JN AJP: Lung Cellular and Molecular Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Neurophysiol 85: 995-997, 2001;
0022-3077/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (20)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karadsheh, M. F.
Right arrow Articles by Delpire, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karadsheh, M. F.
Right arrow Articles by Delpire, E.

The Journal of Neurophysiology Vol. 85 No. 2 February 2001, pp. 995-997
Copyright ©2001 by the American Physiological Society

RAPID COMMUNICATION

Neuronal Restrictive Silencing Element Is Found in the KCC2 Gene: Molecular Basis for KCC2-Specific Expression in Neurons

Michael F. Karadsheh and E. Delpire

Departments of Anesthesiology and Pediatrics, Vanderbilt University Medical Center, Nashville, Tennessee 37232-2520


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES

Karadsheh, Michael F. and E. Delpire. Neuronal Restrictive Silencing Element Is Found in the KCC2 Gene: Molecular Basis for KCC2-Specific Expression in Neurons. J. Neurophysiol. 85: 995-997, 2001. KCC2 is one of four known isoforms of the K-Cl cotransporter with an expression pattern restricted to neurons. It mediates efflux of Cl- across neuronal membranes and plays an important role in GABAergic and glycinergic neurotransmission. To understand the molecular basis for neuronal specificity of KCC2 expression, we isolated and sequenced portions of the KCC2 gene, including some of its 5' flanking (control) region. We found a 21-bp sequence, within intron 1, that shares 80% homology to the consensus site for neuronal-restrictive silencing factor binding. We demonstrated that this specific sequence of the KCC2 gene promotes transcriptional regulation by showing that nuclear proteins isolated from a mouse neural progenitor cell line interact with this 21-bp element and by establishing that this element silences reporter gene expression in nonneuronal cells.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES

GABA and glycine are inhibitory neurotransmitters in the adult CNS. However, they produce excitatory responses in young immature brain (Ben-Ari et al. 1989; Ehrlich et al. 1999). The conversion of the GABA effect from excitatory to inhibitory occurs shortly after birth and is related to the intracellular Cl- concentration in neurons (Ehrlich et al. 1999; Owens et al. 1996). Immature neurons have an intracellular Cl- concentration higher than predicted for a passive distribution (Ehrlich et al. 1999; Owens et al. 1996). On activation of GABAA receptor, there is an outward movement of Cl- that leads to membrane depolarization (excitation). During postnatal development, the intracellular Cl- concentration decreases to values below equilibrium and GABA induces Cl- influx resulting in membrane hyperpolarization (inhibition).

The expression of the Na-K-2Cl cotransporter, NKCC1, decreases (Plotkin et al. 1997), whereas expression of KCC2, an isoform of the K-Cl cotransporter, increases (Clayton et al. 1998; Lu et al. 1999) during postnatal development. These changes in cotransporter expression are consistent with a decrease in intracellular Cl- concentration and with the switch from depolarizing to hyperpolarizing GABA currents.

Analysis of KCC2 expression by Northern blot, in situ hybridization, and immunofluorescence has revealed that KCC2 expression is restricted to neurons (Lu et al. 1999; Payne et al. 1996). To study the neuronal specificity of KCC2 expression, we isolated and examined the gene encoding this cotransporter. In the course of identifying and isolating exon 1 and the upstream regulatory region of the gene, we discovered a 21-bp motif downstream of exon 1 that resembles the consensus sequence of the known neuronal-restrictive silencing element (NRSE). We report here that this KCC2 element binds to nuclear proteins and inhibits the transcription of a reporter gene in C17 nonneuronal cells.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES

Genomic library

A Lamda FIXII mouse genomic library (Stratagene, La Jolla, CA) was screened using the first 280-bp fragment of the rat KCC2 cDNA (Payne et al. 1996). Five positive clones were isolated. After secondary screening, two single positive clones were grown in liquid culture, and phage DNA was isolated and mapped with a panel of restriction enzymes. Southern blot analysis was performed to identify exon 1. A 12-kb EcoRI-NotI fragment was subcloned into the vector Bluescript, and 1.6 kb at the 5' end was sequenced.

Electromobility shift assay

C17 progenitor cells from eight confluent 10-cm culture dishes were trypsinized, washed, and spun for 5 min at 1,500 rpm. Nuclear proteins were isolated as previously described (Shelton et al. 1992) and quantitated using the Bradford assay (Bradford 1976). Two complementary neuronal-restrictive silencing element (NRSE) oligonucleotides were end-labeled with 32P-dATP using T4 polynucleotide kinase, annealed, and purified by phenol:chloroform extraction. Protein-DNA binding was achieved by incubating 7 µg nuclear protein with 2 µl probe (4 pmols) in a 25-µl reaction containing (in mM) 100 KCl, 5 MgCl2, 1 EDTA, 0.5 DTT, 0.1 ZnCl2, 10% glycerol, 0.05% Nonidet P-40, and 10 HEPES pH 7.7 for 15 min at room temperature. The reactions were then separated on 4% polyacrylamide gel.

PGL3 constructs and luciferase assays

A 1.5-kb EcoRI-XhoI fragment of the mouse KCC2 gene containing some 5' flanking sequence, the putative minimal promoter and some 5' untranslated region was ligated at the EcoRI and XhoI sites of the promoterless luciferase reporter gene vector pGL3-basic (Promega). This new vector was designed to test the activity of the KCC2 promoter. Two synthetic complementary oligonucleotides containing the 21-bp KCC2 NRSE sequence flanked by EcoRI sites were thenligated at the EcoRI site upstream of the KCC2 promoter. The three vectors (pGL3-basic, pGL3-KCC2, and pGL3-NRSE-KCC2) were transfected in C17 progenitor neural cells for promoter assay, together with a pSVbeta gal vector to correct for transfection efficiency. C17 cells were transfected using 2.5 µg construct, 1.5 µg beta -galactosidase, and 3 µg/ml lipofectamine (Gibco). After 36 h, the cells were washed and lysed with 300 µl lysis buffer (Promega). beta -galactosidase activity was obtained by incubating 100 µl lysate to 100 µl 2 × ONPG buffer [(in mM) 120 Na2HPO4, 80 NaH2PO4, 2 MgCl2, 100 beta -mercaptoethanol, and 4.4 o-nitrophenyl beta -D-galactopyranoside] at 37°C for 24 h, followed by the addition of 334 µl 1 M Na2CO3, and measurement of optical density at 420 nm. Luciferase activity was measured in a EG and G Autolumat luminometer (Model LB953) by injecting 100 µl luciferase reagent (Promega) to 40 µl lysate. Results were expressed as ratios between luciferase and beta -galactosidase activities. beta -galactosidase activity was determined to control for changes in transfection efficiency.


    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES

Negative transcriptional regulation of neuronal genes in nonneuronal cells was first described for the SCG10 and type II Na+ channel genes (Kraner et al. 1992; Mori et al. 1990). Since these original reports, transcription of many genes expressed specifically in neurons have been shown to be regulated through this mechanism. These genes contain in their promoter or introns a specific sequence NRSE that constitutes the binding site for a protein expressed in nonneuronal cells (NRSF or REST) and inhibits their transcription. This negative transcriptional regulation is also critical in the development of the nervous system. Most genes expressed in differentiated or mature neurons are not found in precursor and immature cells. Up-regulation of these neuronal specific genes coincides with the down-regulation of NRSF expression (Schoenherr and Anderson 1995). Importance of NRSF regulation is also evidenced by the multiple malformations observed by Chen and coworkers in different nonneural tissues and by the embryonic lethality of complete inactivation of NRSF in the knockout mouse (Jones and Meech 1999).

Out of four genes that encode K-Cl cotransporter, KCC2 has been shown to be neuronal specific with potential relevance in CNS development and intracellular Cl- homeostasis (Clayton et al. 1998; Lu et al. 1999). Previous work has determined that KCC2 expression is low at birth and increases during postnatal development (Clayton et al. 1998; Lu et al. 1999). The KCC2 gene is therefore a very good candidate for regulation by NRSF. To understand the molecular basis for the restrictive expression of KCC2 in neurons, we isolated the promoter region of the KCC2 gene. A mouse lambda phage genomic library was screened with a probe consisting of the first 280-bp fragment of the rat KCC2 cDNA (Payne et al. 1996). A ~18-kb genomic clone was obtained and analyzed by restriction digest and Southern blot analysis. This genomic clone contains ~7 kb of 5' flanking region, exon 1, and ~11 kb of the downstream sequence. The 5' flanking region (1.5 kb of it), exon 1, and a short portion of intron 1 were sequenced. We did not characterize the 5' boundary nor the 3' end of the gene. The entire sequenced fragment was analyzed using the transcription factor database available at http://www@genome.ad.jp. As expected, we found in intron 1 a 21-bp sequence with high sequence homology (81%) to the known consensus sequence of NRSE (Fig. 1). This consensus was derived from 19 sequences for which NRSF binding was experimentally determined (Schoenherr et al. 1996). Out of the four mismatched nucleotides, three are located at positions most frequently modified in functional NRSEs and subsequently demonstrated to be nonessential of the NRSF binding (Schoenherr et al. 1996).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Structure of a 18-kb genomic fragment isolated from a mouse genomic library. Magnification of exon 1 displays the position corresponding to the 5' end of the rat cDNA, the 5' untranslated region (UTR), the ATG start of the KCC2 protein (origin of arrow, M, methionine; L, leucine; N, asparagine), and the exon/intron boundary (5' splice junction). The position of the KCC2 NRSE sequence, depicted as a star, is observed downstream of exon 1. The alignment of the KCC2 putative neuronal-restrictive silencing element (NRSE) sequence with the NRSE consensus sequence is shown with identical residues placed in boxes and with the residues, likely subject to modifications (asterisk). M and S in the consensus sequence represents (A, C) and (C, G), respectively. Selected restrictions sites are shown as landmarks: X, XhoI; E, EcoRI. The thick black line starting at the EcoRI site indicates the fragment which was sequenced, and the thick gray line represents a 10.2-kb genomic fragment released in Genbank under Accession No. AJ011033.

To demonstrate that the 21-bp fragment of the KCC2 gene is involved in the regulation of KCC2 expression, we first examined possible interaction of this fragment with nuclear proteins isolated from C17 nonneuronal cells. Two complementary synthetic oligonucleotide primers were annealed, labeled with 32-P, and incubated with nuclear proteins isolated from mouse progenitor C17 neural cells. Interaction of the probe with nuclear proteins was demonstrated by acrylamide gel electrophoresis. As demonstrated in Fig. 2A, the mobility of the probe (lane 1) was retarded in the presence of nuclear proteins (lane 2), indicating protein-DNA interaction. The protein-DNA complex was completely displaced by a cold NRSE fragment (Fig. 2B, lane 2) but not by an unrelated DNA fragment of the same size and same G + C content (Fig. 2B, lane 3).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 2. Electromobility shift assay. Nuclear protein (15 µg) isolated from C17 neural progenitor cells were incubated with 32P-end-labeled NRSE oligonucleotide (TCCAGAACCGTGGACAGCGCC) for 15 min at room temperature. The reactions were separated on 4% acrylamide gels and exposed to autoradiography. A: presence of a retarded band in reactions where nuclear proteins were incubated with the probe, indicating DNA-protein interaction. B: the protein-DNA complex was still present when excess cold DNA of unrelated sequence was added to the reaction and absent when cold NRSE DNA was added to compete with the probe.

Using a luciferase gene reporter assay, we examined the effect of the 21-bp KCC2 NRSE fragment on gene transcription. A 1,500-bp EcoRI-XhoI fragment consisting of the most proximal 5' flanking region of the KCC2 gene, and possibly containing the minimal promoter (see Fig. 1), was inserted upstream of the promoterless luciferase gene. Two complementary synthetic oligonucleotides consisting of the 21-bp KCC2 NRSE sequence and flanking EcoRI sites were annealed and ligated upstream of the 1,500-bp fragment. The three vectors (pGL3 basic, pGL3-KCC2, pGL3-NRSE-KCC2) were transfected in C17 cells and assayed for luciferase activity. As shown in Fig. 3, pGL3-basic had little luciferase activity, pGL3-KCC2 yielded significant luciferase activity, while the addition of the NRSE sequence (pGL3-NRSE-KCC2) inhibited completely the KCC2 promoter-induced luciferase signal as indicated by a return to baseline levels.



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 3. NRSE element from KCC2 gene inhibits luciferase transcription. Relative luciferase activities measured with promoterless PGL3-basic vector, PGL3 vector containing 1,500 bp of 5' flanking region of the KCC2 gene (EcoRI-XhoI fragment) and PGL3 vector including both the KCC2 promoter and the 21-bp NRSE element. Note the significant increased luciferase activity generated by the KCC2 promoter (P < 0.01, ANOVA) and the complete inhibition induced by the presence of the NRSE element. Each bar represents the mean ± SD of 3 measurements. Experiments shown in this figure were repeated 4 times with similar results.

These results demonstrate that the KCC2 NRSE-like 21-bp sequence is capable of silencing transcription of the luciferase reporter gene in C17 nonneuronal cells. These are pluripotent, undifferentiated, neuronal or glial-precursor cells. Taken together, these experiments suggest an important role for this putative element in regulating KCC2 gene expression.


    ACKNOWLEDGMENTS

E. Delpire is an Established Investigator from the American Heart Association.

This work was supported by National Institute of Neurological Disorders and Stroke Grant NS-36758.


    FOOTNOTES

Address for reprint requests: E. Delpire, Anesthesiology Research Div., Dept. of Anesthesiology, T-4202 Medical Center North, Nashville, TN 37232-2520 (E-mail: eric.delpire{at}mcmail.vanderbilt.edu).

Received 6 March 2000; accepted in final form 28 September 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES

0022-3077/01 $5.00 Copyright © 2001 The American Physiological Society



This article has been cited by other articles:


Home page
J. Neurosci.Home page
T. R. Burton, D. D. Eisenstat, and S. B. Gibson
BNIP3 (Bcl-2 19 kDa Interacting Protein) Acts as Transcriptional Repressor of Apoptosis-Inducing Factor Expression Preventing Cell Death in Human Malignant Gliomas
J. Neurosci., April 1, 2009; 29(13): 4189 - 4199.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Uvarov, A. Ludwig, M. Markkanen, P. Pruunsild, K. Kaila, E. Delpire, T. Timmusk, C. Rivera, and M. S. Airaksinen
A Novel N-terminal Isoform of the Neuron-specific K-Cl Cotransporter KCC2
J. Biol. Chem., October 19, 2007; 282(42): 30570 - 30576.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. H. C. Lee, J. A. Walker, J. R. Williams, R. J. Goodier, J. A. Payne, and S. J. Moss
Direct Protein Kinase C-dependent Phosphorylation Regulates the Cell Surface Stability and Activity of the Potassium Chloride Cotransporter KCC2
J. Biol. Chem., October 12, 2007; 282(41): 29777 - 29784.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. Gamba
Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters
Physiol Rev, April 1, 2005; 85(2): 423 - 493.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
L. Zhu, D. Lovinger, and E. Delpire
Cortical Neurons Lacking KCC2 Expression Show Impaired Regulation of Intracellular Chloride
J Neurophysiol, March 1, 2005; 93(3): 1557 - 1568.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Brauer, E. Frei, L. Claes, S. Grissmer, and H. Jager
Influence of K-Cl cotransporter activity on activation of volume-sensitive Cl- channels in human osteoblasts
Am J Physiol Cell Physiol, July 1, 2003; 285(1): C22 - C30.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (20)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karadsheh, M. F.
Right arrow Articles by Delpire, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karadsheh, M. F.
Right arrow Articles by Delpire, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online