|
|
||||||||
The Journal of Neurophysiology Vol. 85 No. 4 April 2001, pp. 1479-1488
Copyright ©2001 by the American Physiological Society
1Department of Anesthesiology and 3Department of Neurology, Chang Gung Memorial Hospital; and 2Department of Anatomy and 4Department of Physiology, Chang Gung University School of Medicine, Kwei-San, Tao-Yuan, Taiwan, R.O.C.
| |
ABSTRACT |
|---|
|
|
|---|
Li, Allen H.,
Hwa-Min Hwang,
Peter P. Tan,
Tony Wu, and
Hung-Li Wang.
Neurotensin Excites Periaqueductal Gray Neurons Projecting to
the Rostral Ventromedial Medulla.
J. Neurophysiol. 85: 1479-1488, 2001.
Microinjection of neurotensin
into the midbrain periaqueductal gray (PAG) produces a potent and
naloxone-insensitive analgesic effect. To test the hypothesis that
neurotensin induces the analgesic effect by activating the PAG-rostral
ventromedial medulla (RVM) descending antinociceptive pathway, PAG
neurons that project to RVM (PAG-RVM) were identified by microinjecting
DiIC18, a retrograde tracing dye, into the rat
RVM. Subsequently, fluorescently labeled PAG-RVM projection neurons
were acutely dissociated and selected for whole cell patch-clamp
recordings. During current-clamp recordings, neurotensin depolarized
retrogradely labeled PAG-RVM neurons and evoked action potentials.
Voltage-clamp recordings indicated that neurotensin excited PAG-RVM
neurons by opening the voltage-insensitive and nonselective cation
channels. Both SR 48692, a selective NTR-1 antagonist, and SR 142948A,
a nonselective antagonist of NTR-1 and NTR-2, failed to prevent
neurotensin from exciting PAG-RVM neurons. Neurotensin failed to evoke
cationic currents after internally perfusing PAG-RVM projection neurons
with GDP-
-S or
anti-G
q/11 antiserum.
Cellular Ca2+ fluorescence measurement using
fura-2 indicated that neurotensin rapidly induced
Ca2+ release from intracellular stores of PAG-RVM
neurons. Neurotensin-evoked cationic currents were blocked by heparin,
an IP3 receptor antagonist, and
1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid
(BAPTA), a fast chelator of Ca2+. These results
suggest that by activating a novel subtype of neurotensin receptors,
neurotensin depolarizes and excites PAG-RVM projection neurons through
enhancing Ca2+-dependent nonselective cationic
conductance. The coupling mechanism via
G
q/11 proteins is likely
to involve the production of IP3, and subsequent
IP3-evoked Ca2+ release
leads to the opening of nonselective cation channels.
| |
INTRODUCTION |
|---|
|
|
|---|
The midbrain
periaqueductal gray (PAG) and the rostral ventromedial medulla (RVM),
which includes nucleus raphe magnus (NRM), nucleus reticularis
paragigantocellularis pars alpha (NRG
), and nucleus reticularis
paragigantocellularis (NRPG), are key components of the brain stem
descending pain control circuit that inhibits the nociceptive
transmission in the dorsal horn of spinal cord and trigeminal sensory
complex (Bandler and Shipley 1994
; Fields et al.
1991
). Antrograde and retrograde tracing studies showed that
PAG neurons project monosynaptically to the NRM, NRG
, and NRPG (Beitz et al. 1983
; Lakos and Basbaum
1988
). Electrical stimulation in the PAG evokes a monosynaptic
excitatory potential in the RVM neurons (Mason et al.
1985
). Furthermore, analgesia induced by the PAG stimulation is
abolished by the lesion of NRM and adjacent medullary reticular
formation (Sandkuhler and Gebhart 1984
). Thus the
antinociceptive effect produced by PAG excitation is mediated by an
excitatory innervation from the PAG to the RVM, which projects to the
dorsal horn of spinal cord and inhibits the pain transmission (Fields et al. 1991
).
It is well known that when microinjected into PAG, opioid peptides and
morphine produce the analgesic effect by activating the PAG-RVM
antinociceptive pathway (Fields et al. 1991
;
Morgan et al. 1992
). In addition to opioid-induced
analgesia, an extensive body of evidence suggests that endogenous
neurotensin, a tridecapeptide, regulates the pain transmission by
modulating the PAG-RVM antinociceptive neuronal circuitry. When
microinjected into the PAG, neurotensin produced a potent and
naloxone-insensitive analgesia (Al-Rodhan et al. 1991
).
It has been shown that neurotensin-containing neurons and fibers are
present in the ventromedial and ventrolateral columns of the PAG
(Shipley et al. 1987
). PAG neurons express a high
density of neurotensin receptors (Uhl 1990
) and are
densely innervated by neurotensin-immunoreactive nerve terminals, which
originate from the bed nucleus of the stria terminalis, the central
nucleus of the amygdala, and the lateral hypothalamus (Behbehani
et al. 1988
; Gray and Magnuson 1992
;
Rizvi et al. 1991
). Neurotensin-containing axon
terminals form synapses with PAG neurons that project to the NRM and
adjacent reticular formation (Williams and Beitz 1989
). Intracellular recording studies showed that neurotensin exerts a direct
excitatory effect on PAG neurons (Behbehani et al. 1987
, 1988
). Thus it is very likely that neurotensin produces
the analgesic effect by directly exciting PAG neurons that project to
the RVM. To test this hypothesis, in the present study whole cell
patch-clamp recordings and intracellular Ca2+
fluorescence measurement were performed to investigate the ionic and
molecular mechanisms by which neurotensin modulates the excitability of
retrogradely labeled PAG-RVM projection neurons.
| |
METHODS |
|---|
|
|
|---|
Retrograde labeling and acute isolation of rat PAG-RVM projection neurons
Rat PAG neurons that project to the RVM were retrogradely
labeled by 1,1'-dioctadecyl-3,3,3'3'-tetramethyl-indocarbo cyanine (DiIC18; Molecular Probes, Eugene, OR) as
described previously (Kangrga and Loewy 1995
;
Osborne et al. 1996
). Briefly, 11- to 13-day-old
Sprague-Dawley rats were anesthetized with ether and placed in a
stereotaxic frame. After exposing the dura by trephination, DiIC18 dissolved in DMSO (20 mg/ml) was pressure
injected into the RVM (injection volume, ~100 nl).
Three to 4 days after the DiIC18 injection,
PAG-RVM projection neurons were acutely dissociated according to the
procedures described previously (Wu and Wang 1996
;
Wu et al. 1995
). Briefly, rats were terminally
anesthetized with pentobarbital sodium and decapitated. The whole brain
was quickly removed, and 300-µm-thick midbrain slices containing the
PAG were prepared by using a Vibratome slicer in the ice-cold
PIPES-buffered Ringer solution containing (in mM) 120 NaCl, 5 KCl, 20 NaHCO3, 2 MgSO4, 2 CaCl2, 1 KH2PO4, 10 glucose, and 15 PIPES, pH 7.4. Ventrolateral and lateral segments of the PAG were
excised and incubated for 20 min at 32°C in an oxygenated PIPES
saline solution (in mM: 125 NaCl, 5 KCl, 2 CaCl2, 2 MgSO4, 10 glucose, and 15 PIPES, pH 7.4)
containing 0.5 mg/ml pronase E (Sigma, St. Louis, MO). Then tissue
segments were triturated with a Pasteur pipette, and dissociated
neurons were plated onto polylysine-coated coverslips and kept at a
100% O2 atmosphere for 30 min. Subsequently,
DiIC18 retrogradely labeled PAG-RVM neurons were
identified under the epifluorescence illumination (rhodamine filter)
and selected for whole cell patch-clamp recordings or the measurement
of intracellular calcium level.
To confirm the injection site and visualize the distribution of
DiIC18-labeled neurons in the PAG, brain was
quickly dissected and fixed in the phosphate-buffered saline containing
4% paraformaldehyde. Subsequently, 100-µm vibratome sections of the
PAG or RVM were prepared and observed by the fluorescence microscopy.
Although a small amount of DiIC18 spread
laterally into the NRG
and NRPG, the majority of
DiIC18 injections examined (n = 5) were applied directly into the NRM (data not shown).
Whole cell voltage- and current-clamp recordings
Acutely dissociated PAG-RVM neurons were voltage and current
clamped by using the conventional whole cell version of patch-clamp techniques (Hamil et al. 1981
). Patch pipettes with a
resistance of 3-4 M
were fabricated from hard borosillicate glasses
using a pipette puller (P-87, Sutter Instruments, Novato, CA). Holding potentials, data acquisition, and analysis were controlled by an
on-line personal computer programmed with AxoTape 2.0 and pCLAMP 6.0 (Axon Instruments, Foster City, CA). Current and voltage signals obtained by a patch-clamp amplifier (Axopatch-200A, Axon Instruments) were filtered at 2 kHz, digitized (Digidata 1200A interface, Axon Instruments) and stored on the hard disk of the computer for a later analysis.
The extracellular solution had the following composition (in mM): 145 NaCl, 3 KCl, 2 CaCl2, 1 MgCl2, 15 glucose, and 10 HEPES (pH 7.3 with
NaOH). The recording pipette was filled with (in mM) 65 KCl, 70 KF, 1 MgCl2, 0.1 CaCl2, 1.1 EGTA, 2 ATP, 0.3 GTP, and 5 HEPES (pH
7.3 with KOH). Liquid junction potentials were corrected as described
previously (Barry and Lynch 1991
). Series resistance was
usually <0.10 M
, and the compensation circuitry of the amplifier
was used to minimize the series resistance error. In some experiments,
GTP was replaced by guanosine-5'-O-(2-thiodiphosphate) (GDP-
-S) or
guanosine-5'-O-(3-thiotriphosphate) (GTP-
-S). Neurotensin peptides
(Peninsula, Belmont, CA) were dissolved in the external solution and
applied to neurons using pressure ejections (Picospritzer, General
Valve, Fairfield, NJ) from blunt micropipettes (diameter, 20-30 µm).
Prism program (GraphPad Software) was used to analyze the dose-response
curve. Experiments were performed at room temperature (22-25°C).
Intracellular administration of the
anti-G
q/11 antibody
Rabbit polyclonal antiserum (QL) directed against the common
carboxyl decapeptide of
G
q and
G
11 was purchased from
Du Pont/NEN (Boston, MA). This antibody has been shown to block various
G
q/11-mediated effects
including phospholipase C activation, inositol(1,4,5) trisphosphate
(IP3)-evoked calcium release and cationic
currents (Murthy and Makhlouf 1994
; Wang and Wu
1996
; Wu and Wang 1996
).
Anti-G
q/11 antibody was
dissolved in a slightly modified internal solution (1:50 dilution;
final concentration was approximately 0.5 mg/ml) containing 0.2% BSA
and 1 mM GTP. For whole cell patch-clamp recordings, the tip of patch
electrode was filled with antiserum-free pipette solution, and
electrode was backfilled with the internal solution containing the
anti-G
q/11 antibody.
Antiserum-free solution in the tip of patch pipette not only
facilitated the formation of high-gigaohm seal but also made it
possible to record neurotensin-evoked membrane currents before the
antibody diffused into PAG-RVM neurons and antagonized G
q/11-mediated effects.
As controls, antiserum was heated at 90°C for 10 min and then used
for whole cell recordings as described above. After the whole cell
patch-clamp recordings, the successful intracellular dialysis of the
anti-G
q/11 antibody was
confirmed by performing immunofluorescence stainings with Texas
Red-conjugated goat anti-rabbit IgG (Vector, Burlingame, CA).
Single-cell reverse transcriptase-polymerase chain reaction (RT-PCR) assay
To study the expression of
G
q and
G
11 mRNAs in single
PAG-RVM projection neurons, single-cell RT-PCR assay was performed as
described previously (Wang and Wu 1996
; Wu and
Wang 1996
). Briefly, after finishing whole cell patch-clamp
recordings, the cellular content was aspirated into the tip of patch
pipette by applying a gentle suction. The first strand cDNA was
synthesized in a reaction volume of 30 µl containing 3 mM
MgCl2, 50 mM Tris-HCl (pH 8.3), 77 mM KCl, 10 mM
dithiothreitol, 8 ng/µl random hexamers, 1 mM of each deoxynucleotide 5'-triphosphate, 20 U of ribonuclease inhibitor (Promega, Madison, WI),
and 150 U of Moloney murine leukemia virus reverse transcriptase (Promega) for 1 h at 42°C. Then the reaction mixture was heated at 90°C for 5 min and used as the DNA template for the PCR.
PCR was carried out in a programmable thermal controller with the
following oligonucleotide primers. 1) Sense primer for
G
q is
5'GGTGTCTGCTTTTGAGAATCCATA3' and corresponds to nucleotides 359-382 of
mouse G
q
(Strathmann and Simon 1990
). 2) Sense primer
for G
11 is
5'GACCTGGAGAACATCATCTTCAGG3' and corresponds to nucleotides 582-605 of
mouse G
11 (Strathmann and Simon 1990
). 3) Common
antisense primer for G
q and G
11 is
5'GTACTCCTTCAGGTTCAGCTGCAG3' and corresponds to nucleotides 1044-1067
of mouse G
q and
G
11. With these primers,
the predicted sizes of PCR products for
G
q and
G
11 cDNA fragments are
709 and 486 bp, respectively. Aliquots of PCR products were separated
and visualized in an ethidium bromide-stained agarose gel (1.5%) by
the electrophoresis. PCR DNA fragments encoding G
q and
G
11 were also gel
purified and used for the dideoxy chain-termination DNA sequencing
(Thermo Sequenase cycle sequencing kit, Amersham, Cleveland, OH).
Intracellular Ca2+ measurement
[Ca2+]i of PAG-RVM
neuron was measured using the fluorescence ratio imaging with fura-2 AM
(acetoxymethyl ester) as described previously (Thomas and
Delaville 1991
). Briefly, acutely dissociated PAG neurons were
loaded with 5 µM fura-2 AM for 30 min at room temperature, and then
washed and incubated for an additional 20 min in PIPES-buffered saline
solution. Experiments were performed on the stage of Nikon Diaphot
microscope equipped with a 75 W Xenon lamp, a ×40 oil immersion
objective (Nikon Fluor, NA 1.3) and a filter changer (Lambda10-2,
Sutter Instruments) controlled by Axon Imaging Workbench (AIW) software
(Axon Instruments). Fura-2 was excited at 340 and 380 nm, and emission
fluorescence above 510 nm was collected. Fluorescent images were
acquired with a digital charge-coupled device camera (SenSys,
Photometrics, Tucson, AZ) and analyzed by using AIW software.
Calibration of [Ca2+]i
value was carried out by using fura-2 calcium imaging calibration kit (Molecular Probes) and the equation (Grynkiewicz et al.
1985
) [Ca2+]i = Kd × [(R
Rmin)/(Rmax
R)] × Sf2/Sb2.
R is the ratio of 340/380 nm excitation fluorescence value.
Rmin and
Rmax are fluorescence ratio values
measured at Ca2+-free and saturating
Ca2+ conditions, respectively.
Sf2/Sb2
is the ratio of fluorescence intensities for calcium-free and
calcium-bound fura-2 obtained with 380 nm excitation.
Statistics
All results are expressed as means ± SE value of n experiments. Mann-Whitney test (2-tailed) was used to determine whether the difference was statistically significant (P < 0.01).
Materials
GDP-
-S and GTP-
-S were purchased from Boehringer Mannheim.
Heparin and staurosporine were obtained from RBI (Natick, MA), and
1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid
(BAPTA) from Molecular Probes.
{2-[(1-(7-chloro-4-quinolinyl)-5-2(2,6-dimethoxyphenyl)pyrazol-3-yl)carbonylamino]-tricyclo (3.3.1.1.3.7)decan-2-carboxylic
acid} (SR 48692) and
{2-[(5-(2,6dimethoxyphenyl)-1-(4-(N-(3-dimethylaminopropyl)-N-methylcarbamoyl)-2-isopropyl-phenyl)-1H-pyrazole-3-carbonyl)-amino} adamantane-2-carboxylic
acid} (SR 142948A) were kindly provided by Dr. Danielle Gully (Sanofi
Recherche, France).
| |
RESULTS |
|---|
|
|
|---|
Identification of PAG-RVM projection neurons
To identify PAG neurons that project to the PAG-RVM,
DiIC18, a retrograde tracing dye, was
microinjected into the rat RVM. In accordance with previous
retrograde-labeling studies (Beitz et al. 1983
;
Osborne et al. 1996
; Reichling and Basbaum
1990
), DiIC18-labeled neurons were found
in the ventrolateral, lateral, and dorsomedial divisions of the PAG,
but were scarce in the dorsolateral PAG (data not shown). In the
present study, DiIC18 retrogradely labeled
neurons were acutely dissociated from the ventrolateral and lateral
PAG, which mediate the antinociceptive effect by sending projections to
the RVM (Bandler and Shipley 1994
). Consistent with
previous studies (Osborne et al. 1996
; Reichling
and Basbaum 1990
), most of retrogradely labeled PAG-RVM neurons
(about 70%) were small bipolar cells (diameter, 12-15 µm; Fig.
1, A and B). Other
labeled PAG-RVM projection neurons were larger multipolar cells
(diameter, 15-20 µm; Fig. 1, C and D).
|
Neurotensin excites PAG-RVM projection neurons by enhancing a nonselective cationic conductance
In agreement with previous studies (Behbehani et al.
1987
; Sanchez and Ribas 1991
), acutely isolated
bipolar or multipolar PAG-RVM neurons exhibited spontaneous action
potentials. The spontaneous firing frequency ranged between 5 and 15 Hz
(mean firing rate, 6.1 ± 1.5 Hz, mean ± SE,
n = 27), and the membrane input resistance was 650 ± 57 M
(n = 27). Sixty-five percent of bipolar or
multipolar PAG-RVM neurons studied (n = 247) responded
to neurotensin with the induction of inward current at the negative
membrane potential and a membrane depolarization. During whole cell
current-clamp recordings, neurotensin (1 µM) increased the firing
rate of spontaneously active PAG-RVM neurons (data not shown) and
triggered action potentials from PAG-RVM projection neurons
(n = 21) hyperpolarized to prevent the spontaneous
firing (Fig. 2A). Consistent
with a previous study (Behbehani et al. 1987
), the
excitatory effect of neurotensin on PAG-RVM projection neurons resulted
from a reversible depolarization of 12-15 mV (Fig. 2A).
Under voltage clamp at a holding potential (VH) of
60 mV, neurotensin (1 µM)
evoked an inward current reversibly (Fig. 2B, 21 ± 2 pA, n = 125 cells) and with a concentration-dependent manner (Fig. 2C; EC50 = 84 nM).
NT(8-13) (3 µM), the C-terminal hexapeptide fragment of neurotensin,
also depolarized the PAG-RVM neurons by evoking inward currents (mean
amplitude, 16 ± 1 pA, n = 8, VH =
60 mV). These results indicate
that neurotensin depolarizes and excites PAG-RVM projection neurons by
evoking an inward current at negative membrane potentials.
|
To investigate the ionic mechanism by which neurotensin induces inward
currents in PAG-RVM projection neurons, a current-voltage curve was
constructed by measuring neurotensin-evoked currents at various holding
potentials. Neurotensin (1 µM)-induced currents reversed the
direction at
15 ± 2 mV (n = 12 neurons), a
reversal potential expected for nonselective cation channels, and were linear over the holding potentials between
100 and 40 mV (Fig. 3). Reducing the external sodium
concentration from 145 to 70 mM greatly decreased the magnitude of
neurotensin-evoked inward current. When the sodium concentration was
decreased to 70 mM (NaCl was replaced by Tris-HCl), the amplitude of
neurotensin-induced inward current at the holding potential of
60 mV
was 10 ± 2 pA (n = 8; with 145 mM NaCl, control
neurotensin current was 21 ± 2 pA). When internal and
extracellular potassium ions were replaced by Cs+
ions, neurotensin (1 µM) still evoked inward currents from PAG-RVM neurons reversibly at the holding potential of
60 mV (mean magnitude, 20 ± 1 pA, n = 5). With a recording solution
containing cesium ions, current-voltage (I-V) curve of
neurotensin-activated current was also linear over the range of
membrane potentials (
100 to 40 mV) studied, and the average
extrapolated reversal potential was
12 ± 2 mV
(n = 5). These findings suggest that neurotensin depolarizes PAG-NRM neurons by opening voltage-insensitive and nonselective cation channels, which are permeable to
Na+, K+, and
Cs+ ions.
|
Up to now, subtype 1 neurotensin receptor (NTR-1) and subtype 2 neurotensin receptor (NTR-2), which possess the seven transmembrane structure of G-protein-coupled receptors, have been cloned from the
rat brain (Vincent et al. 1999
). SR 48692, a highly
potent nonpeptide antagonist of NTR-1
(Kd = 3 nM), has been shown to inhibit
neurotensin-mediated biological effects (Gully et al. 1993
). However, SR 48692 (10 µM) failed to prevent
neurotensin (1 µM) from evoking inward cationic currents in
DiIC18-labeled PAG-RVM neurons (Fig.
4A; control NT current,
20 ± 2 pA; with SR 48692, NT current, 19 ± 2 pA,
n = 8, VH =
60 mV).
In the presence of 10 µM SR 142948A, a potent nonselective antagonist
of NTR-1 (Kd = 6 nM) and NTR-2
(Kd = 4 nM) (Gully et al.
1997
), neurotensin (1 µM) still evoked cationic currents
(Fig. 4B; control NT current, 20 ± 1 pA; with SR
142948A, NT current, 19 ± 2 pA, n = 8, VH =
60 mV). In contrast to a
previous study showing that SR 48692 and SR 142948A activate NTR-2
artificially expressed in the Chinese hamster ovary (CHO) cells
(Yamada et al. 1998
), SR 48692 and SR 142948A did not
affect the membrane potential and spontaneous firing rate of
DiIC18-labeled PAG-RVM neurons. Our investigation indicated that 100 nM SR 48692 or SR 142948A completely blocked neurotensin (5 µM)-evoked cationic currents in acutely dissociated substantia nigra dopaminergic neurons (Wu et al. 1995
;
Li and Wang, unpublished results). These findings propose that
neurotensin excites PAG-RVM projection neurons by activating a novel
subtype of neurotensin receptors.
|
G
q/11 proteins couple neurotensin
receptors to cation channels of PAG-RVM neurons
Neurotensin receptor is a member of the superfamily of
G-protein-coupled receptors (Vincent et al. 1999
),
suggesting that G-proteins are involved in neurotensin activation of
nonselective cationic conductance. This hypothesis was tested by
dialyzing retrogradely labeled PAG-RVM neurons with GTP analogues,
GDP-
-S and GTP-
-S. GDP-
-S binds to G-proteins and causes an
irreversible inactivation of G-proteins. When PAG-RVM projection
neurons were dialyzed with 1 mM GDP-
-S, the mean amplitude of NT
current obtained 1 min after starting recordings was 22 ± 1 pA
(n = 10, VH =
60 mV). However, neurotensin-induced current became significantly smaller
after perfusing PAG-RVM neurons with GDP-
-S for 3-5 min (Fig.
5B, P < 0.01). Neurotensin failed to evoke cationic currents in PAG-RVM neurons
dialyzed with 1 mM GDP-
-S for 7 min (Fig. 5, A and
B).
|
One minute after initiating the recording, neurotensin evoked an inward
current reversibly (mean magnitude, 23 ± 3 pA, n = 10, VH =
60 mV) from PAG-RVM
neurons dialyzed with 0.5 mM GTP-
-S, an irreversible activator of
G-proteins (Fig. 5C). When PAG-RVM projection neurons were
internally perfused with 0.5 mM GTP-
-S for 7 min, neurotensin evoked
cationic currents irreversibly (Fig. 5, C and D).
Following the irreversible induction of cationic currents, subsequent
application of neurotensin did not induce any membrane current.
Internal perfusion of GTP-
-S or GDP-
-S did not affect the resting
membrane properties of PAG-RVM neurons. When
DiIC18-labeled PAG-RVM neurons were studied with
control internal solution containing 0.3 mM GTP, neurotensin-evoked
cationic currents were totally reversible and did not display any
significant rundown for 10-15 min after the initiation of whole cell
recordings (the initial amplitude of neurotensin current, 21 ± 2 pA; after 15 min, mean amplitude, 19 ± 3 pA, n = 8, VH =
60 mV). These results
suggest that G-proteins couple neurotensin receptors to nonselective
cation channels of PAG-RVM projection neurons.
Neurotensin receptor has been shown to be linked to
G
q/11- phospholipase C
pathway (Vincent et al. 1999
; Wang 1997
).
Our previous investigation demonstrated that G
q/11 couples
neurotensin receptors to nonselective cation and inwardly rectifying
potassium channels of substantia nigra dopaminergic neurons
(Wang and Wu 1996
; Wu et al. 1995
). To
investigate the functional role of
G
q/11 in mediating the
neurotensin enhancement of cationic conductance of PAG-RVM neurons, we
dialyzed DiIC18-labeled PAG-RVM neurons with a
specific antibody (QL) raised against the common C-terminus of
G
q and
G
11 during the whole
cell voltage-clamp recordings. Successful perfusion of PAG-RVM neurons
with the anti-G
q/11 antiserum was confirmed by performing the immunofluorescence staining after the whole cell recordings (data not shown). When PAG-RVM neurons
(n = 10) were perfused with the
anti-G
q/11 antiserum for
1 min, neurotensin still evoked inward currents (Fig.
6A). After dialyzing PAG-RVM
neurons for 4 min, neurotensin-induced inward currents became
significantly smaller (Fig. 6C, P < 0.01). Twelve minutes after the initiating whole cell recordings, neurotensin failed to evoke the inward cationic current (Fig. 6, A and
C). When retrogradely labeled PAG-RVM neurons
(n = 10) were internally perfused with the
heat-inactivated
anti-G
q/11 antibody, the
initial amplitude of neurotensin-evoked cationic current was 20 ± 2 pA. After internally perfusing PAG-RVM neurons with the
heat-inactivated antiserum for 12 min, neurotensin-induced cationic
currents were not significantly inhibited (Fig. 6, B and
C; mean amplitude, 18 ± 1 pA). Furthermore, internal
perfusion of the
anti-G
q/11 antibody did
not affect the resting electrical properties of retrogradely labeled
PAG-RVM neurons. These results clearly indicate that the inhibition of neurotensin-evoked cationic current by the
anti-G
q/11 antibody is
due to the specific block of neurotensin
receptor-G
q/11 coupling.
|
The anti-G
antibody used in the present study
recognizes both G
q and
G
11. To test the
possibility that G
q or
G
11 selectively mediates
the neurotensin activation of cationic conductance, we also
investigated the expression of mRNAs encoding
G
q and
G
11 in individual
PAG-RVM projection neurons. In these experiments, neurotensin-induced
membrane currents were recorded from PAG-RVM neurons. After finishing
whole cell voltage-clamp recordings, the cellular content of each
neuron was aspirated to the tip of patch electrode and utilized for the subsequent reverse transcription. One-half of the reverse transcription product was used for the PCR amplification of cDNA encoding
G
q or
G
11. To amplify mRNAs
encoding G
q and
G
11, we designed two
G
-subunit specific forward primers and a
common reverse primer for both
-subunits. With these primers, the
predicted sizes of PCR products for
G
q and
G
11 cDNA fragments are
709 and 486 bp, respectively. In 10 DiIC18-labeled PAG-RVM neurons, neurotensin
evoked the inward cationic current (Fig.
7A; mean amplitude, 21 ± 2 pA, VH =
60 mV). Subsequent single-cell RT-PCR analysis revealed that putative
G
q and
G
11 cDNA fragments with
expected sizes were amplified from all 10 neurons studied (Fig.
7B). DNA sequencing using PCR DNA product indicated that
709- and 486-bp DNA fragments correspond to rodent
G
q and
G
11 cDNAs, respectively
(data not shown). Amplified PCR DNA products were not observed when
reverse transcriptase was omitted (data not shown, n = 5 neurons), indicating that PCR DNA products derived from
G
q and
G
11 mRNA transcripts
rather than contaminating genomic DNA. These results suggest that both
G
q and
G
11 mRNAs are expressed
in neurotensin-responsive PAG-RVM projection neurons.
|
IP3-evoked Ca2+ release mediates the neurotensin enhancement of cationic conductance
Receptor-activated Gq/11 proteins cause the
stimulation of phospholipase C (PLC), and PLC hydrolyzes
phosphatidylinositol 4,5-bisphosphate and generates second messengers,
inositol (1,4,5) trisphosphate (IP3) and
diacylglycerol. Subsequently, IP3 evokes the
Ca2+ release from intracellular stores, and
diacylglycerol activates protein kinase C (Helper and Gilman
1992
). Gq/11 proteins could couple
neurotensin receptors to cation channels either indirectly via second
messengers, diacylglycerol and IP3, or through a
membrane-delimited pathway without involving intracellular second
messengers (Hille 1994
).
The possible role of protein kinase C in mediating neurotensin
enhancement of the cationic conductance was tested by adding staurosporine, a potent inhibitor of protein kinase C, into the pipette
solution during whole cell voltage-clamp recordings (Wu et al.
1995
). In PAG-RVM projection neurons dialyzed with 10 µM staurosporine for 10 min, neurotensin (1 µM) still evoked cationic currents at the holding potential of
60 mV (Fig.
8A; mean magnitude, 20 ± 1 pA, n = 8; control response, 21 ± 2 pA). This
finding suggests that protein kinase C is not involved in the
neurotensin modulation of cationic conductance of PAG-RVM projection
neurons.
|
To investigate the role of IP3 in mediating the
enhancement of cationic conductance by neurotensin, heparin (2 mg/ml),
an IP3 receptor antagonist (Cruzblanca et
al. 1998
; Wu et al. 1995
), was included in the
internal solution during whole cell recordings. Neurotensin (1 µM)-evoked cationic current was blocked after the intracellular
administration of heparin for 7-10 min (Fig. 8B; initial
magnitude of neurotensin current, 23 ± 2 pA, n = 8, VH =
60 mV). These results
suggest that IP3 is essential for the neurotensin
activation of cationic conductance of PAG-RVM projection neurons.
IP3 evokes the Ca2+ release
from the intracellular stores, and the subsequent rise in the
intracellular calcium concentration evokes various cellular responses
including the modulation of ionic conductance (Hille
1994
). The hypothesis that IP3-evoked Ca2+ release mediates the neurotensin enhancement
of cationic conductance was first tested by measuring the intracellular
Ca2+ level with the aid of fura-2 fluorescence
measurement. When applied to DiIC18-labeled
PAG-RVM neurons, neurotensin (1 µM) induced a rapid rise in the
cytoplasmic Ca2+ level (Fig. 8C; basal
Ca2+ level, 126 ± 17 nM; with neurotensin,
Ca2+ level, 322 ± 35 nM, n = 10). Neurotensin still increased the intracellular
Ca2+ level when experiments were performed in a
Ca2+-free external solution containing 1 mM EGTA
(basal Ca2+ level, 113 ± 15 nM; with
neurotensin, Ca2+ level, 226 ± 16 nM,
n = 9). The functional role of
Ca2+ as the messenger of neurotensin modulation
of cationic conductance was further investigated by buffering
intracellular Ca2+ with a fast
Ca2+ chelator, BAPTA. In retrogradely labeled
PAG-RVM neurons dialyzed with 10 mM BAPTA for 7-9 min, neurotensin (1 µM) failed to evoke cationic currents (Fig. 8D; initial
amplitude of neurotensin current, 25 ± 2 pA, n = 10, VH =
60 mV). Together with the
finding that the intracellular dialysis of heparin blocks
neurotensin-induced cationic currents, these results suggest that
IP3-evoked Ca2+ release is
responsible for the neurotensin enhancement of cationic conductance of
PAG-RVM projection neurons.
| |
DISCUSSION |
|---|
|
|
|---|
To gain insight into the cellular and molecular mechanisms by
which neurotensin produces an antinociceptive effect in the PAG, we
investigated the electrophysiological effect of neurotensin on
retrogradely labeled PAG-RVM neurons. Consistent with published studies
(Osborne et al. 1996
; Reichling and Basbaum
1990
), our results indicate that PAG-RVM projection neurons are
small bipolar or large multipolar cells. A previous investigation
showed that electrolytic lesions of RVM abolished the
neurotensin-induced analgesia in the PAG and that microinjection of
neurotensin into the PAG led to an excitation of NRM neurons
(Behbehani and Pert 1984
), suggesting that neurotensin
produces the antinociceptive effect by directly exciting PAG neurons
that project to the RVM. The results reported here, for the first time,
provide the direct evidence that neurotensin depolarizes and excites
DiIC18-retrogradely labeled PAG-RVM projection neurons.
Inflammatory pain stimulus has been shown to cause neurotensin release
within the PAG (Williams et al. 1995
). It has also been
reported that both preproneurotensin mRNA and neurotensin peptide are
up-regulated within PAG neurons in rat models for the chronic
nociception (Williams and Beitz 1993
). Together with the
results presented here, these findings suggest that endogenous neurotensin is released in response to the nociceptive stimulus and
modulates the spinal pain transmission by exciting PAG-RVM projection
neurons. In contrast to a direct excitation of PAG-RVM neurons by
neurotensin, opioid peptides and morphine are believed to disinhibit
PAG-RVM projection neurons by hyperpolarizing and decreasing the
activity of GABAergic interneurons, which tonically inhibit descending
output neurons (Vaughan et al. 1997
). Interestingly, morphine and
[D-Ala2,N-methyl-Phe4,Gly-ol5] enkephalin
(DAMGO), a specific µ-opioid receptor agonist, have been reported to
induce an increase of neurotensin release in the PAG (Stiller et
al. 1997
), proposing that the excitation of PAG-RVM projection
neurons by endogenous neurotensin could also contribute to the
opioid-mediated analgesia in the PAG.
Although a previous study demonstrated that neurotensin depolarizes
periaqueductal gray neurons (Behbehani et al. 1987
), the exact ionic mechanism of neurotensin-induced excitation in the PAG has
not been investigated. Our voltage-clamp recordings suggest that
neurotensin depolarizes PAG-RVM projection neurons through enhancing a
voltage-independent and nonselective cationic conductance. In
accordance with the present study, it has been reported that neurotensin depolarizes supraoptic nucleus neurons by opening nonselective cation channels (Kirkpatrick and Bourque
1995
). On the other hand, neurotensin has been shown to excite
cholinergic neurons of nucleus basalis, serotonergic neurons of the
dorsal raphe nucleus, ventral tegmental and substantia nigra
dopaminergic neurons through a dual ionic mechanism, an increase in the
nonselective cationic conductance, and a decrease in the potassium
conductance (Farkas et al. 1994
; Jiang et al.
1994
; Jolas and Aghajanian 1996
; Wu et
al. 1995
).
Neurotensin receptor is believed to be a member of the family of
Gq-coupled receptors (Vincent et al.
1999
; Wang 1997
). Among the members of
Gq family, including Gq,
G11, G12,
G13, and Gz (Helper
and Gilman 1992
), Gq and
G11 are highly expressed in the brain
(Milligan 1993
). To investigate the involvement of
G
q and
G
11 in mediating the
neurotensin enhancement of cationic conductance,
anti-G
q/11 antibody raised against the common C-terminal decapeptide of
G
q and
G
11 was dialyzed into
DiIC18-labeled PAG-RVM neurons during the whole
cell recordings. Our results indicate that internal perfusion of
PAG-RVM neurons with
anti-G
q/11 antiserum
completely blocks neurotensin-evoked cationic currents. Although the

dimer of G protein could also function as the mediator of
neurotransmitter modulation of ion channels (Herlitze et al.
1996
), the present study suggests that
-subunits of
Gq/11 mediate the neurotensin enhancement of
cationic conductance of PAG-RVM projection neurons.
The anti-G
q/11 antiserum
used in the present study recognizes both
G
q and
G
11. Therefore we
studied the expression of
G
q and
G
11 in individual
PAG-RVM neurons. Single-cell RT-PCR analysis demonstrates that both
G
q and
G
11 mRNAs are present in
NT-responsive PAG-RVM projection neurons. This finding suggests that
neurotensin modulation of cationic conductance is mediated either by
both G
q and
G
11 or by one of these
two
-subunits. The first hypothesis is supported by the following
findings. 1)
G
q and
G
11 share 97% amino
acid sequence identity in C-terminal domains, which couple
neurotransmitter receptors to various effectors, and indistinguishably
activate phospholipase C-
isoforms (Helper and Gilman
1992
; Sternweis and Smircka 1992
). 2)
Agonist stimulations of M1 muscarinic,
vasopressin, and bombesin receptors lead to the activation and
down-regulation of both
G
q and
G
11 (Mullaney et
al. 1993
; Offermanns et al. 1994
), indicating
that these neurotransmitter receptors interact with both
G
q and
G
11 equally and
nonselectively. However, intranuclear injection of DNA plasmid encoding
the antisense sequence of
G
q selectively
attenuated the muscarinic inhibition of M-type potassium currents in
sympathetic neurons (Haley et al. 1998
). Moreover, it
has been shown that pretreating ventromedial hypothalamic neurons with
G
11 antisense
oligonucleotide blocked muscarinic inhibition of delayed rectifier
K+ currents (ffrench-Mullen et al. 1994
). These
findings suggest that G-protein-coupled receptors could interact
selectively with G
11 or
G
q. Further studies
using the specific antisense oligonucleotide to
G
q or
G
11 are required to
elucidate the exact coupling mode between
G
q/11 and neurotensin receptors of PAG-RVM projection neurons.
G
q/11 could couple
neurotensin receptors to nonselective cation channels of PAG-RVM
neurons either indirectly through second messengers or directly in a
membrane-delimited way. The present study suggests that activation of
neurotensin receptors in PAG-RVM projection neurons results in the
stimulation of phospholipase C and the generation of
IP3 via Gq/11 proteins. The
subsequent IP3-evoked Ca2+
release is responsible for the opening of nonselective cation channels
(Patridge et al. 1994
). This transduction pathway is supported by the following findings. 1) Heparin, an
antagonist of IP3 receptor, inhibited the
neurotensin enhancement of cationic conductance. 2)
Neurotensin rapidly induced the release of Ca2+
from intracellular stores. 3) Neurotensin-evoked cationic
current was blocked by BAPTA. In accordance with the present study, our previous investigation showed that
G
q/11 couples NTR-1
receptors to cation channels of substantia nigra dopaminergic neurons
indirectly through the
IP3-Ca2+ signaling pathway
(Wu et al. 1995
).
SR 48692, a nonpeptide antagonist of NTR-1, has been shown to block
several neurotensin-mediated pharmacological effects in the brain,
which include neurotensin excitation of midbrain dopaminergic neurons,
neurotensin-evoked dopamine efflux in the striatum, and turning
behavior induced by neurotensin (Gully et al. 1993
;
Wu et al. 1995
). However, the present study demonstrates
that SR 48692 fails to inhibit neurotensin excitation of
DiIC18-labeled PAG-RVM neurons, suggesting that
neurotensin-induced analgesia in the PAG is not mediated by the
activation of NTR-1. In agreement with the present study, it has been
reported that SR 48692 fails to antagonize neurotensin-induced
antinociception in the brain (Dubuc et al. 1994
).
Subtype 2 neurotensin receptor (NTR-2) with a low affinity for SR 48692 has also been cloned from the brain (Vincent et al.
1999
). NTR-2 has been reported to partially mediate central and
SR 48692-resistant analgesic effect of neurotensin (Dubuc et
al. 1999
; Gully et al. 1997
). Our results
demonstrate that SR 142948A, a potent antagonist of NTR-1 and NTR-2,
fails to prevent neurotensin from exciting retrogradely labeled PAG-RVM neurons. In contrast to the present study showing that neurotensin enhances the nonselective conductance of PAG-RVM projection neurons through IP3-Ca2+ pathway,
the exact signal transduction pathway of neurotensin-activated NTR-2 is
still unknown (Vincent et al. 1999
). Furthermore,
several groups of investigators reported that neurotensin (1 µM)
fails to induce IP3 formation and intracellular
Ca2+ mobilization in CHO or HEK 293 cells
expressing a high density of NTR-2 (Botto et al. 1998
;
Yamada et al. 1998
). Therefore it is very likely that
neurotensin exerts an excitatory effect on PAG-RVM neurons and produces
an analgesic effect by activating a novel subtype of neurotensin
receptors. Further studies using the molecular cloning method are
required to prove the existence of an additional subtype of neurotensin
receptors, which mediates the neurotensin-induced analgesia in the PAG.
In summary, the present study provides the evidence that the central
antinociceptive action of neurotensin in part results from the
excitation of PAG-RVM projection neurons. In addition to NTR-2, which
has been shown to mediate the central antinociceptive effect of
neurotensin (Dubuc et al. 1999
; Gully et al.
1997
), the results presented here suggest that an additional
subtype of neurotensin receptors mediate neurotensin excitation of
PAG-RVM neurons and neurotensin-induced analgesia in the PAG. Future
development of specific agonists for neurotensin receptors mediating
the central analgesia could lead to a better clinical management of the pain.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by the National Science Council (NSC89-2320-B-182-057) and Chang Gung Research Foundation (CMRP 555).
| |
FOOTNOTES |
|---|
Address for reprint requests: H.-L. Wang (E-mail: hlwns{at}mail.cgu.edu.tw).
Received 24 July 2000; accepted in final form 21 December 2000.
| |
REFERENCES |
|---|
|
|
|---|
-subunit of delayed rectifier K+ current in rat ventromedial hypothalamic neurons.
J Physiol (Lond)
474:
21-26, 1994
subunit of Gq contributes to muscarinic inhibition of potassium current in sympathetic neurons.
J Neurosci
18:
4521-4531, 1998
subunits.
Nature
380:
258-262, 1996[Medline].
and Gq
in rat brain.
J Neurochem
61:
845-851, 1993[Web of Science][Medline].
and G11
equally and non-selectively.
FEBS Lett
324:
241-245, 1993[Web of Science][Medline].
subunits is present in vertebrates and invertebrates.
Proc Natl Acad Sci USA
87:
9113-9117, 1990
q/11 mediates neurotensin excitation of substantia nigra dopaminergic neurons.
Mol Brain Res
36:
29-36, 1996[Medline].
q/11 mediates cholecystokinin activation of the cationic conductance in rat substantia nigra dopaminergic neurons.
J Neurochem
66:
1060-1066, 1996[Web of Science][Medline].This article has been cited by other articles:
![]() |
V. A. Mitchell, H. Kawahara, and C. W. Vaughan Neurotensin inhibition of GABAergic transmission via mGluR-induced endocannabinoid signalling in rat periaqueductal grey J. Physiol., June 1, 2009; 587(11): 2511 - 2520. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sarret, M. J. Esdaile, A. Perron, J. Martinez, T. Stroh, and A. Beaudet Potent Spinal Analgesia Elicited through Stimulation of NTS2 Neurotensin Receptors J. Neurosci., September 7, 2005; 25(36): 8188 - 8196. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. St-Gelais, M. Legault, M.-J. Bourque, P.-P. Rompre, and L.-E. Trudeau Role of Calcium in Neurotensin-Evoked Enhancement in Firing in Mesencephalic Dopamine Neurons J. Neurosci., March 10, 2004; 24(10): 2566 - 2574. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |