWLEDGMENTS

The cDNAs used in this study were generously provided by the following: E. Perez-Reyes (University of Virginia); T. Snutch (University of British Columbia, Vancouver, Canada); Y. Mori (Seriken, Okazaki, Japan); P. G. Strange (Reading, UK); T. Hughes (Yale, New Haven, CT); and Genetics Institute (Cambridge, MA). The technical help of N. Balaguero is gratefully acknowledged.

This work was supported by the Medical Research Council (MRC), Wellcome Trust and Royal Society. D. C. Bell was funded by a MRC/Merck, Sharp and Dohme collaborative Ph.D. studentship.

Present addresses: D. C. Bell, Center for Neurobiology and Behavior, Columbia University, New York, NY 10032; P. F. Brust, Ambryx Inc., 11099 N. Torrey Pines Rd., #160, La Jolla, CA 92037; A. Nesterova, Dept. of Endocrinology, University of Colorado Health Sciences Center, Denver, CO 80262.


    FOOTNOTES

Address for reprint requests: A. C. Dolphin, Dept. of Pharmacology (Medawar Building), University College London, Gower St., London WC1E 6BT, UK (E-mail: a.dolphin{at}ucl.ac.uk).

Received 17 May 2000; accepted in final form 18 October 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

0022-3077/01 $5.00 Copyright © 2001 The American Physiological Society



This article has been cited by other articles:


Home page
JGPHome page
M. L. Roberts-Crowley and A. R. Rittenhouse
Arachidonic acid inhibition of L-type calcium (CaV1.3b) channels varies with accessory CaV{beta} subunits
J. Gen. Physiol., April 1, 2009; 133(4): 387 - 403.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Ramadan, Y. Qu, R. Wadgaonkar, G. Baroudi, E. Karnabi, M. Chahine, and M. Boutjdir
Phosphorylation of the Consensus Sites of Protein Kinase A on {alpha}1D L-type Calcium Channel
J. Biol. Chem., February 20, 2009; 284(8): 5042 - 5049.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
H. Vacher, D. P. Mohapatra, and J. S. Trimmer
Localization and Targeting of Voltage-Dependent Ion Channels in Mammalian Central Neurons
Physiol Rev, October 1, 2008; 88(4): 1407 - 1447.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
T. Momiyama and Y. Fukazawa
D1-like dopamine receptors selectively block P/Q-type calcium channels to reduce glutamate release onto cholinergic basal forebrain neurones of immature rats
J. Physiol., April 1, 2007; 580(1): 103 - 117.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
P. Chameau, Y. Qin, S. Spijker, G. Smit, and M. Joels
Glucocorticoids Specifically Enhance L-Type Calcium Current Amplitude and Affect Calcium Channel Subunit Expression in the Mouse Hippocampus
J Neurophysiol, January 1, 2007; 97(1): 5 - 14.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
F. P. Bellinger, B. K. Fox, W. Y. Chan, L. K. Davis, M. A. Andres, T. Hirano, E. G. Grau, and I. M. Cooke
Ionotropic glutamate receptor activation increases intracellular calcium in prolactin-releasing cells of the adenohypophysis
Am J Physiol Endocrinol Metab, December 1, 2006; 291(6): E1188 - E1196.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
G. L. J. Galli, E. W. Taylor, and H. A. Shiels
Calcium flux in turtle ventricular myocytes
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2006; 291(6): R1781 - R1789.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. J. Butcher, J. Leroy, M. W. Richards, W. S. Pratt, and A. C. Dolphin
The importance of occupancy rather than affinity of CaV{beta} subunits for the calcium channel I-II linker in relation to calcium channel function
J. Physiol., July 15, 2006; 574(2): 387 - 398.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. Liu, S. M. P. Jacobo, N. Hilliard, and G. H. Hockerman
Differential Modulation of Cav1.2 and Cav1.3-Mediated Glucose-Stimulated Insulin Secretion by cAMP in INS-1 Cells: Distinct Roles for Exchange Protein Directly Activated by cAMP 2 (Epac2) and Protein Kinase A
J. Pharmacol. Exp. Ther., July 1, 2006; 318(1): 152 - 160.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Eltit, A. A. Garcia, J. Hidalgo, J. L. Liberona, M. Chiong, S. Lavandero, E. Maldonado, and E. Jaimovich
Membrane Electrical Activity Elicits Inositol 1,4,5-Trisphosphate-dependent Slow Ca2+ Signals through a Gbeta{gamma}/Phosphatidylinositol 3-Kinase {gamma} Pathway in Skeletal Myotubes
J. Biol. Chem., April 28, 2006; 281(17): 12143 - 12154.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. A. Wolf, J. T. Moyer, M. T. Lazarewicz, D. Contreras, M. Benoit-Marand, P. O'Donnell, and L. H. Finkel
NMDA/AMPA Ratio Impacts State Transitions and Entrainment to Oscillations in a Computational Model of the Nucleus Accumbens Medium Spiny Projection Neuron
J. Neurosci., October 5, 2005; 25(40): 9080 - 9095.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Z. Zhang, Y. He, D. Tuteja, D. Xu, V. Timofeyev, Q. Zhang, K. A. Glatter, Y. Xu, H.-S. Shin, R. Low, et al.
Functional Roles of Cav1.3({alpha}1D) Calcium Channels in Atria: Insights Gained From Gene-Targeted Null Mutant Mice
Circulation, September 27, 2005; 112(13): 1936 - 1944.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Leroy, M. S. Richards, A. J. Butcher, M. Nieto-Rostro, W. S. Pratt, A. Davies, and A. C. Dolphin
Interaction via a Key Tryptophan in the I-II Linker of N-Type Calcium Channels Is Required for {beta}1 But Not for Palmitoylated {beta}2, Implicating an Additional Binding Site in the Regulation of Channel Voltage-Dependent Properties
J. Neurosci., July 27, 2005; 25(30): 6984 - 6996.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
R. A. Rose, M. B. Anand-Srivastava, W. R. Giles, and J. S. Bains
C-type Natriuretic Peptide Inhibits L-type Ca2+ Current in Rat Magnocellular Neurosecretory Cells by Activating the NPR-C Receptor
J Neurophysiol, July 1, 2005; 94(1): 612 - 621.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y. Qu, G. Baroudi, Y. Yue, N. El-Sherif, and M. Boutjdir
Localization and modulation of {alpha}1D (Cav1.3) L-type Ca channel by protein kinase A
Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2123 - H2130.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
N. Hosoi, I. Arai, and M. Tachibana
Group III Metabotropic Glutamate Receptors and Exocytosed Protons Inhibit L-Type Calcium Currents in Cones But Not in Rods
J. Neurosci., April 20, 2005; 25(16): 4062 - 4072.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Berrou, Y. Dodier, A. Raybaud, A. Tousignant, O. Dafi, J. N. Pelletier, and L. Parent
The C-terminal Residues in the Alpha-interacting Domain (AID) Helix Anchor CaV{beta} Subunit Interaction and Modulation of CaV2.3 Channels
J. Biol. Chem., January 7, 2005; 280(1): 494 - 505.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
D. Lipscombe, T. D. Helton, and W. Xu
L-Type Calcium Channels: The Low Down
J Neurophysiol, November 1, 2004; 92(5): 2633 - 2641.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
S. J. Tavalin, D. Shepherd, R. K. Cloues, S. E. H. Bowden, and N. V. Marrion
Modulation of Single Channels Underlying Hippocampal L-Type Current Enhancement by Agonists Depends on the Permeant Ion
J Neurophysiol, August 1, 2004; 92(2): 824 - 837.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
G. Liu, N. Hilliard, and G. H. Hockerman
Cav1.3 Is Preferentially Coupled to Glucose-Induced [Ca2+]i Oscillations in the Pancreatic {beta} Cell Line INS-1
Mol. Pharmacol., May 1, 2004; 65(5): 1269 - 1277.
[Abstract] [Full Text]


Home page
J. Physiol.Home page
M. Michna, M. Knirsch, J.-C. Hoda, S. Muenkner, P. Langer, J. Platzer, J. Striessnig, and J. Engel
Cav 1.3 ({alpha}1D) Ca2+ currents in neonatal outer hair cells of mice
J. Physiol., December 15, 2003; 553(3): 747 - 758.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
A. C. Dolphin
G Protein Modulation of Voltage-Gated Calcium Channels
Pharmacol. Rev., December 1, 2003; 55(4): 607 - 627.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
H. Bao, W. H. Wong, J. M. Goldberg, and R. A. Eatock
Voltage-Gated Calcium Channel Currents in Type I and Type II Hair Cells Isolated From the Rat Crista
J Neurophysiol, July 1, 2003; 90(1): 155 - 164.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
J. Vigh, E. Solessio, C. W. Morgans, and E. M. Lasater
Ionic Mechanisms Mediating Oscillatory Membrane Potentials in Wide-Field Retinal Amacrine Cells
J Neurophysiol, July 1, 2003; 90(1): 431 - 443.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
P. Tosetti, V. Parente, V. Taglietti, K. Dunlap, and M. Toselli
Chick RGS2L demonstrates concentration-dependent selectivity for pertussis toxin-sensitive and -insensitive pathways that inhibit L-type Ca2+ channels
J. Physiol., May 15, 2003; 549(1): 157 - 169.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. Liu, N. Dilmac, N. Hilliard, and G. H. Hockerman
Cav1.3 Is Preferentially Coupled to Glucose-Stimulated Insulin Secretion in the Pancreatic beta -Cell Line INS-1
J. Pharmacol. Exp. Ther., April 1, 2003; 305(1): 271 - 278.
[Abstract] [Full Text]


Home page
J. Neurophysiol.Home page
H. Song, L. Nie, A. Rodriguez-Contreras, Z.-H. Sheng, and E. N. Yamoah
Functional Interaction of Auxiliary Subunits and Synaptic Proteins With CaV1.3 May Impart Hair Cell Ca2+ Current Properties
J Neurophysiol, February 1, 2003; 89(2): 1143 - 1149.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. Banihashemi and P. R. Albert
Dopamine-D2S Receptor Inhibition of Calcium Influx, Adenylyl Cyclase, and Mitogen-Activated Protein Kinase in Pituitary Cells: Distinct G{alpha} and G{beta}{gamma} Requirements
Mol. Endocrinol., October 1, 2002; 16(10): 2393 - 2404.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
V. Carabelli, M. D'Ascenzo, E. Carbone, and C. Grassi
Nitric oxide inhibits neuroendocrine CaV1 L-channel gating via cGMP-dependent protein kinase in cell-attached patches of bovine chromaffin cells
J. Physiol., June 1, 2002; 541(2): 351 - 366.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z. Zhang, Y. Xu, H. Song, J. Rodriguez, D. Tuteja, Y. Namkung, H.-S. Shin, and N. Chiamvimonvat
Functional Roles of Cav1.3 ({alpha}1D) Calcium Channel in Sinoatrial Nodes: Insight Gained Using Gene-Targeted Null Mutant Mice
Circ. Res., May 17, 2002; 90(9): 981 - 987.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. Raghib, F. Bertaso, A. Davies, K. M. Page, A. Meir, Y. Bogdanov, and A. C. Dolphin
Dominant-Negative Synthesis Suppression of Voltage-Gated Calcium Channel Cav2.2 Induced by Truncated Constructs
J. Neurosci., November 1, 2001; 21(21): 8495 - 8504.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Safa, J. Boulter, and T. G. Hales
Functional Properties of CaV1.3 (alpha 1D) L-type Ca2+ Channel Splice Variants Expressed by Rat Brain and Neuroendocrine GH3 Cells
J. Biol. Chem., October 12, 2001; 276(42): 38727 - 38737.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
W. Xu and D. Lipscombe
Neuronal CaV1.3{alpha}1 L-Type Channels Activate at Relatively Hyperpolarized Membrane Potentials and Are Incompletely Inhibited by Dihydropyridines
J. Neurosci., August 15, 2001; 21(16): 5944 - 5951.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Scholze, T. D. Plant, A. C. Dolphin, and B. Nurnberg
Functional Expression and Characterization of a Voltage-Gated CaV1.3 ({{alpha}}1D) Calcium Channel Subunit from an Insulin-Secreting Cell Line
Mol. Endocrinol., July 1, 2001; 15(7): 1211 - 1221.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Koschak, D. Reimer, I. Huber, M. Grabner, H. Glossmann, J. Engel, and J. Striessnig
alpha 1D (Cav1.3) Subunits Can Form L-type Ca2+ Channels Activating at Negative Voltages
J. Biol. Chem., June 15, 2001; 276(25): 22100 - 22106.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (68)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bell, D. C.
Right arrow Articles by Dolphin, A. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bell, D. C.
Right arrow Articles by Dolphin, A. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online