|
|
||||||||
The Journal of Neurophysiology Vol. 85 No. 2 February 2001, pp. 816-827
Copyright ©2001 by the American Physiological Society
1D, CaV1.3)
Voltage-Dependent Calcium Currents
1Department of Pharmacology, University College London, London WC1E 6BT, United Kingdom; 2Merck Research Laboratories, La Jolla, California 92307; 3Abteilung Pharmakologie und Toxikologie, Universität Ulm and Institut für Pharmakologie, Freie Universität, D-14195 Berlin, Germany; and 4Merck, Sharp and Dohme, Neuroscience Research Centre, Harlow CM20 2QR, United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
Bell, D. C.,
A.
J. Butcher,
N. S. Berrow,
K. M. Page,
P. F. Brust,
A. Nesterova,
K. A. Stauderman,
G. R. Seabrook,
B. Nürnberg, and
A. C. Dolphin.
Biophysical Properties, Pharmacology, and Modulation of
Human, Neuronal L-Type (
1D, CaV1.3)
Voltage-Dependent Calcium Currents.
J. Neurophysiol. 85: 816-827, 2001.
Voltage-dependent calcium channels
(VDCCs) are multimeric complexes composed of a pore-forming
1 subunit together with several accessory
subunits, including
2
,
, and, in some
cases,
subunits. A family of VDCCs known as the L-type channels are
formed specifically from
1S (skeletal muscle),
1C (in heart and brain),
1D (mainly in brain, heart, and endocrine
tissue), and
1F (retina). Neuroendocrine L-type currents have a significant role in the control of
neurosecretion and can be inhibited by GTP-binding (G-) proteins.
However, the subunit composition of the VDCCs underlying these
G-protein-regulated neuroendocrine L-type currents is unknown. To
investigate the biophysical and pharmacological properties and role of
G-protein modulation of
1D calcium channels,
we have examined calcium channel currents formed by the human neuronal
L-type
1D subunit, co-expressed with
2
-1 and
3a, stably
expressed in a human embryonic kidney (HEK) 293 cell line, using whole
cell and perforated patch-clamp techniques. The
1D-expressing cell line exhibited L-type
currents with typical characteristics. The currents were high-voltage
activated (peak at +20 mV in 20 mM Ba2+) and
showed little inactivation in external Ba2+,
while displaying rapid inactivation kinetics in external
Ca2+. The L-type currents were inhibited by the
1,4 dihydropyridine (DHP) antagonists nifedipine and nicardipine and
were enhanced by the DHP agonist BayK S-(
)8644. However,
1D L-type currents were not modulated by
activation of a number of G-protein pathways. Activation of endogenous
somatostatin receptor subtype 2 (sst2) by somatostatin-14 or activation
of transiently transfected rat D2 dopamine receptors
(rD2long) by quinpirole had no effect. Direct activation of G-proteins by the nonhydrolyzable GTP analogue, guanosine
5'-0-(3-thiotriphospate) also had no effect on the
1D currents. In contrast, in the same system,
N-type currents, formed from transiently transfected
1B/
2
-1/
3,
showed strong G-protein-mediated inhibition. Furthermore, the I-II
loop from the
1D clone, expressed as a
glutathione-S-transferase (GST) fusion protein, did not bind G
, unlike the
1B I-II loop fusion
protein. These data show that the biophysical and pharmacological
properties of recombinant human
1D L-type
currents are similar to
1C currents, and
these currents are also resistant to modulation by
Gi/o-linked G-protein-coupled receptors.
| |
INTRODUCTION |
|---|
|
|
|---|
The L-type voltage-dependent calcium channels (VDCCs) are formed
by one of four possible pore forming
1
subunits:
1S (found in skeletal muscle)
(Tanabe et al. 1987
),
1C
(mainly cardiac) (Mikami et al. 1989
),
1D (in neurons and neurosecretory cells and
heart) (Seino et al. 1992
; Williams et al.
1992
; Wyatt et al. 1997
; Yaney et
al. 1992
), or
1F (retinal, not yet
functionally expressed) (Strom et al. 1998
). The VDCC
family nomenclature was recently revised by Ertel et al.
(2000)
:
1S,
1C,
1D, and
1F were renamed CaV1.1,
CaV1.2, CaV1.3, and
CaV1.4, respectively. The
1 subunits are co-assembled with the accessory
subunits
,
2
(and
1 in skeletal muscle). L-type currents have
been defined pharmacologically by their sensitivity to low (nM to µM)
concentrations of 1,4-dihydropyridine (DHP) antagonists (e.g.,
nifedipine and nicardipine) and agonists [e.g., S-(
)BayK8644]
(Sanguinetti and Kass 1984
). In addition, L-type
channels exhibit the following biophysical characteristics:
"long-lasting" currents that show little inactivation in
Ba2+ (Nowycky et al. 1985
); some
selectivity for Ba2+ over
Ca2+ and Ca2+-dependent
inactivation (Soldatov et al. 1997
).
GTP-binding (G-) proteins exist as heterotrimeric complexes, composed
of a G
subunit and a G
dimer. On activation of a G-protein-coupled receptor (GPCR), the heterotrimer dissociates into
free G
-GTP and G
dimers. It is these free G
subunits that are thought to be responsible for fast, membrane delimited, voltage-dependent G-protein inhibition of certain neuronal VDCCs, including
1A,
1B, and
1E (Herlitze et al. 1996
;
Ikeda 1996
; Page et al. 1998
; for a
review see Dolphin 1998
). VDCCs undergoing voltage-dependent G-protein modulation display the following
characteristics: a decrease in whole cell current, depolarizing shift
in the current-voltage (I-V) relationship, and slowed
activation kinetics (Bean 1989
). Another characteristic
is the loss of G-protein modulation at large depolarizations
(Bean 1989
); consequently a large depolarizing prepulse
immediately before a test pulse transiently removes inhibition, and the
activation kinetics become faster, a phenomenon termed prepulse
facilitation (Bean 1989
; Elmslie et al.
1990
).
Native cardiac L-type channels have long been known to exhibit
G-protein-induced stimulation via G
S and a
cAMP-dependent protein kinase pathway (Reuter 1983
).
Recently stimulation of smooth muscle L-type currents by G
has
also been reported via a phosphinositide 3 kinase pathway (Viard
et al. 1999
). Inhibition via activation of
G
i/o, and subsequent inhibition of adenylyl cyclase, is another G-protein modulatory path that regulates cardiac L-type channels (Fischmeister and Hartzell 1986
). In
native endocrine and neurosecretory cells and cell lines, G-protein
inhibition of L-type currents has also been observed (Degtiar et
al. 1997
; Gilon et al. 1997
; Haws et al.
1993
; Hernandez-Guijo et al. 1999
; Kleuss
et al. 1991
; Mathie et al. 1992
; Tallent
et al. 1996
). This is thought to be involved in the inhibitory
modulation of secretion. However, the subtype(s) of VDCC
1 subunit(s) involved and type of G-protein
modulation observed for these L-type currents have not been fully
defined (see Dolphin 1999
, for review). In neuronal and
neurosecretory tissue, L-type currents are formed from
1D as well as
1C
subunits (Chin et al. 1992
).
1D
has also been shown to be expressed in heart (Hell et al.
1993
; Wyatt et al. 1997
). The consensus of
current research suggests that L-type currents resulting from
expression of neuronal (Bourinet et al. 1996
;
Canti et al. 1999
) or cardiac (Meza and Adams
1998
)
1C isoforms do not exhibit the
voltage-dependent G-protein inhibition that is typical of N or P/Q
currents. Nevertheless, in experiments where cloned
1C has been co-expressed with accessory
subunits in Xenopus laevis oocytes (Oz et al.
1998
) and HEK 293 cells (Dai et al. 1999
;
Kamp et al. 2000
), other forms of facilitation and second-messenger-based inhibition have been observed.
The existence of G-protein modulation of cloned
1D L-type VDCCs has not yet been examined.
Here we have used a stable HEK 293 cell line expressing the human
1D subunit, together with the human accessory
subunits
2
-1 and
3a, to establish the biophysical and
pharmacological properties of the expressed current and whether the
resultant current shows G-protein modulation.
| |
METHODS |
|---|
|
|
|---|
Materials
The following compounds were stored at
20°C (stock
concentration in mM unless stated, solvent, and source): nifedipine,
NIF (3, ethanol, Sigma, St. Louis, MO); nicardipine, NIC (3, ethanol, Sigma); BayK S-(
)8644, BayK (3, ethanol, RBI, Natwick, MA);
somatostatin-14, SST (0.1, deoxygenated double-distilled water, RBI,
Natwick, MA); quinpirole, Quin (10, double-distilled water, RBI);
forskolin (10, dimethyl sulfoxide, Sigma); geneticin G-418 sulfate (100 mg/ml, double-distilled water, Life Technologies, Paisley, Scotland); Zeocin (100 mg/ml, supplied in solution form, Invitrogen, Carlsbad, CA); and amphotericin-B (80 mg/ml, dimethyl sulfoxide, Sigma).
The following cDNAs were used in transient transfections: rabbit
1B (GenBank accession number D14157), rat
1E (rbEII, L15453), rat
1E
long (see below for details), rat
1b (Tomlinson et al. 1993
), rat
3 (M88571), rat
2
-1 (neuronal splice variant, M86621), rat
D2long receptor (rD2long,
X17458, N5
G), and mut-3 green fluorescent protein (GFP, U73901).
All cDNAs were subcloned into the expression vector pRK5 except for the clones used in the
1E long transient
transfection study, which were subcloned into the expression vector
pMT2 (Genetic Institute, Cambridge, MA) (see Swick et al.
1992
). The rat
1E
(rbEII, L15453) clone has a truncated N-terminus, compared with other
1E clones. Page et al. (1998)
extended
this clone using a rat
1E N-terminal extension
(AF057029). The resulting rat
1E
long clone used in this study has homology to
published mouse (L29346), human (L27745), and rabbit (X67855)
1E clones. The
1b
subunit used in this study is that of Tomlinson et al.
(1993)
. It is identical to the rat
1b
clone defined in the GenBank database (X61394) except for two
substitutions (R417
S and V435
A) and the deletion A431
(T. P. Snutch, personal communication).
1D Stable cell line (HEK 293
1D)
Standard techniques were used to transfect HEK 293 stably with
human neuronal
1D (M76558),
2b
-1
(M76559) and
3a (not published); for clarity this cell
line (#5D12-20) will subsequently be referred to as HEK 293
1D. The cloning of these VDCC subunits is
discussed in Williams et al. (1992)
. The clonal
1D cell line was established by transfecting
HEK293 cells using a standard Ca2+ phosphate
procedure (Brust et al. 1993
) with 10, 5, and 5 µg of
the
1D,
2b
-1, and
3a expression constructs, respectively. The
1D subunit expression plasmid,
pcDNA1
1DRBS, does not contain an antibiotic
resistance gene, whereas the
2b
-1 and
3a subunit expression plasmids,
pRc/CMV
2b
-1 and
pZeoCMV
3a, contain the neomycin and Zeocin
resistance genes, respectively. Geneticin G-418 sulfate (final
concentration 100 µg/ml, Life Technologies) and Zeocin (final
concentration 40 µg/ml, Invitrogen) were used for selection of
colonies. The selection medium was added to the cells 48 h after
transfection. Antibiotic-resistant colonies were transferred to 96-well
plates using cloning cylinders, 2-4 wk after selection was initiated.
Cell lines containing functional channels were selected with a
fluo3-based calcium flux assay.
Cell culture and transfection
The culture medium in which the HEK 293
1D and control HEK 293 cells were grown
consisted of Dulbecco's modified Eagle's medium (DMEM) with 4.5-g
glucose · l
1
(DMEM, Life Technologies). This was supplemented with 5% bovine calf
serum (Hyclone, UT), penicillin (100 IU · ml
1) and streptomycin
(100 µg · ml
1;
Life Technologies) and the additional selection antibiotics for the HEK
293
1D cell line (as described above). The
cells were grown in this medium at 37°C, 5%
CO2, and passaged every 2-3 days.
For transient transfection of the
1B,
2
-1,
3a VDCC
subunits and mut-3 GFP expression marker into HEK 293 cells, a mixture was made containing, respectively, 15, 5, 5, and 1 µl of the cDNAs (at a concentration of 1 µg/µl). In experiments where the
rD2long was used, 5 µg of this cDNA was added;
in experiments where this D2 receptor pathway was not investigated, 5 µg of blank pRK5 vector was used to give a final cDNA amount of 31 µg. The same amounts were used for the transfection of
1E,
2
-1,
1b, and mut-3 GFP (using 5 µg of blank pMT2
to make the mixture up to a final amount of 31 µg). For transfection,
10 µl of Geneporter reagent (Genetic Therapy Systems, San Diego, CA)
and 2 µl of the cDNA mix were added to each 1 ml of DMEM (no
supplements) and incubated at 20°C for 1 h before addition of 1 ml to each 35-mm-diam culture dish containing approximately 2 × 106 cells. Transfected cells were then grown at
37°C for 36 h and subsequently at 28°C for 36 h. This
process of 37°C/28°C incubation was also the standard procedure for
the stable
1D cell line before electrophysiological experiments. In experiments on the HEK 293
1D cells where additional transient
transfection of rD2long expression was required,
the cDNA mix was formed of rD2long (5 µg) and
mut-3 GFP (1 µg) cDNA, and made up to 31 µg with blank pRK5, with
the transfection procedure being as described above (for
1B and
1E). Successful transfection was determined by expression of mut3-GFP.
Electrophysiology
The internal (pipette) and external solutions and recording
techniques were similar to those previously described (Campbell et al. 1995
). For whole cell patch-clamp recordings, the patch pipette solution contained (in mM) 140 Cs-aspartate, 5 EGTA, 2 MgCl2, 0.1 CaCl2, 2 K2ATP, 0.8 TrisGTP, 10 HEPES; pH 7.2, 310 mOsm
with sucrose. In experiments where guanosine 5'-0-(3-thiotriphospate) (GTP-
S) and guanosine 5'-0-(2-thiodiphospate) (GDP-
S) were used, the GTP was replaced with either 100 µM GTP-
S (Sigma) or 2 mM GDP-
S (Boehringer, Mannheim, Germany). For perforated-patch clamp recordings the patch pipette solution contained (in mM) 100 CH3O3SCs, 25 CsCl, 3 MgCl2, 40 HEPES; pH 7. 3, and freshly
supplemented (within 1 h of recording) with 240 µg/ml
amphotericin-B. The external solution contained (in mM) 160 tetraethylammonium (TEA) bromide, 3 KCl, 1.0 NaHCO3, 1.0 MgCl2, 10 HEPES, 4 glucose, 10 or 20 BaCl2 or
CaCl2; pH 7. 4, 320 mOsm with sucrose. The
perfusion rate was 1-2 ml/min. Pipettes of resistance 2-5 M
were
used. An Axon 200A or an Axopatch 1D amplifier (Axon
Instruments, Foster City, CA) was used, and data were filtered
at 1 kHz and digitized at 5-10 kHz using a Digidata 1200 interface
(Axon Instruments). Membrane capacitance measurements were recorded
from the amplifier following capacitance compensation. Analysis was
performed using pClamp 6.02 (Axon Instruments) and Origin 5 (Microcal Software, Northampton, MA). Current records
are shown following leak and residual capacitance current subtraction
(P/4 or P/5 protocol). Data are expressed as means ± SE.
Statistical analysis was performed using paired or unpaired Student's
t-test, as appropriate, where significance was defined as
P < 0. 05 (*) and P < 0. 01 (**).
Where indicated, I-V relations were fitted with a combined
Boltzmann and linear fit
|
(1) |
1,
V50,act is the mid-point of voltage
dependence of activation, Vrev is the
reversal potential, and k is the slope factor.
Steady-state inactivation data were fitted with a Boltzmann function of
the form
|
(2) |
The holding potential was
80 mV, unless otherwise stated. Voltages
were not corrected for liquid junction potential, measured using the
method described in Neher (1995)
, which were up to
2.7 mV in whole cell recording solutions and
5.4 mV in perforated-patch solutions.
Construction, expression, and purification of proteins
The polymerase chain reaction (PCR) was used to amplify (from
full length clones) regions of cDNA encoding the calcium channel I-II
loops of the rabbit
1B and human
1D clones (M76558). As the full length clone
of the human
1D was unavailable for PCR, it
was necessary to perform RT-PCR from the HEK 293
1D cell line. Approximately
105 HEK 293
1D cells
were lysed using the QiaShredder and the total RNA extracted using the
Qiagen RNEasy kit (Qiagen, Crawley, UK). After a further
phenol/chloroform extraction and precipitation the total RNA was
reverse transcribed using MMLV-Reverse Transcriptase (Life
Technologies, Paisley, Scotland) and random hexamer primers (Promega,
Southampton, UK). PCR was performed using either Pfu (Promega) or Pfx (Life Technologies) high-fidelity DNA
polymerase in the supplied polymerase buffers. BamHI and
EcoRI restriction sites (underlined) for directional,
in-frame cloning of the resulting fragments into pGEX2T (Pharmacia, St.
Albans, UK) were present in the primer sets as follows:
1B Forward:
5'CTCAGGATCCTTTGCTAAGGAGCG3'
Reverse: 5'AGAAGAATTCTGCCTTCACCATGC3'
1D Forward:
5'GTGGATCCTTCTCAAAGGAAAGAG3'
Reverse: 5'AGGAATTCGTGACAGACTTCAC3'
Amplification was for 30 cycles before the resulting products were
separated by agarose gel electrophoresis, digested with BamHI and EcoRI and subcloned into pGEX2T
(Pharmacia). The resulting constructs are
GST
1BI-II loop and
GST
1DI-II loop, respectively. The sequences
of all the fusion protein constructs were verified by cycle sequencing
(Sequitherm, Epicentre laboratories, Madison, WI) or automated
sequencing, before use in protein expression studies.
Expression cultures of BL21(DE3)-Codon Plus-(RIL) Escherichia
coli (Stratagene, Amsterdam, NL) were grown overnight at 37°C in
LB medium supplemented with 34 µg/ml chloramphenicol, 50 µg/ml ampicillin, and 1% (wt/vol) glucose. The saturated cultures were diluted 10-fold in the same medium and grown for a further 2.5 h.
before cooling to 25°C and induction with 0.1 mM
isopropyl-thio-galactopyranoside. Induced cultures were grown at 25°C
for a further 2.5 h before harvesting. All further purification
steps were performed at 4°C. Cells were lysed by sonication in
phosphate-buffered saline, pH 7.4 (PBS: 10 mM phosphate buffer, pH 7.4, 137 mM NaCl, 2.7 mM KCl) containing 1% sarcosyl, 25 mM EDTA, 0.5 mM
dithiothreitol, and protease inhibitors (1 tablet per 50 ml of lysate,
Complete EDTA-free, Roche Diagnostics, Lewes, UK) followed by a 10-min incubation at 4°C. TritonX-100 was then added to a final
concentration of 2% and the lysate re-sonicated and incubated at 4°C
for a further 10 min. before centrifugation at 20,000 × g for 15 min at 4°C. The resulting supernatant was then
applied to a 1-ml GSTrap column (Pharmacia) and the column washed with
10 column volumes of binding buffer (PBS, pH 7.4 containing 0.1%
Triton X100, 20 mM EDTA, 0.5 mM dithiothreitol and 1 protease inhibitor
tablet per 200 ml). Bound GST-fusion proteins were then eluted from the
column with elution buffer (binding buffer, at pH 8.0, supplemented
with 5 mM reduced glutathione). Glutathione was removed from the fusion protein preparations by dialysis against HBS-EP buffer [10 mM HEPES,
pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.005% (vol/vol) Tween 20] before
samples were frozen in aliquots at
20°C.
Bovine brain G-proteins were purified to apparent homogeneity using
conventional chromatographic techniques. G
dimers were then
liberated from G
subunits in the presence of aluminum fluoride (Exner et al. 1999
). Isolation and final purification of
G
was achieved using a Mono Q FPLC column (Pharmacia). G
subunits were identified by their immunoreactivity and stored in
aliquots at
80°C until required for use.
A full-length
1b with C-terminal
hexa-histidine tag (H6C
1b) was produced by PCR
(10 cycles) using Pfu polymerase (Stratagene, Amsterdam),
1b in pMT2 as template and the following
primers:
Forward: 5'GGGAATTCATGGTCCAGAAGAGCG3'
Reverse: 5' GGGAATTCTCAATGATGATGATGATGATGGCGGATCTACACG 3'
The resulting PCR product (approximately 1.9k.b.) was digested with
EcoRI and subcloned into the pKK233-3 vector (Amersham Pharmacia, Little Chalfont, UK). To maximize yields of the full-length H6C
1b protein the 600b.p. 3'
NcoI-EcoRI fragment of
H6C
1b and the 1.3k.b.
5'NcoI-NcoI fragment of
1b were subcloned into
NcoI-EcoRI digested pET28b (Novagen, Nottingham,
UK) to give H6C
1b-pET28b. BL21(DE3)-Codon
Plus-(IRL) Escherichia coli (Stratagene) were transformed
with H6C
1b-pET28b, and cultures were grown
overnight to saturation at 37°C in LB (pH 5.5) supplemented with
kanamycin (30 µg/ml), chloramphenicol (34 µg/ml) and 1% wt/vol
glucose, diluted 1:10 with the same media and grown for a further
3 h before cooling to room temperature and induction with 0.5 mM
isopropylthio-
-D-galactoside (IPTG). The cultures were grown
for 3 h postinduction at room temperature then harvested
by centrifugation, pellets were stored at
70°C until required.
Escherichia coli pellets containing expressed
H6C
1b protein were lysed at 4°C by
sonication in 20 mM phosphate buffer (pH 7.4), containing 1 protease
inhibitor tablet per liter of culture pelleted. Solid NaCl was added to
the lysate to a final concentration of 1 M before the lysate was
cleared at 20,000 × g at 4°C for 15 min. Imidazole
solution (pH 7.4) was then added to the resulting supernatant to give a
final concentration of 40 mM before loading onto a nickel-primed 5 ml
HiTrap Chelating column (Amersham Pharmacia) equilibrated with loading
buffer (20 mM phosphate buffer, pH 7.4, 1 M NaCl, 40 mM Imidazole,
0.15% wt/vol octylglucoside and 1 protease inhibitor tablet per 100 ml). The column was washed thoroughly with wash buffer (as load buffer
but 70 mM imidazole) before H6C
1b was eluted
from the column in elution buffer (as load buffer but 200 mM imidazole).
Peak UV280 absorbance fractions were rapidly
buffer exchanged on a Sephadex G-25 (Amersham Pharmacia) column into
IEX buffer (20 mM 2-[N-morpholino]ethanesulfonic acid, pH
6.0, 1 protease inhibitor tablet per 200 ml) supplemented with 500 mM
NaCl, before dilution 1:10 with IEX buffer. The diluted sample was
loaded onto a 1 ml SP-Sepahrose HP column (Amersham Pharmacia), the
column was washed with IEX buffer before H6C
1b
proteins were eluted in a linear gradient of 0 to 1 M NaCl in IEX
buffer. Fractions containing H6C
1b were
identified by SDS-PAGE analysis, with Coomassie blue staining, before
dialysis against storage buffer (20 mM borate, pH 8.0, 500 mM NaCl, 1 mM EDTA, 1 protease inhibitor tablet per 200 ml).
H6C
1b prepared in this manner was found to
have a half-life in excess of 60 days at 4°C as judged by SDS-PAGE
and Coomassie blue staining.
Surface plasmon resonance binding assay
All assays were performed on a Biacore 2000 (Biacore AB,
Uppsala, Sweden) at 25°C in HBS-EP buffer (10 mM HEPES, pH 7.4; 150 mM NaCl, 3 mM EDTA, 0.005% vol/vol polysorbate 20) unless stated otherwise. Glutathione S-transferase (GST) fusion proteins
were immobilized on CM5 dextran chips using an anti-GST monoclonal antibody kit according to the manufacturer's instructions (Biacore AB). To obtain identical molar loadings of the different molecular mass
fusion proteins, the following resonance unit (RU) correction factors
were used during immobilization (GST = 1, GST
1DI-II loop = 1.52, GST
1BI-II loop = 1.57). G
dimers
were diluted in HBS-EP buffer before use, and G
injections were
performed using a flow rate of 50 µl/min for 5 min. Experiments using
H6C
1b were performed in modified HBS-EP buffer
containing 500 mM NaCl, with the same flow rate and injection time used
for the G
experiments.
| |
RESULTS |
|---|
|
|
|---|
1D Sensitivity to DHPs
From electrophysiological recording of the HEK 293
1D
(
1D/
2
-1/
3a)
cell line, 43% of cells were found to express calcium channel
currents, and for those currents that were stable, the mean current
density was
10 ± 2.1 pA/pF (mean ± SE, n = 21) in 20 mM Ba2+ at a test potential of +10 mV
(and approximately half this value when recorded in 10 mM
Ba2+). As expected, the
1D currents displayed sensitivity to DHP antagonists. The effects of 3 and 10 µM nifedipine are shown in the
time course in Fig. 1A, and
the percentage inhibition of IBa by 3 µM nifedipine and nicardipine is shown in the bar chart in Fig.
1B. The 1,4-DHP antagonist block was also characterized by an increase in the inactivation kinetics of
IBa during the test depolarization
(+10 mV, Vt), which can be observed by
comparing the inhibition at peak compared with the end of the 200-ms
test pulse (
and
, respectively, in Fig. 1A, and
and
in Fig. 1B). However,
1D
IBa showed very similar inhibition by
nifedipine at three different holding potentials
(Vh =
80,
50, and
30 mV). At
Vh =
50 mV, 3 µM nifedipine
inhibited
1D
IBa by 62 ± 7% (at peak) and
94 ± 3% (at the end of 200 ms pulse, n = 5); at
Vh =
30 mV the inhibition was
similar, being 56 ± 7% (at peak) and 91 ± 3% (at 200 ms,
n = 6).
|
The agonist BayK S-(
)8644 (3 µM) produced a marked enhancement of
the current (325 ± 25% increase, n = 5, at
Vt = +10 mV in 10 mM
Ba2+; 680 ± 84% increase,
n = 14, at Vt = +10 mV
in 20 mM Ba2+; Fig. 1C). The onset of
enhancement was rapid (reaching steady-state enhancement within 1-2
min of application, Fig. 1C) and was accompanied by a
characteristic hyperpolarizing shift in the I-V relationship (Fig. 1D). In some recordings BayK S-(
)8644 enhanced
1D currents also displayed the characteristic
slowing of tail current deactivation (for an example, see the enhanced
current trace in Fig. 6B).
Biophysical characteristics of the
1D current
The activation and steady-state inactivation of
1D currents are shown in Fig.
2A. Fitting the current
activation gave a V50,act of
+1.8 ± 1.2 mV. Examining the steady-state inactivation properties of the
1D currents showed that at test
potentials up to +30 mV the
1D currents did
not fully inactivate and had a relatively depolarized
V50,inact of
13. 4 ± 1.8 mV
(n = 6). The inactivation kinetics at
Vt = +10 mV were very slow in
Ba2+ (see examples of control traces in Fig. 1,
A, C, and D). Single exponentials were
fitted to the inactivating phase during long (1,200-1,600 ms)
depolarizing steps, (e.g., the white line in the example trace shown in
Fig. 2B). The
inact was 439 ± 50 ms (n = 4). The inactivation kinetics with external
Ca2+ rather than Ba2+ were
far more rapid, shown by the overlaid example traces in Fig.
2C. Almost complete inactivation was observed during a
200-ms depolarizing pulse in Ca2+
(
inact = 44.3 ± 1.1 ms,
n = 7). Additionally, the peak current in 20 mM
Ca2+ was smaller than in 20 mM
Ba2+
(ICa was ~20% of
IBa). The mean
I-V relationship in 20 mM Ba2+
and 20 mM Ca2+ exemplifies these differences
(Fig. 2D).
|
1D Currents do not show G-protein-mediated
inhibition
Having established some basic biophysical and pharmacological
properties of
1D currents, we then examined
whether these currents displayed G-protein modulation. Initially the
modulation of the
1D currents was compared
with that of
1B currents (known to be
G-protein modulated), transiently expressed in HEK 293 cells, by
activating the endogenous somatostatin receptor subtype 2 (sst2). Application of somatostatin (SST, 100-500 nM, n = 8)
had no effect on the
1D current (Fig.
3A). Using the same endogenous
receptor-based signaling pathway, application of SST (500 nM) caused a
rapid inhibition of
1B currents, observed in
all cells tested (see Fig. 3B; mean inhibition, 40 ± 7%, n = 8).
|
Due to the nature of whole cell patch clamping, the internal contents
of the cell can be disrupted, resulting in loss of normal signaling
pathways within the cell. Such "wash out" effects can be minimized
by using the perforated-patch clamp technique (Horn and Marty
1988
). To ensure that the loss of G-protein modulation was not
due to such wash out, amphotericin-B perforated patches were also used;
however, no modulation of
1D currents by SST was observed at any test potential (n = 5, Fig.
3C). I-V relationship pulse protocols were
performed during control, SST perfusion and wash conditions in a
perforated patch-clamp recording (example traces from these
I-V relationships are shown at the bottom of Fig.
3C). The results exemplify the lack of effect of SST with almost identical values for V50,act
(CTRL =
6.1 mV; SST =
6.6 mV; WASH =
5.7 mV) and
k (CTRL = 8.6 mV; SST = 8.2 mV; WASH = 8.4 mV).
To examine another G-protein-coupled receptor pathway, the
rD2long receptor was transiently co-expressed
with GFP as an expression marker in the
1D
cell line and was also transiently co-expressed with
1B/
2
-1/
3
in HEK293 cells. However, application of the D2 agonist quinpirole (300 nM), had no effect on
1D currents (n = 7, Fig.
4A), although a clear
inhibitory effect was observed in 10/16 of the
1B/
2
-1/
3
expressing cells (with a mean inhibition of 59 ± 7%,
n = 10; Fig. 4B). This inhibition was
greater than that produced by activation of the endogenous sst2
receptor, suggesting more efficient activation of this G-protein
pathway by D2 receptors, but despite this, no inhibition of
1D currents was observed (Fig. 4C).
|
The GTP analogue GTP-
S can be used as a more direct way of
activating G-proteins since it is nonhydrolyzable and leads to their
sustained activation. Conversely, the GDP analogue GDP-
S can be used
to block G-protein activation. Using these guanine nucleotide
analogues, the existence of tonic modulation was examined with a
prepulse (PP) protocol. Figure
5A depicts the ratio of current in the absence (no PP) or immediately following (+PP) a large
depolarizing prepulse (+PP/no PP ratio) for control (CTRL, gray columns
and associated example traces), with 100 µM GTP-
S (black columns
and associated example traces) and with 2 mM GDP-
S intracellularly
(white columns and associated example traces). It can be seen in both
the histogram and also in the example traces relating to these +PP/no
PP ratios (Fig. 5A), that there was a small degree of
facilitation (+PP/no PP ratio >1) in all of the intracellular
conditions. Furthermore, the activation time to 90% peak (ttp 90%)
was shorter for all +PP than no PP currents (Fig. 5B).
However, the magnitude of prepulse facilitation, and the activation ttp
90%, were unaltered by inclusion of GTP-
S or GDP-
S.
|
In comparison, in recordings made from cells transfected with
1B channels, there was no evidence of prepulse
facilitation of
1B currents using control
intracellular pipette solution. However, following direct activation of
G-proteins with GTP-
S (Fig. 5C), there was a marked
facilitation of the +PP current compared with the no PP current. Under
these recording conditions, the ttp 90% was also greater in the no PP
current than in the current preceded by a prepulse, whereas in control
conditions this was not apparent (Fig. 5D).
G-protein modulation of calcium currents can be also identified by a
decrease in the current amplitude and a depolarizing shift of the
I-V relationship with intracellular GTP-
S, while opposite
effects (increase in current density and hyperpolarizing shift of the
I-V relationship) are seen with GDP-
S (due to removal of
tonic G-protein modulation). However, in the HEK 293
1D cell line no difference was observed in the
I-V relationships across the G-protein activating conditions
(control, n = 21; +GTP-
S, n = 23;
+GDP-
S, n = 17; data not shown).
1D Currents are also resistant to G-protein
modulation in the presence of a 1,4-DHP agonist
In a recent study by Hernandez-Guijo et al. (1999)
,
a form of voltage-independent G-protein modulation was observed of rat chromaffin cell L-type currents. Inhibition was observed during perfusion of a cocktail of BayK S-(
)8644, by a combination of a
number of receptor agonists including ATP, opioids with or without the
additional inclusion of catecholamines. In Fig.
6, we investigated whether there was any
G-protein modulation of the
1D currents during
BayK S-(
)8644 perfusion. The
1D expressing
cells were also transiently transfected with
rD2long receptors, and after enhancement of the
1D current by BayK S-(
)8644 (3 µM), a
cocktail of BayK S-(
)8644 (3 µM), SST (500 nM), and quinpirole (300 nM) was applied. No effect was observed of this cocktail of drugs (n = 5, Figs. 6, A and B).
|
Selectivity of 1,4-DHP antagonists for L-type currents
Despite the lack of G-protein modulation of expressed
1D channel currents in HEK 293 cells, several
reports showing the modulation of 1,4-DHP-sensitive currents in
neuroendocrine cells have appeared (Degtiar et al. 1997
;
Gilon et al. 1997
; Haws et al. 1993
;
Hernandez-Guijo et al. 1999
; Kleuss et al.
1991
; Tallent et al. 1996
). One possible explanation is that 1,4-DHPs may be blocking non-L-type currents, and
it is these currents that exhibit the G-protein modulation. Previous
research has shown that the selectivity of DHP antagonists for L-type
channels may not be as absolute as previously thought (Diochot
et al. 1995
; Furukawa et al. 1999
). To further
examine this possibility of
1E channels
providing a G-protein-modulated, 1,4-DHP-sensitive current, we
investigated currents resulting from transient expression of
1E
long/
2
-1/
1b.
It was observed that these
1E currents were
inhibited by both nifedipine and nicardipine (10 µM), although the
onset of inhibition is slower than for inhibition of
1D currents (data not shown). The % inhibition was compared at the peak of the current and at the end of
the 200-ms depolarizing test pulse. For nifedipine, there was 13 ± 4% inhibition of the peak current and 32 ± 9% inhibition at
200 ms (n = 9). For nicardipine, there was 63 ± 5% inhibition of the peak current and 87 ± 7% inhibition at 200 ms (n = 3). Thus the increased inactivation that was
associated with 1,4-DHP inhibition of
1D
currents is also apparent for these
1E currents.
G
and VDCC
subunit binding to
1 I-II
loops expressed as GST fusion proteins
To examine biochemically the basis for the lack of G-protein
modulation of the
1D VDCC, the cytoplasmic
loops between transmembrane domains I-II of the human
1D and rabbit
1B
clones used in this study were expressed in Escherichia coli
as GST fusion proteins and purified as described in
METHODS. The purified fusion proteins are shown after
separation on 12.5% SDS-PAGE gels (Fig.
7A). The proteins were bound via the GST moiety to the Biacore 2000 CM5 sensor
chip, as described, and GST itself was used as a control. Purified
bovine brain G
subunits were then applied to the sensor chip
surface at a rate of 50 µl/min, for 5 min. The sensorgram traces are
shown in Fig. 7B, for three concentrations (10, 25, and 50 nM) of G
exposed to the
1B I-II loop,
and a single concentration of G
(100 nM) exposed to the
1D I-II loop. In contrast to the data for the
1B I-II loop, which showed
concentration-dependent binding of G
, no binding of G
was
observed to the
1D I-II loop. A similar lack
of binding was observed for up to 4 µM G
exposed to a fusion
protein of the I-II loop from a rat pancreatic
1D clone (D38101, results not shown).
|
Kinetic analysis was performed for the lowest concentration of G
(10 nM) binding to the
1B I-II loop. Single
exponential fits were made to the binding and dissociation phases of
the sensorgram (Fig. 7B). The observed on-rate
[kon(obs)] for G
binding was 0.0121 s
1, and the
off-rate (koff) after termination of
G
perfusion was 0.0104 s
1. Assuming a
unimolecular reaction in which
|
|

binding was
calculated to be 62.2 nM. This is very similar to the
KD determined previously for G
binding to parts of the
1A I-II loop
(De Waard et al. 1997As a positive control for the integrity of the GST fusion proteins, the
ability of purified H6C
1b (Fig. 7A)
to bind to the same I-II loops was examined. Both
1D and
1B I-II loops
bound H6C
1b reversibly (Fig. 7C),
with the
1D I-II loop demonstrating a higher
binding affinity with a KD of 10 nM
compared with 21 nM for
1B, determined as
above, using the Biacore kinetic analysis software with 1:1 interaction.
| |
DISCUSSION |
|---|
|
|
|---|
L-type current characteristics exhibited by expression of the human
neuronal
1D clone
There are a number of key characteristics shown by the calcium
channel currents expressed by the HEK 293
1D
cells that are acknowledged as being traits of L-type currents.
Sensitivity to the DHP antagonists (nifedipine and nicardipine) and an
agonist [BayK S-(
)8644] were observed. The degree of inhibition and
enhancement are comparable with other studies investigating the
pharmacology of expressed cloned L-type channels (Tomlinson et
al. 1993
; Williams et al. 1992
). In addition,
the increased inactivation observed during DHP antagonist application
that has been reported previously for native cardiac L-type channels
(Lee and Tsien 1983
) was also apparent for the
1D currents. This effect of DHP antagonists on
the inactivation kinetics was recently investigated by Handrock et al. (1999)
, who suggested that it is due to a second DHP
binding site. However, care must be taken when using the
characteristics of antagonism by DHPs, since, as was observed by the
application of nifedipine and nicardipine to cells transiently
expressing
1E channels in this study,
1E channels also exhibit inhibition by DHP
antagonists (Stephens et al. 1997
), including the
characteristic increase in inactivation (compare peak inhibition with
that at 200 ms into the depolarizing prepulse). More selective
pharmacological definition of L-type over
1E
or other non-L-type currents might be obtained by using low micromolar
concentrations of nifedipine (rather than the more promiscuous
nicardipine; an effect also observed in oocytes) (Furukawa et
al. 1999
). However, in the present study, 10 µM nifedipine
was required to completely inhibit
1D currents. Enhancement by BayK S-(
)8644 remains a defining
characteristic of L-type currents, since
1E
currents have previously been shown to be insensitive to BayK
S-(
)8644 (Stephens et al. 1997
).
Many of the biophysical characteristics expected of L-type currents are
also observed for the
1D currents. The
I-V relationship in Fig. 2D shows that the
currents activate at about
20 mV and with the peak at approximately
+20 mV in 20 mM Ba2+, as also observed for other
native L-type channels, and for
1C currents
(Lacinova et al. 1995
). However, native
1D currents observed in inner hair cells were
shown to have I-V relationships approximately 20 mV negative
to the I-V relationship observed in this study
(Platzer et al. 2000
); this difference may be partially accounted for by the lower external Ba2+
concentration used (10 mM). They also exhibit the ion selectivity (Ba2+ > Ca2+) typical of
other native and cloned L-type channels (Kalman et al.
1988
), with current density in 20 mM Ba2+
being approximately five-fold greater than that seen for 20 mM Ca2+. The activation observed for the
1D currents expressed in this study
(V50,act of +1.8 mV; see Fig.
2A) is very similar to expressed cardiac
(Pérez-García et al. 1995
) and neuronal
(Tomlinson et al. 1993
)
1C
L-type channel currents. The steady-state inactivation (V50,inact of
13.9 mV; see Fig.
2A), is also comparable to expressed cardiac
1C L-type currents (Lacinova et al.
1995
). The inactivation kinetics are also typical of
"long-lasting" neuronal L-type currents (Nowycky et al.
1985
). In 20 mM Ba2+, very little
inactivation of
1D currents was observed,
while rapid and striking calcium-dependent inactivation was
observed in 20 mM Ca2+ (see Fig. 2,
B-D).
Another characteristic of the
1D currents that
correlates well with other studies of expressed
1C channels (Dai et al. 1999
; Kamp et al. 2000
) is the small but reproducible
facilitation following a large depolarizing prepulse (see Fig. 5). Such
attributes are often indicative of G-protein modulation; however, for
the
1D current this effect was independent of
G-protein modulation, as it was similar in the presence of GTP-
S and
GDP-
S.
As yet there are no biophysical characteristics or pharmacological
tools that can differentiate between currents resulting from either
native or expressed
1C and
1D channels. Previous research has shown that
the block by DHP antagonists is voltage dependent, with greater
inhibition being observed when the holding potential is more
depolarized (Sanguinetti and Kass 1984
). However, for
the
1D currents no such voltage dependence of
block by DHP antagonists was observed, with similar block occurring (at
both peak current and 200 ms) at all holding potentials examined.
Another aspect that may prove to be different is the
inact of
1D currents in Ba2+. In a previous study examining the
inact of
1C when
co-expressed with
3 in Xenopus
laevis oocytes (Soldatov et al. 1997
), slower rates
of inactivation were observed (~1,300 ms) than seen here for
1D currents. Nevertheless, care must be taken
in interpreting such results since expression system (oocyte vs. HEK
293) and specific accessory subunit composition (particularly
subunits) will have marked effects on the inactivation properties.
Lack of G-protein modulation of
1D currents
The preceding biophysical and pharmacological characterization
clearly defined the
1D currents as being
L-type in nature. We then investigated the possibility of G-protein
modulation of this L-type current. G-protein modulation was examined
either by activation of the endogenous sst2 receptors or by transient expression of another GPCR, the rD2long receptor.
However, no modulation was observed of
1D
currents via either pathway. To ensure that the G-protein pathways were
intact and capable of coupling to calcium channels in the HEK 293 cells, both the endogenous sst2 and the transiently expressed exogenous
rD2long receptors were stimulated via their
respective agonists in HEK 293 cells expressing
1B currents, which have been shown to be
G-protein modulated by many groups (for review, see Dolphin
1998
). These positive controls showed obvious G-protein
modulation, confirming that modulation is possible by these pathways.
Furthermore, the modulation of the
1D current
was also investigated during application of BayK S-(
)8644, since
G-protein-mediated inhibition of L-type currents had been observed in
native rat chromaffin cells, during enhancement by BayK S-(
)8644
(Hernandez-Guijo et al. 1999
). However, a combination of
BayK S-(
)8644, SST, and quinpirole did not reveal inhibitory
G-protein modulation of BayK S-(
)8644-enhanced
1D currents co-expressed with
rD2long (see Fig. 6).
Another method to examine G-protein modulation is to use the
nonhydrolyzable GTP and GDP analogues GTP-
S and GDP-
S. The advantage of using these guanine nucleotide analogues is that they act
directly on all G-proteins, producing sustained activation (in the case
of GTP-
S) or blockade of activation (GDP-
S) (Dolphin and
Scott 1987
). Using a standard large depolarizing (+120 mV) prepulse protocol to detect G-protein modulation, no
GTP-
S-dependent effect was observed on
1D
currents, yet the
1B currents do exhibit marked tonic G-protein modulation in these conditions.
The lack of G-protein modulation of this
1D
clone is corroborated by the lack of G
binding to a GST fusion
protein of the
1D I-II loop, whereas in
parallel experiments, reversible binding of G
was observed to the
1B I-II loop. In contrast, both the
1D and
1B I-II loops
reversibly bound purified
1b subunit, indicating that they are probably folded in a native conformation (see
Fig. 7C). While the I-II loop is not the only region of the
1B calcium channel that is involved in its
G-protein regulation (Canti et al. 1999
; Page et
al. 1998
; Zhang et al. 1996
), nevertheless it is
certainly one of the key sequences contributing to the inhibition of
neuronal calcium channels (De Waard et al. 1997
).
Gs-protein modulation of L-type currents was also
investigated by activation of the Gs-adenyl
cyclase pathway with forskolin. No effect of forskolin was observed
(n = 4, data not shown). Protein kinase A (PKA)
modulation of channels has been shown to require A-kinase anchoring
proteins (AKAPs) (Johnson et al. 1997
). The presence of
AKAPs was not examined in this study, although they are likely to be
present since they are found in tsA-201 cells which are an HEK
293-derived cell line (Johnson et al. 1997
).
From these results, the
1D L-type clone used
in the present study does not appear to be the molecular counterpart of
the native neuronal and endocrine L-type channels that have been shown to exhibit G-protein modulation in several neuroendocrine preparations (Degtiar et al. 1997
; Gilon et al. 1997
;
Haws et al. 1993
; Hernandez-Guijo et al.
1999
; Kleuss et al. 1991
; Tallent et al.
1996
).
Source of G-protein-modulated neuroendocrine L-type current?
Since we have shown that the
1D/
2
-1/
3a
currents do not exhibit inhibitory G-protein modulation, what is the
molecular counterpart of the native L-type current in neuroendocrine
cells that do exhibit G-protein modulation? L-type currents are
generally identified by their sensitivity to DHP antagonists; however,
we previously demonstrated DHP antagonist block of a rat
1E isoform, rbEII (Stephens et al.
1997
). Because this isoform has a 50 amino acid truncation of
the N-terminus compared with
1E clones from other species (Page et al. 1998
), and may therefore not
represent a native isoform in rat brain (Schramm et al.
1999
), we have now confirmed and extended the finding of DHP
sensitivity of
1E currents, using
1Elong, an isoform whose extended N-terminus
is homologous to the cloned human (L27745), rabbit (X67855), and mouse (L29346) (Williams et al. 1994
)
1E sequences. The partial DHP sensitivity
(particularly to nicardipine) of
1E currents observed, as well as the DHP sensitivity of other cloned non-L-type currents observed recently (Furukawa et al. 1999
)
suggests the caveat that some studies apparently demonstrating
G-protein modulation of "L-type" currents (according to their
sensitivity to DHP antagonists) may need to be reviewed. However, this
uncertainty over identification of L-type currents by DHP antagonist
sensitivity may only be relevant to a few studies, and the significant
bank of evidence for G-protein modulation of neuroendocrine L-type
channels will be unaffected, particularly those studies in which L-type
currents have been defined by S(
)-BayK8644 enhancement
(Hernandez-Guijo et al. 1999
).
Additional
1D isoforms have been cloned from
pancreatic
-cells in rat (Ihara et al. 1995
) and
hamster (Yaney et al. 1992
). There is little functional
expression data available for these clones. Expression of
1D clones appears to be problematic with relatively low current density yields (even in the clone used in this
study, a low percentage of cells exhibited stable currents), a problem
that has hindered research in this area and may indicate that the
full-length clones currently available are not naturally occurring
splice variants. A number of sequences within the
1A,
1B, and
1E VDCC subunits have been shown to be
important for G
binding and modulation of the channel. These important
1 VDCC subunit sequences include the
intracellular loop between domains I and II (De Waard et al.
1997
), a region within the N-terminus (Canti et al.
1999
; Page et al. 1998
) and the C-terminus
(Qin et al. 1997
; Zhang et al. 1996
). Two
particularly relevant motifs present in the I-II loop (QQIER)
(Zamponi et al. 1997
) and the N-terminus (YKQSIAQRART)
(Canti et al. 1999
) of
1B are
not conserved in the
1D clone used here.
Furthermore, when comparing sequence alignments of the pancreatic
-cell
1D clones with the neuronal
1D clone used in this study, most elements in
putative regions pertinent to G-protein modulation are homologous to
each other. This suggests that these additional published
1D clones may also be predicted to exhibit no
G-protein modulation. Indeed, similar results have been obtained
regarding the lack of inhibitory G-protein modulation of another
1D clone (Yaney et al. 1992
)
(A. Scholze, T. D. Plant, A. C. Dolphin, and B. Nürnberg, unpublished results). However, the
1D sequences show least conservation in the
C-terminal tails, with either long (as in the
1D clone used here) or short C-terminus
isoforms (as in Yaney et al. 1992
) providing scope for
the possibility that the C-terminus of alternative
1D splice variants may provide a means of
G-protein modulation of certain splice variants.
As further progress is made in the elucidation of neuroendocrine L-type
channels, it is becoming clear that a sophisticated level of complexity
is likely to exist. For example, in the GH3 (a
rat pituitary derived) cell line alone, several mRNA transcripts encoding splice variants of the
1D subunit
have been reported (Safa et al. 1998
). Further
complexity of these channels will be added due to the differing
combinations of accessory subunits. Although
3
appears to be a significant accessory subunit associated with neuronal
L-type channels (Pichler et al. 1997
), nevertheless,
4 is also prominently associated with neuronal
L-type channels, and
1b and
2a are also associated with a small proportion
of the channels (Pichler et al. 1997
). Between
subunit isoforms there are also splice variants (for reviews see
Birnbaumer et al. 1998
; Castellano and
Perez-Reyes 1994
) that add to the channel subunit complexity.
Among these combinations of
1D splice variants and accessory subunits, there may be a sub-set that do exhibit the
G-protein modulation observed in native neuroendocrine cells and
derived cell lines. Alternatively, an as yet undiscovered accessory
protein may be required for coupling of the neuronal L-type channels to
G-protein inhibitory pathways, or modulation may involve
Ca2+-dependent mechanisms (Mathie et al.
1992
), a process not investigated in the present study.
| |
ACKNOWLEDGMENTS |
|---|
The cDNAs used in this study were generously provided by the following: E. Perez-Reyes (University of Virginia); T. Snutch (University of British Columbia, Vancouver, Canada); Y. Mori (Seriken, Okazaki, Japan); P. G. Strange (Reading, UK); T. Hughes (Yale, New Haven, CT); and Genetics Institute (Cambridge, MA). The technical help of N. Balaguero is gratefully acknowledged.
This work was supported by the Medical Research Council (MRC), Wellcome Trust and Royal Society. D. C. Bell was funded by a MRC/Merck, Sharp and Dohme collaborative Ph.D. studentship.
Present addresses: D. C. Bell, Center for Neurobiology and Behavior, Columbia University, New York, NY 10032; P. F. Brust, Ambryx Inc., 11099 N. Torrey Pines Rd., #160, La Jolla, CA 92037; A. Nesterova, Dept. of Endocrinology, University of Colorado Health Sciences Center, Denver, CO 80262.
| |
FOOTNOTES |
|---|
Address for reprint requests: A. C. Dolphin, Dept. of Pharmacology (Medawar Building), University College London, Gower St., London WC1E 6BT, UK (E-mail: a.dolphin{at}ucl.ac.uk).
Received 17 May 2000; accepted in final form 18 October 2000.
| |
REFERENCES |
|---|
|
|
|---|
subunits.
J Bioenerg Biomembr
30:
357-375, 1998[Web of Science][Medline].
-subunit in rat neurones.
J Physiol (Lond)
485:
365-372, 1995
1B critical for inhibition of the voltage-dependent calcium channel by G
.
J Neurosci
19:
6855-6864, 1999
subunits.
Biochem Soc Trans
22:
483-488, 1994[Web of Science][Medline].
complex to voltage-dependent calcium channels.
Nature
385:
446-450, 1997[Medline].
)-baclofen in rat sensory neurones: modulation by guanine nucleotides.
J Physiol (Lond)
386:
1-17, 1987
S modify calcium current activation in bullfrog sympathetic neurons.
Neuron
5:
75-80, 1990[Web of Science][Medline].
o1 generates G
o3, an abundant G-protein in brain.
Proc Natl Acad Sci USA
96:
1327-1332, 1999
1 subunits.
J Cell Biol
123:
949-962, 1993
3 subunit.
FEBS Lett
373:
103-107, 1995[Web of Science][Medline].
1 subunits
1B and
1E as an essential determinant of G-protein modulation.
J Neurosci
18:
4815-4824, 1998
1 and
subunits.
J Gen Physiol
105:
289-306, 1995
with a C-terminal G
binding domain of the Ca2+ channel
1 subunit is responsible for channel inhibition by G-protein-coupled receptors.
Proc Natl Acad Sci USA
94:
8866-8871, 1997
1E voltage-gated calcium channels in rat cerebellar granule cells
detection of major calcium channel
1-transcripts by reverse transcription-polymerase chain reaction.
Neuroscience
92:
565-575, 1999[Web of Science][Medline].
1 subunit of a voltage-dependent calcium channel expressed in pancreatic
cells.
Proc Natl Acad Sci USA
89:
584-588, 1992
role of the carboxyl-terminal region encoded by exons 40-42 in
1C subunit in the kinetics and Ca2+ dependence of inactivation.
J Biol Chem
272:
3560-3566, 1997
1 subunits in G-protein modulation.
J Physiol (Lond)
509:
163-169, 1998
1E calcium channels in COS-7 cells.
Pflügers Arch
433:
523-532, 1997[Web of Science][Medline].
dimers stimulate vascular L-type Ca2+ channels via phosphoinositide 3-kinase.
FASEB J
13:
685-694, 1999
1,
2, and
subunits of a novel human neuronal calcium channel subtype.
Neuron
8:
71-84, 1992[Web of Science][Medline].
1E calcium channel subtypes.
J Biol Chem
269:
22347-22357, 1994
1-subunit of the voltage-dependent calcium channel from the
-cell.
Mol Endocrinol
6:
2143-2152, 1992
1 subunit.
Nature
385:
442-446, 1997[Medline].This article has been cited by other articles:
![]() |
M. L. Roberts-Crowley and A. R. Rittenhouse Arachidonic acid inhibition of L-type calcium (CaV1.3b) channels varies with accessory CaV{beta} subunits J. Gen. Physiol., April 1, 2009; 133(4): 387 - 403. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Ramadan, Y. Qu, R. Wadgaonkar, G. Baroudi, E. Karnabi, M. Chahine, and M. Boutjdir Phosphorylation of the Consensus Sites of Protein Kinase A on {alpha}1D L-type Calcium Channel J. Biol. Chem., February 20, 2009; 284(8): 5042 - 5049. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Vacher, D. P. Mohapatra, and J. S. Trimmer Localization and Targeting of Voltage-Dependent Ion Channels in Mammalian Central Neurons Physiol Rev, October 1, 2008; 88(4): 1407 - 1447. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Momiyama and Y. Fukazawa D1-like dopamine receptors selectively block P/Q-type calcium channels to reduce glutamate release onto cholinergic basal forebrain neurones of immature rats J. Physiol., April 1, 2007; 580(1): 103 - 117. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Chameau, Y. Qin, S. Spijker, G. Smit, and M. Joels Glucocorticoids Specifically Enhance L-Type Calcium Current Amplitude and Affect Calcium Channel Subunit Expression in the Mouse Hippocampus J Neurophysiol, January 1, 2007; 97(1): 5 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. P. Bellinger, B. K. Fox, W. Y. Chan, L. K. Davis, M. A. Andres, T. Hirano, E. G. Grau, and I. M. Cooke Ionotropic glutamate receptor activation increases intracellular calcium in prolactin-releasing cells of the adenohypophysis Am J Physiol Endocrinol Metab, December 1, 2006; 291(6): E1188 - E1196. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. J. Galli, E. W. Taylor, and H. A. Shiels Calcium flux in turtle ventricular myocytes Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2006; 291(6): R1781 - R1789. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Butcher, J. Leroy, M. W. Richards, W. S. Pratt, and A. C. Dolphin The importance of occupancy rather than affinity of CaV{beta} subunits for the calcium channel I-II linker in relation to calcium channel function J. Physiol., July 15, 2006; 574(2): 387 - 398. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Liu, S. M. P. Jacobo, N. Hilliard, and G. H. Hockerman Differential Modulation of Cav1.2 and Cav1.3-Mediated Glucose-Stimulated Insulin Secretion by cAMP in INS-1 Cells: Distinct Roles for Exchange Protein Directly Activated by cAMP 2 (Epac2) and Protein Kinase A J. Pharmacol. Exp. Ther., July 1, 2006; 318(1): 152 - 160. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Eltit, A. A. Garcia, J. Hidalgo, J. L. Liberona, M. Chiong, S. Lavandero, E. Maldonado, and E. Jaimovich Membrane Electrical Activity Elicits Inositol 1,4,5-Trisphosphate-dependent Slow Ca2+ Signals through a Gbeta{gamma}/Phosphatidylinositol 3-Kinase {gamma} Pathway in Skeletal Myotubes J. Biol. Chem., April 28, 2006; 281(17): 12143 - 12154. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Wolf, J. T. Moyer, M. T. Lazarewicz, D. Contreras, M. Benoit-Marand, P. O'Donnell, and L. H. Finkel NMDA/AMPA Ratio Impacts State Transitions and Entrainment to Oscillations in a Computational Model of the Nucleus Accumbens Medium Spiny Projection Neuron J. Neurosci., October 5, 2005; 25(40): 9080 - 9095. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, Y. He, D. Tuteja, D. Xu, V. Timofeyev, Q. Zhang, K. A. Glatter, Y. Xu, H.-S. Shin, R. Low, et al. Functional Roles of Cav1.3({alpha}1D) Calcium Channels in Atria: Insights Gained From Gene-Targeted Null Mutant Mice Circulation, September 27, 2005; 112(13): 1936 - 1944. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Leroy, M. S. Richards, A. J. Butcher, M. Nieto-Rostro, W. S. Pratt, A. Davies, and A. C. Dolphin Interaction via a Key Tryptophan in the I-II Linker of N-Type Calcium Channels Is Required for {beta}1 But Not for Palmitoylated {beta}2, Implicating an Additional Binding Site in the Regulation of Channel Voltage-Dependent Properties J. Neurosci., July 27, 2005; 25(30): 6984 - 6996. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Rose, M. B. Anand-Srivastava, W. R. Giles, and J. S. Bains C-type Natriuretic Peptide Inhibits L-type Ca2+ Current in Rat Magnocellular Neurosecretory Cells by Activating the NPR-C Receptor J Neurophysiol, July 1, 2005; 94(1): 612 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Qu, G. Baroudi, Y. Yue, N. El-Sherif, and M. Boutjdir Localization and modulation of {alpha}1D (Cav1.3) L-type Ca channel by protein kinase A Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2123 - H2130. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hosoi, I. Arai, and M. Tachibana Group III Metabotropic Glutamate Receptors and Exocytosed Protons Inhibit L-Type Calcium Currents in Cones But Not in Rods J. Neurosci., April 20, 2005; 25(16): 4062 - 4072. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Berrou, Y. Dodier, A. Raybaud, A. Tousignant, O. Dafi, J. N. Pelletier, and L. Parent The C-terminal Residues in the Alpha-interacting Domain (AID) Helix Anchor CaV{beta} Subunit Interaction and Modulation of CaV2.3 Channels J. Biol. Chem., January 7, 2005; 280(1): 494 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lipscombe, T. D. Helton, and W. Xu L-Type Calcium Channels: The Low Down J Neurophysiol, November 1, 2004; 92(5): 2633 - 2641. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Tavalin, D. Shepherd, R. K. Cloues, S. E. H. Bowden, and N. V. Marrion Modulation of Single Channels Underlying Hippocampal L-Type Current Enhancement by Agonists Depends on the Permeant Ion J Neurophysiol, August 1, 2004; 92(2): 824 - 837. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Liu, N. Hilliard, and G. H. Hockerman Cav1.3 Is Preferentially Coupled to Glucose-Induced [Ca2+]i Oscillations in the Pancreatic {beta} Cell Line INS-1 Mol. Pharmacol., May 1, 2004; 65(5): 1269 - 1277. [Abstract] [Full Text] |
||||
![]() |
M. Michna, M. Knirsch, J.-C. Hoda, S. Muenkner, P. Langer, J. Platzer, J. Striessnig, and J. Engel Cav 1.3 ({alpha}1D) Ca2+ currents in neonatal outer hair cells of mice J. Physiol., December 15, 2003; 553(3): 747 - 758. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Dolphin G Protein Modulation of Voltage-Gated Calcium Channels Pharmacol. Rev., December 1, 2003; 55(4): 607 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Bao, W. H. Wong, J. M. Goldberg, and R. A. Eatock Voltage-Gated Calcium Channel Currents in Type I and Type II Hair Cells Isolated From the Rat Crista J Neurophysiol, July 1, 2003; 90(1): 155 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Vigh, E. Solessio, C. W. Morgans, and E. M. Lasater Ionic Mechanisms Mediating Oscillatory Membrane Potentials in Wide-Field Retinal Amacrine Cells J Neurophysiol, July 1, 2003; 90(1): 431 - 443. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Tosetti, V. Parente, V. Taglietti, K. Dunlap, and M. Toselli Chick RGS2L demonstrates concentration-dependent selectivity for pertussis toxin-sensitive and -insensitive pathways that inhibit L-type Ca2+ channels J. Physiol., May 15, 2003; 549(1): 157 - 169. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Liu, N. Dilmac, N. Hilliard, and G. H. Hockerman Cav1.3 Is Preferentially Coupled to Glucose-Stimulated Insulin Secretion in the Pancreatic beta -Cell Line INS-1 J. Pharmacol. Exp. Ther., April 1, 2003; 305(1): 271 - 278. [Abstract] [Full Text] |
||||
![]() |
H. Song, L. Nie, A. Rodriguez-Contreras, Z.-H. Sheng, and E. N. Yamoah Functional Interaction of Auxiliary Subunits and Synaptic Proteins With CaV1.3 May Impart Hair Cell Ca2+ Current Properties J Neurophysiol, February 1, 2003; 89(2): 1143 - 1149. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Banihashemi and P. R. Albert Dopamine-D2S Receptor Inhibition of Calcium Influx, Adenylyl Cyclase, and Mitogen-Activated Protein Kinase in Pituitary Cells: Distinct G{alpha} and G{beta}{gamma} Requirements Mol. Endocrinol., October 1, 2002; 16(10): 2393 - 2404. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Carabelli, M. D'Ascenzo, E. Carbone, and C. Grassi Nitric oxide inhibits neuroendocrine CaV1 L-channel gating via cGMP-dependent protein kinase in cell-attached patches of bovine chromaffin cells J. Physiol., June 1, 2002; 541(2): 351 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, Y. Xu, H. Song, J. Rodriguez, D. Tuteja, Y. Namkung, H.-S. Shin, and N. Chiamvimonvat Functional Roles of Cav1.3 ({alpha}1D) Calcium Channel in Sinoatrial Nodes: Insight Gained Using Gene-Targeted Null Mutant Mice Circ. Res., May 17, 2002; 90(9): 981 - 987. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Raghib, F. Bertaso, A. Davies, K. M. Page, A. Meir, Y. Bogdanov, and A. C. Dolphin Dominant-Negative Synthesis Suppression of Voltage-Gated Calcium Channel Cav2.2 Induced by Truncated Constructs J. Neurosci., November 1, 2001; 21(21): 8495 - 8504. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Safa, J. Boulter, and T. G. Hales Functional Properties of CaV1.3 (alpha 1D) L-type Ca2+ Channel Splice Variants Expressed by Rat Brain and Neuroendocrine GH3 Cells J. Biol. Chem., October 12, 2001; 276(42): 38727 - 38737. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xu and D. Lipscombe Neuronal CaV1.3{alpha}1 L-Type Channels Activate at Relatively Hyperpolarized Membrane Potentials and Are Incompletely Inhibited by Dihydropyridines J. Neurosci., August 15, 2001; 21(16): 5944 - 5951. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Scholze, T. D. Plant, A. C. Dolphin, and B. Nurnberg Functional Expression and Characterization of a Voltage-Gated CaV1.3 ({{alpha}}1D) Calcium Channel Subunit from an Insulin-Secreting Cell Line Mol. Endocrinol., July 1, 2001; 15(7): 1211 - 1221. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Koschak, D. Reimer, I. Huber, M. Grabner, H. Glossmann, J. Engel, and J. Striessnig alpha 1D (Cav1.3) Subunits Can Form L-type Ca2+ Channels Activating at Negative Voltages J. Biol. Chem., June 15, 2001; 276(25): 22100 - 22106. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |