|
|
||||||||
The Journal of Neurophysiology Vol. 87 No. 2 February 2002, pp. 750-760
Copyright ©2002 by the American Physiological Society
Department of Oral and Craniofacial Biological Sciences, Dental School; and Program in Neuroscience, University of Maryland, Baltimore, Maryland 21201
| |
ABSTRACT |
|---|
|
|
|---|
Miki, Kenji,
Q.-Q. Zhou,
W. Guo,
Y. Guan,
R. Terayama,
R. Dubner, and
K. Ren.
Changes in Gene Expression and Neuronal Phenotype in Brain Stem
Pain Modulatory Circuitry After Inflammation.
J. Neurophysiol. 87: 750-760, 2002.
Recent studies indicate that
descending pain modulatory pathways undergo time-dependent changes in
excitability following inflammation involving both facilitation and
inhibition. The cellular and molecular mechanisms of these phenomena
are unclear. In the present study, we examined
N-methyl-D-aspartate (NMDA) receptor gene
expression and neuronal activity in the rostral ventromedial medulla
(RVM), a pivotal structure in pain modulatory circuitry, after complete
Freund's adjuvant (CFA)-induced hindpaw inflammation. The reverse
transcription polymerase chain reaction analysis indicated that there
was an upregulation of mRNAs encoding NMDA receptor subunits in the RVM
after inflammation. The increase in the NR1, NR2A, and NR2B receptor
mRNAs started at 5 h, maintained for 1-7 days (P < 0.05-0.001) and returned to the control level at 14 days after
inflammation. Western blot analysis indicated that the protein
translation products of the NR2A subunit were also increased
(P < 0.01). In single-unit extracellular recordings, we correlated RVM neuronal activity with the paw withdrawal response in
rats with inflammation. We describe these RVM cells as on-, off-, and
neutral-like cells because of their similarity to previous studies in
which neuronal responses were correlated with tail-flick nocifensive
behavior in the absence of inflammation. In contrast to previous
studies in the absence of inflammation, using tail flick as a
behavioral correlate, fewer off-like cells in naïve animals
exhibited a complete pause before the paw withdrawal to a noxious
thermal stimulus. The percentage of cells showing a pause of activity
after noxious stimulation was further reduced after inflammation
(
2 P < 0.0001 vs.
naïve rats). Continuous neuronal recordings (3-6.5 h) revealed
a phenotypic switch of RVM neurons during the development of
inflammation: 11/15 neutral-like cells initially unresponsive to
noxious stimuli exhibited and maintained response profiles characteristic of pain modulatory neurons (became off-like:
n = 5; became on-like: n = 6).
Neutral-like cells recorded in noninflamed animals did not show
response profile changes during continuous recordings (5-5.5 h,
n = 7). A population study (n = 165)
confirmed an increase in on- and off-like cells and a decrease in
neutral-like cells at 24 h after inflammation as compared with
naïve rats (P < 0.001). These results suggest
that enhanced NMDA receptor activation mediates time-dependent changes
in excitability of RVM pain modulatory circuitry. The functional
phenotypic switch of RVM neurons provides a novel mechanism underlying
activity-dependent plasticity and enhanced net descending inhibition
after inflammation.
| |
INTRODUCTION |
|---|
|
|
|---|
Recent studies have addressed the role of descending brain stem
pathways in the development of dorsal horn hyperexcitability and
chronic or persistent pain (see Dubner and Ren 1999
;
Ren et al. 2000
for reviews). A key finding is that in
response to a persistent tissue injury, the activation of pain
modulatory pathways is enhanced (Hurley and Hammond
2000
; Kauppila et al. 1998
; Ren and
Dubner 1996
; Schaible et al. 1991
;
Tsuruoka and Willis 1996
; Urban and Gebhart
1999
). The descending pathways also undergo time-dependent
changes in excitability after injury. There is an initial decrease and
a subsequent increase in the excitability of descending pathways
following inflammation (Terayama et al. 2000a
). Further,
the increased descending modulation involves both facilitation and
inhibition (Urban and Gebhart 1999
; Wei et al.
1999
; also see Vanderah et al. 2001
), and the
interaction between these pathways will dictate the development of
spinal hyperexcitability and hyperalgesia.
Behavioral evidence suggests that changes in excitability occur in
neurons in the rostral ventromedial medulla (RVM), a pivotal structure
in pain modulatory circuitry (Fields et al. 1991
), after hindpaw inflammation (Terayama et al. 2000a
). In lightly
anesthetized rats, focal electrical stimulation of the RVM inhibited
nociceptive paw withdrawal and tail flick in an intensity-dependent
manner. The intensity of the electrical stimulus needed to produce
inhibition decreased over time, suggesting changes in the excitability
of brain stem pain modulatory circuitry. Microinjection of selective N-methyl-D-aspartate (NMDA) receptor antagonists
prevented the inflammation-induced increase in RVM excitability
(Terayama et al. 2000a
). Thus the enhanced descending
modulation appears to be mediated by changes in the activation of the
NMDA excitatory amino acid (EAA) receptor in the RVM. However, the
cellular and molecular mechanisms underlying these dynamic changes in
excitability remain unclear.
The NMDA receptor is assembled with NR1 and NR2A-D subunits. NR1 and
NR2 subunits have been shown to be distributed in the RVM region
(Watanabe et al. 1994
; Wenzel et al.
1995
). Two types of neurons, on and off cells, have been
identified as pain modulatory neurons in RVM because their response
properties are correlated with the nocifensive tail-flick reflex (see
Fields et al. 1991
). On cells are characterized by a
sudden increase in firing immediately before initiation of the
tail-flick reflex, and off cells exhibit a pause in activity just prior
to the tail flick reflex. The third class of RVM neurons, neutral
cells, show no consistent change in activity associated with transient
nociceptive reflexes. The activity of on and off cells has been
associated with facilitation and inhibition of pain transmission,
respectively. The role of neutral cells in pain modulation is unclear.
It is generally believed that they are not involved in descending
modulation, although recent studies suggest that neutral cells do play
a role (Ellrich et al. 2000
). Whether these different
classes of neurons play a role in the endogenous mechanisms responsible
for changes in excitability in the RVM after inflammation is not known.
In the present study, we provide new evidence that time-dependent
plasticity in the pain modulatory circuitry involves changes in NMDA
receptor gene expression and a phenotypic switch of RVM neurons.
Preliminary results have been reported (Miki et al.
2000
; Terayama et al. 2000b
).
| |
METHODS |
|---|
|
|
|---|
Inflammation
Male Sprague-Dawley rats (200-400 g, Harlan, Indianapolis) were used. Inflammation was induced with complete Freund's adjuvant (CFA, Sigma, St. Louis) suspended in an oil/saline (1:1) emulsion and injected (0.1 mg Mycobacterium sc) into the hindpaw. The injection produces an intense tissue inflammation characterized by erythema, edema, and hyperalgesia. This animal model has been approved by the University of Maryland Dental School Animal Care and Use Committee.
Reverse transcription-polymerase chain reaction (RT-PCR)
Rats were overdosed with pentobarbital (100 mg/kg). A brain stem
block including the ventral half and middle 3-mm portion of the rostral
medulla was dissected at 2 and 5 h and 1, 3, 7, and 14 days after
inflammation. This block of tissue mainly included RVM structures, but
excluded the facial nucleus and inferior olive. Total RNA was isolated
using the TRIzol reagent (Gibco BRL Life Technologies). The RNA samples
were treated with DNAse I to remove residual genomic DNA. The
first-strand cDNA was synthesized with SuperScript RNase
H
reverse transcriptase (Gibco BRL) at 42°C
for 1 h. The reaction product was used as the RT-PCR template. The
PCR primers were designed according to published sequences of NMDA NR1,
and NR2 receptor subunits: NR1, CTGCAACCCTCACTTTTGAG (sense);
TGCAAAAGCCAGCTGCATCT (antisense); NR2A, GACGGTCTTGGGATCTTAAC (sense);
TGACCATGAATTGGTGCAGG (antisense); NR2B, CAAGAACATGGCCAACCTGT
(sense); GGTACACATTGCTGTCCTTC (antisense). Glyceraldehyde
phosphate dehydrogenase (GAPDH) mRNA RT-PCR was used as an internal
control: TGAAGGTCGGTGTGAACGGATTTGGC (sense); CATGTAGGCCATGAGGTCCACCAC
(antisense). All primers were synthesized by Genosys (Sigma). Each PCR
reaction mixture (0.1 ml) contained: 10 ng synthesized cDNA, 0.01 mM of
each of the 5' and 3' sequence-specific primers, 4 deoxynucleoside
triphosphates (0.2 mM each), 5 U recombinant Taq DNA
polymerase (Gibco BRL), 10 µM Tris-HCl (pH 9.0 at 20°C), 1.5-2.3
mM MgCl2, and 50 mM KCl. Template dilution
analysis was conducted to determine that the amount of cDNA template to
be used in the reaction was in the linear range. The temperature cycle
(Robocycler Infinity, Stratagene) was: 94°C/3 min (initial
denaturing), 94°C/1 min (denaturing), 45-55°C/1 min (annealing),
and 72°C/1 min (extension). A total of 25-30 cycles and a final
10-min extension at 72°C were conducted. The PCR product samples were
loaded in parallel with a 100-bp DNA ladder (Gibco) on a 2% ethidium
bromide-stained agarose gel. The gel image was scanned for
densitometric analysis (Scion National Institutes of Health Image
1.60). All specific PCR product bands were normalized to respective
GAPDH bands because its expression is not regulated by manipulations
within the design of these experiments (MacArthur et al.
1999
). The raw data from three individual experiments were used
for statistical analysis (ANOVA with post hoc Fisher's PLSD test). The
relative mRNA levels under different experimental conditions, as
indicated by the PCR product, were then illustrated as a percentage of
the naive controls for the purpose of comparison. The positive PCR
bands were purified (Wizard DNA clean-up kit, Promega) and the
sequences of the PCR products verified (ABI 373 DNA Sequencer). Mock
RT-PCR reaction controls included the omitting of reverse
transcriptase, primers, or template. No specific PCR product was found
in control reactions.
Western blot
The brain stem tissues were removed as described in the preceding text and homogenized in solubilization buffer (50 mM Tris-HCl, pH 8.0; 150 mM NaCl, 1 mM EDTA, 1% N-P40, 0.5% deoxycholic acid, 0.1% SDS, 1 mM Na3VO4, 1 U/ml aprotinin, 20 µg/ml leupetin, and 20 µg/ml pepstatin A). The homogenate was centrifuged at 14,000 rpm for 10 min at 4°C. The supernatant was removed. The protein concentration was determined using a detergent-compatible protein assay with a bovin serum albumin standard. Proteins (50 µg) were separated on a 7.5% SDS-PAGE gel and blotted to nitrocellulose membrane (Amersham) with a trans-blot transfer cell system (Bio-Rad). The blots were blocked with 5% milk in TBS buffer (20 mM Tris, 150 mM NaCl, pH 7.4) at room temperature for 30 min. After decanting the blocking buffer, the blot was incubated with anti-goat NR2A antibody (1:1000, Santa Cruz) overnight at 4°C. The membrane was washed with TBS buffer and incubated for 1 h with anti-goat IgG horseradish peroxidase (1:3,000, Santa Cruz) in 5% milk/TBS. The membrane was then washed three times with TBS buffer. The immunoreactivity was detected using enhanced chemiluminescence (Amersham). The films were scanned and quantified by densitometry (National Institutes of Health Image 1.60). The loading of equal amounts of protein was verified with Coomassie blue staining. ANOVA and unpaired two-tailed t-tests were used to determine significant differences between sample groups.
Neuronal recording
Animals were anesthetized initially with pentobarbital sodium
(40-45 mg/kg ip), and catheters inserted into a jugular vein and the
trachea. The rat was placed in a stereotaxic apparatus (David Kopf).
The medulla was exposed, covered with an agar pool, and filled with
warm mineral oil. During the recording session, a light level of
anesthesia was maintained by a continuous infusion of pentobarbital
(3-10 mg · kg
1 · h
1 iv). Body temperature (37.5-38.0°C) was
maintained with a heating pad. The level of anesthesia was maintained
such that a consistent paw withdrawal response was evoked by a noxious
thermal stimulus, but there were no other exaggerated nocifensive
behaviors (also see Fields et al. 1983a
). This animal
preparation preserves a consistent level of response withdrawal to
noxious stimuli and develops consistent inflammation and increased
responses to noxious stimuli that are comparable to that seen in awake
animals (Terayama et al. 2000a
).
Extracellular single neuronal recordings were made with tungsten
microelectrodes (FHC, 10 M
) from the RVM region (
10.3 to
11.3 mm
to the Bregma, 1 mm lateral to the midline). Neurons were searched for
by light touch with a brush on the hindpaw, although most neurons
exhibited background activity. Once a single neuron was isolated, a
noxious thermal stimulus was applied to the hindpaw to elicit
withdrawal responses. Electromyographic (EMG) activity related to paw
withdrawal was recorded simultaneously to mark the onset of a paw
withdrawal, allowing the activity of the neuron to be correlated to the
paw withdrawal. The neurons were then classified according to the
temporal relationship of their responses to the paw withdrawal behavior
(see RESULTS). Neuronal and EMG activity were displayed on
an oscilloscope and stored on a computer for off-line analysis with
Spike 2 (CED). During continuous recordings, we ensured that recordings
were from the same neurons by isolating units with a window
discriminator and monitoring spike configuration throughout the
recording session (Spike 2, CED).
Rats were overdosed with pentobarbital sodium (100 mg/kg) at the
conclusion of the experiment and perfused with 4% paraformaldehyde. The sections of brain stem tissue were stained with cresyl violet for
verification of recording sites according to Paxinos and Watson (1998)
. The RVM refers to the region including nucleus raphe
magnus, nucleus reticularis gigantocellularis pars alpha, and nucleus paragigantocellularis lateralis.
To determine whether changes in neuronal activity after a noxious
stimulus were statistically significant, a cumulative-sum (cusum)
technique (Davey et al. 1986
; Ren et al.
1989
) was employed on each neuron. The cusum integrates
differences from a mean control level of counts in a peristimulus time
histogram and can be used to detect and verify changes in neuronal
activity. In the present study, cusums were derived from peristimulus
time histograms of neuronal activity by a bin-by-bin analysis
(binwidth = 10 ms) and represent the cumulative differences from
the mean activity level averaged from a 10-s period immediately before
a stimulus (Davey et al. 1986
; Ren et al.
1989
). To differentiate the deviation of a cusum from normal
fluctuations in neuronal activity, the variance of the cusum was
calculated according to Davey et al. (1986)
. The
statistical limit for normal fluctuations of cusums is set at ±3 SD of
the cusum and plotted (Davey et al. 1986
). The deviation
of the cusum beyond the 3 SD of the cusum indicates a significant
change in activity.
| |
RESULTS |
|---|
|
|
|---|
NMDA receptor gene expression
We examined NR1, NR2A, and NR2B subunit mRNA expression in the RVM
tissue in naïve and hindpaw-inflamed rats. The RT-PCR analysis
indicated that there was an upregulation of mRNAs encoding NR1, NR2A,
and NR2B receptor subunits in the RVM after induction of inflammation
and hyperalgesia (Fig. 1). The increase
in the NR1, NR2A, and NR2B receptor mRNAs started at 5 h after
inflammation, although only the increase in the NR2B subunit mRNA
reached statistical significance at this time point (P < 0.05; Fig. 1B). At 1-7 days post-CFA time points, the
three NMDA receptor subunits exhibited significant increases in mRNA
expression (P < 0.05-0.001; Fig. 1B). All
mRNAs returned to the control level by 14 days after inflammation. The
upregulation of NMDA receptor protein was verified by Western blot
analysis. We chose to examine the protein levels of the NR2A subunit,
which showed the largest increase in mRNA levels. Figure
2A shows an example of Western
immunoblot using polyclonal antibodies against the NR2A subunit of the
NMDA receptor. Compared to naive controls, there was an increase in
NR2A subunit proteins after inflammation. ANOVA revealed a significant
effect over the time course of experiment (P < 0.01).
Post hoc analysis indicated that the increase in NR2A protein levels
was significant at 1-7 days post-CFA (Fig. 2B). These
results are consistent with the hypothesis that enhanced NMDA receptor
activation mediates time-dependent changes in excitability of RVM pain
modulatory circuitry (Terayama et al. 2000a
). These
time-dependent changes in excitability led us to determine if there
were changes in the response properties of RVM neurons.
|
|
RVM neurons in inflamed rats
Extracellular single-unit recordings were made from the brain stem in rats lightly anesthetized with pentobarbital sodium. Histological staining confirmed that the recording sites were localized to the RVM (Fig. 3). Most neurons (n = 188) were recorded from the nucleus raphe magnus and nucleus reticularis gigantocellularis pars alpha. A few neurons (n = 7) were in the lateral paragigantocellular nucleus or in the area just dorsal to the RVM.
|
We have correlated RVM neuronal activity with the paw
withdrawal response to thermal stimuli in rats after inflammation.
We describe these RVM cells as on-, off-, and neutral-like cells because of their similarity to previous studies in which neuronal responses were correlated with tail-flick nocifensive behavior (Fields et al. 1991
). On-like cells were characterized
by a sudden increase in firing immediately before initiation of the paw
withdrawal response (Fig. 4A),
off-like cells exhibited a depression in activity just prior to the paw
withdrawal response (Fig. 4C), and neutral-like cells showed
no change in activity associated with the nocifensive paw withdrawal
behavior (Fig. 5, A and
C). Cumsum analysis indicated that stimulus-induced changes
in neuronal activity were statistically significant (Fig. 4,
B and D). Neuronal activity was better correlated with the nocifensive behavior than the onset of the heat stimulus (Fig.
5, B and D), consistent with previous studies
using tail flick as a behavioral correlate (Fields et al.
1983b
).
|
|
In contrast to previous studies, in the absence of inflammation, fewer
off-like cells exhibited a complete pause before the paw withdrawal
response to a noxious thermal stimulus (Fig.
6A). The percentage of
off-like cells showing a complete pause of activity after noxious
stimulation was significantly lower after inflammation (
2 P < 0.0001, vs.
naïve rats, Table 1). Most
off-like cells (97%) recorded from the inflamed rats showed a sudden
large reduction of activity prior to paw withdrawal (Figs.
4C, 5B, and 6B). Although not
statistically significant, off-like cells recorded in inflamed animals
tended to have a higher level of background firing (mean, 18.9 ± 2.4; range, 0.50-59.1; n = 36), when compared with
that in naive rats (mean, 13.8 ± 1.8; range, 3.3-19.7;
n = 10). The difference in background activity may have
contributed to the lack of a complete pause of activity of off-like
cells in inflamed rats because it would be more difficult to induce a
complete pause in firing when background activity is high.
|
|
Phenotypic switch of RVM neurons
Our previous studies have identified a critical period within
24 h after inflammation that dynamic changes in descending
modulation occurred (Terayama et al. 2000a
). There is an
initial decrease and a subsequent increase in net descending modulation
at 3 and 9-12 h after inflammation, respectively. The enhanced
descending inhibition appears to peak at 24 h after inflammation,
a time consistent with an increase in NMDA receptor gene expression in RVM (see preceding text). We chose to record during this time frame
with the expectation that changes in neuronal activity would be
detected. It is apparent that the NMDA receptor mRNA and protein levels
peaked and plateaued at 24 h after inflammation. Although we
followed the longer time course in our biochemical experiments, we did
not pursue further time points in neuronal recordings. We determined
whether the response profiles of RVM neurons correlated with the
temporal changes in excitability in the RVM after inflammation. In the
first set of experiments, we recorded activity from single units for
3-6.5 h starting from 2 to 11 h and ending from 7 to 17 h
after CFA injection. One neuron was recorded between 18 and 23 h
after inflammation. The similarity of the action potential waveforms
and the constant levels of background firing over the recording period
assured us that the same neuron was being analyzed (Figs.
7 and 8).
During the course of inflammation, some neutral-like cells changed
their activity and exhibited response profiles of off- and on-like
cells. As shown in Fig. 7, a neuron was classified as a neutral-like
cell initially (Fig. 7A, 19 h post-CFA). The same
neuron started to exhibit an on-like response profile to 48°C
stimulus at 20 h (Fig. 7B) and maintained such a
profile during the course of the recording (Fig. 7, C and
D). As shown in Fig. 5A, at 9 h after CFA
injection, another neuron was classified as a neutral-like cell because
there was not a clear relationship between the firing pattern and the
paw withdrawal response. This neuron started to show off-like activity
from 10.5 h after CFA injection. Figure 5B shows that
at 14.5 h after CFA near the end of the recording period, there
was a large reduction of activity of this neuron after the start of the
noxious heat stimulus and immediately prior to the onset of the paw
withdrawal, characteristics of the neuronal discharge pattern of an
off-like cell. Another neutral-like cell recorded from 2 h after
CFA (Fig. 5C), exhibited at 5.5 h a burst of activity
immediately (within 1 s) prior to the onset of the paw withdrawal
(Fig. 5D), characteristic of the firing pattern of an
on-like cell. This change in response profile was maintained for
1.5 h for the remainder of the recording period. No cells that
were originally on-like (n = 10) or off-like
(n = 5) changed their response profiles during a 5-h
recording period in inflamed rats. In a group of control rats without
inflammation, neutral-like cells were continuously recorded in a time
frame similar to that in inflamed rats. We did not observe response profile changes during the long recording period (5-5.5 h,
n = 7) in these noninflamed rats.
|
|
A cusum analysis was performed on each RVM neuron to confirm their functional classifications. The result indicated that the changes in activity of neutral-like cells to off- and on-like neurons in inflamed rats were statistically significant (Fig. 5). Eleven of 15 cells that were initially neutral-like cells exhibited maintained profile changes during recordings (became off-like cells, n = 5; became on-like cells, n = 6). The remaining four neutral-like cells recorded post-CFA exhibited neutral-like profiles at the end of the recording period.
The changes in response profiles of RVM neurons did not appear to correlate with a change in background firing. As shown in Fig. 8, C and D, most RVM neurons exhibited relatively constant levels of background activity. Among neurons showing phenotypic changes, only two neutral-to-on-like cells showed a relatively large reduction of background firing during or after the changes in response profile (Fig. 8D). The changes in response profiles were not transient. Neurons that were switched from neutral-like to on- or off-like cells did not reverse to neutral-like cells in the remaining recording session that lasted for 2.3 ± 0.4 h (range, 1-4.5 h).
In a second set of experiments, we recorded neurons from noninflamed
(n = 72) and 24 h post-CFA (n = 93) animals for shorter time periods (Table
2). There was a significant increase in
the percentage of on- and off-like cells and a decrease in the
percentage of neutral-like cells recorded 24 h after CFA from heat
stimulation of the inflamed paw as compared with naïve rats
(P < 0.001,
2). The mean peak
response frequency of on-like cells was significantly increased in
inflamed as compared with naïve rats (P < 0.05; Fig. 9A). For off-like
responses, the mean percent reduction of neuronal activity immediately
before the onset of a withdrawal response was significantly less in
inflamed rats (P < 0.001; Fig. 9B).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
We have presented new evidence that persistent inflammation induces changes in NMDA receptor gene expression and a phenotype switch of neurons in the RVM pain-modulatory circuitry. The findings provide a cellular mechanism that underlies the activity-dependent plasticity contributing to modulation of persistent pain at supraspinal in addition to spinal levels. The response profile switch of brain stem neurons suggests a novel mechanism for enhanced descending inhibition after injury.
EAAs and their receptors play a prominent role in descending modulatory
effects originating from brain stem sites (Aimone and Gebhart
1986
; Beitz 1990
; Jensen and Yaksh
1992
; Jones and Gebhart 1988
; Spinella et
al. 1996
). All three classes of RVM cells (on, off, and
neutral) are activated by exogenous administration of glutamate
(Heinricher and Roychowdhury 1997
). These previous studies, however, did not address the possible changes in EAA receptor
gene expression associated with activation of pain modulatory circuitry. Recently, it was shown that the administration of the NMDA
selective receptor antagonist, 2-amino-5-phosphonovaleric acid (AP-5),
into the RVM, blocked the facilitation of the tail flick reflex for
1-3 h produced by mustard oil application to the hindleg (Urban
et al. 1999
), indicating the involvement of EAAs in endogenous
mechanisms of persistent pain. It was further established that the
time-dependent increase in excitability in brain stem circuitry
associated with persistent nociceptive activity is NMDA receptor
dependent (Terayama et al. 2000a
). The present study
demonstrates that there is a prolonged upregulation of NMDA receptor
subunit gene expression and protein levels in the brain stem in
response to persistent peripheral tissue injury. This upregulation
occurred at a time when there were dramatic changes in descending
modulation (Ren and Dubner 1996
; Terayama et al. 2000a
). These results complement our previous findings that
increased EAA neurotransmission contributes to inflammation-induced
hyperexcitability of RVM circuitry and enhanced descending inhibition
of nociception.
The central terminals of peripheral nociceptors in the spinal dorsal
horn release a number of chemical mediators including the EAA,
glutamate, the major excitatory neurotransmitter in the dorsal horn.
These chemical mediators contribute to an increase in the excitability
of neurons ("central sensitization") in the dorsal horn of the
spinal cord via actions at ionotropic receptors and G-protein-coupled
receptors (Dubner and Ruda 1992
; Neugebauer et
al. 2000
; Ren et al. 1992
; Woolf and
Salter 2000
; Woolf and Thompson 1991
). The
critical role of ionotropic NMDA receptors in central sensitization at
the spinal level has been shown by a number of groups (Dougherty
and Willis 1992
; Ren et al. 1992
; Woolf
and Thompson 1991
). The present study provides evidence that,
supraspinally, there is also an enhanced EAA neurotransmission that
initiates and maintains the descending modulation, i.e., a putative
brain stem central sensitization, during persistent inflammation and hyperalgesia. This supraspinal central sensitization may be brought about by a cascade of events including neuronal depolarization, removal of the voltage-dependent magnesium block of the
NMDA receptor, calcium entry into the cells, phosphorylation of the
NMDA receptor, a change in the cell's kinetics, and resulting hyperexcitability (increase in synaptic strength) (Woolf and
Salter 2000
).
In previous studies, the response properties of three classes of
neurons in the RVM, on, off, and neutral cells have mainly focused on
animals without preexisting injury (Fields et al. 1983a
, 1991
; Heinricher et al. 1999
; Mason
1997
; Morgan and Fields 1994
). We have used paw
withdrawal as a behavioral correlate in lightly anesthetized rats to
assess the relationship between increased hindpaw responsiveness and
RVM neuronal activity. We describe these RVM neurons as "on-like,"
"off-like," and "neutral-like" cells, respectively, according
to the relationship of their responses to the paw withdrawal behavior.
Consistent with previous studies using tail flick as a behavioral
correlate (Fields et al. 1983b
; Heinricher et al.
1989
), the changes in neuronal activity are best correlated
with the paw withdrawal response. We also introduced a cumulative sum
analysis to verify statistically that the responses of on- and off-like
cells were related to nociception. Our preliminary results showed that
morphine inhibited on-like cell and facilitated off-like cell activity
(unpublished observations), consistent with their role in pain
modulation (also see Fields et al. 1991
). One difference
noted from previous studies using tail flick as a behavioral correlate
was that off-like cells did not always exhibit a complete pause of
activity after a noxious stimulus to the hindpaw. This was particularly
obvious in inflamed rats, perhaps due to an increase in ascending input
and a decrease in GABAergic inhibition of off cell activity (see
Fields et al. 1991
).
An important observation in the present study was that some initially
classified neutral-like cells changed their response profile and were
reclassified as on- or off-like cells during the continuous recordings
when there was ongoing inflammation. The analysis of interspike
intervals indicates that no spike intervals were within the range
(approximately 0.5-1 ms) of the absolute refractory period of an
action potential in our recording, suggesting that only one neuron was
recorded. By monitoring the action potential waveforms and the levels
of background activity, we were assured that the same neuron was being
analyzed during long-tem recordings. The possibility that the phenotype
changes we found in 11 neurons is due to a shift in recording to a
second neuron with the same waveform and level of background activity
(note the wide range of background activity of RVM neurons) is
unlikely. The apparent changes in response profiles of RVM neurons do
not appear to be related to changes in background activity nor the
anesthetic state. The background activity remained constant during the
3- to 6.5-h recording periods for almost all neurons. There also were
no differences in the mean interspike interval and coefficient of
variation of the interspike intervals between noninflamed and inflamed
animals. In addition, we have been able to maintain relative constant
levels of anesthesia in pentobarbital-anesthetized rats for a period
9 h (Terayama et al. 2000a
). We maintained the
recordings for 1-4 h after changes in neuronal profile to confirm that
the changes were not temporary. One earlier study suggested that there
might be an increase in the expression of off-like cells after
inflammation (Montagne-Clavel and Oliveras 1994
).
One caveat of the long-term extracellular single-unit recording is that, even with all precautions, one cannot be absolutely certain that the same one neuron is recorded since spike waveform may change over time and two neurons may have nearly identical waveforms. To verify the profile change of RVM neurons, we performed a population study. There was a significant increase in the percentage of on- and off-like cells and a decrease in the neutral-like cell population after inflammation, thus supporting the observations in the long-term recording experiments. It should be noted, however, that the population of neurons recorded in the present study in noninflamed and inflamed rats may not be represented equally because some RVM neurons may be overlooked due to their low levels of background activity and high mechanical thresholds. To avoid damage of the skin by repeated high-intensity stimuli, we did not use a high-intensity mechanical stimulus as a searching stimulus. If some neurons were to become spontaneously active with inflammation, they must be missed in the noninflamed group. Nevertheless, our combined population studies and long-term single-unit recordings are strongly suggestive of phenotypic changes in neutral cells after inflammation.
Our present findings do not rule out the possibility that the changes
in excitability of RVM neurons may be secondary to inflammation-induced changes in the spinal cord as we focused on responses of RVM neurons to
noxious stimulation of the inflamed paw in the present study. However,
previous evidence indicates that this is unlikely. The enhanced
descending modulation after inflammation occurred in inflamed as well
as noninflamed paws. This has been demonstrated by electrical
stimulation of the RVM (Terayama et al. 2000a
), chemical
stimulation of RVM with EAA receptor agonists (Guan et al.
2000
), and microinjection of opioid receptor agonists into the
RVM (Hurley and Hammond 2000
). Further, direct
stimulation of the dorsolateral funiculus that bypasses brain stem
synaptic mechanisms does not produce a similar change in excitability
in descending pathways (Terayama et al. 2000a
).
The increased excitability in RVM circuitry after inflammation involves
both facilitatory and inhibitory synaptic activity. Immediately before
the onset of a withdrawal response there was a greater increase in
on-like responses. The off-like responses, on the other hand, were
reduced after inflammation as suggested by a less reduction of neuronal
activity after a noxious stimulus and a lack of a complete pause.
Because a pause of off-like cell firing is associated with
disinhibition, a less reduction of neuronal activity and lack of a
complete pause suggest an increase in inhibitory synaptic activity.
These results confirm that the enhanced descending modulation after
inflammation involves both facilitation and inhibition as there are
changes in both on- and off-like cell activity. This effect of
inflammation is different from that of morphine, which suppresses on
cell activity and increases off cell activity (Fields et al.
1991
). However, it is difficult to predict the net
effect of descending modulation from changes in single neuronal
activity without recording from a large population of neurons (also see Heinricher and McGaraughty 1998
). Our previous studies
using a behavioral measure as an endpoint indicate an increased
net inhibition originating from RVM during the later phase
of inflammation (Terayama et al. 2000a
). The mechanisms
underlying the enhanced synaptic activation in RVM circuitry after
inflammation will require further investigation.
The present finding suggests that neutral-like cells also play a role
in the endogenous mechanisms responsible for changes in excitability in
the RVM after inflammation. The role of the neutral cell in opioid and
nonopioid descending inhibition in response to transient noxious
stimuli is poorly understood, although a subgroup of neutral cells are
serotonin-containing, project to the spinal dorsal horn, and express
mu-opioid receptors (Gao et al. 1998
; Mason
1997
; Potrebic et al. 1994
; Wang and
Wessendorf 1999
). Our previous studies suggest the involvement
of serotoninergic RVM neurons in increased descending inhibition after
inflammation (Wei et al. 1999
). However, we have
analyzed interspike intervals separately for individual classes of
neurons and found that the neurons recorded in the present study are
largely not serotoninergic neurons according to Mason
(1997)
(data not shown). Thus the nonserotoninergic population
of RVM cells is also involved in enhanced descending inhibition after
inflammation. The switch of the response profiles of RVM neurons
correlated with the temporal changes in excitability in the RVM after
inflammation (Terayama et al. 2000a
) and changes in NMDA
receptor gene expression. We propose that neutral-like cells in the RVM
constitute a functional class that has the capacity to enhance net
descending inhibition. The receptor mechanisms that account for the
phenotypic changes in neutral-like cells after inflammation appear to
be dependent on NMDA receptor activation. However, further studies are
required to identify the subclasses of RVM neurons that exhibit profile
change after inflammation and are also modulated by glutamatergic
transmission. It is likely that opioid peptide activation
(Hurley and Hammond 2001
) or GABA disinhibition, or
both, are also important in the initiation and maintenance of this RVM
plasticity (see Fields and Basbaum 1999
).
These findings emphasize that increased excitability in the spinal
dorsal horn after inflammation leads to increased NMDA receptor gene
expression and pain modulatory neuronal activity in the RVM and
enhanced descending modulation that may include shifts in the balance
between inhibitory and facilitatory components. This activity-dependent
plasticity in descending pain modulatory circuitry
complements the activity-dependent neuronal plasticity in
ascending pain transmission pathways (Dubner and Ruda
1992
).
| |
ACKNOWLEDGMENTS |
|---|
We thank E. Wade and S. Zou for technical support.
This work was supported by National Institutes of Health Grants DA-10275 and DE-07309.
| |
FOOTNOTES |
|---|
Address for reprint requests: K. Ren, Dept. OCBS, Rm. 5A12, University of Maryland, 666 W. Baltimore St., Baltimore, MD 21201 (E-mail: kren{at}umaryland.edu).
Received 25 June 2001; accepted in final form 23 October 2001.
| |
REFERENCES |
|---|
|
|
|---|
-opioid receptor mRNAs are expressed in spinally projecting serotonergic and nonserotonergic neurons of the rostral ventromedial medulla.
J Comp Neurol
404:
183-196, 1999[Web of Science][Medline].This article has been cited by other articles:
![]() |
L. Zhang and D. L. Hammond Substance P Enhances Excitatory Synaptic Transmission on Spinally Projecting Neurons in the Rostral Ventromedial Medulla After Inflammatory Injury J Neurophysiol, August 1, 2009; 102(2): 1139 - 1151. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Wei, W. Guo, S. Zou, K. Ren, and R. Dubner Supraspinal Glial-Neuronal Interactions Contribute to Descending Pain Facilitation J. Neurosci., October 15, 2008; 28(42): 10482 - 10495. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Villmann and C.-M. Becker On the Hypes and Falls in Neuroprotection: Targeting the NMDA Receptor Neuroscientist, December 1, 2007; 13(6): 594 - 615. [Abstract] [PDF] |
||||
![]() |
J. D. Carlson, J. J. Maire, M. E. Martenson, and M. M. Heinricher Sensitization of Pain-Modulating Neurons in the Rostral Ventromedial Medulla after Peripheral Nerve Injury J. Neurosci., November 28, 2007; 27(48): 13222 - 13231. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Budai, S. G. Khasabov, P. W. Mantyh, and D. A. Simone NK-1 Receptors Modulate the Excitability of ON Cells in the Rostral Ventromedial Medulla J Neurophysiol, February 1, 2007; 97(2): 1388 - 1395. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Winkler, S. M. Hermes, C. I. Chavkin, C. T. Drake, S. F. Morrison, and S. A. Aicher Kappa Opioid Receptor (KOR) and GAD67 Immunoreactivity Are Found in OFF and NEUTRAL Cells in the Rostral Ventromedial Medulla J Neurophysiol, December 1, 2006; 96(6): 3465 - 3473. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Guo, M. T. Robbins, F. Wei, S. Zou, R. Dubner, and K. Ren Supraspinal Brain-Derived Neurotrophic Factor Signaling: A Novel Mechanism for Descending Pain Facilitation J. Neurosci., January 4, 2006; 26(1): 126 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Kincaid, M. J. Neubert, M. Xu, C. J. Kim, and M. M. Heinricher Role for Medullary Pain Facilitating Neurons in Secondary Thermal Hyperalgesia J Neurophysiol, January 1, 2006; 95(1): 33 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kitagawa, K. Kanda, M. Sugiura, Y. Tsuboi, A. Ogawa, K. Shimizu, N. Koyama, H. Kamo, T. Watanabe, K. Ren, et al. Effect of Chronic Inflammation on Dorsal Horn Nociceptive Neurons in Aged Rats J Neurophysiol, June 1, 2005; 93(6): 3594 - 3604. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Brandt, T. A. Cummons, L. Potestio, S. J. Sukoff, and S. Rosenzweig-Lipson Effects of the N-Methyl-D-aspartate Receptor Antagonist Perzinfotel [EAA-090; [2-(8,9-Dioxo-2,6-diazabicyclo[5.2.0]non-1(7)-en-2-yl)-ethyl]phosphonic Acid] on Chemically Induced Thermal Hypersensitivity J. Pharmacol. Exp. Ther., June 1, 2005; 313(3): 1379 - 1386. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. McGaraughty, K. L. Chu, R. S. Bitner, B. Martino, R. E. Kouhen, P. Han, A. L. Nikkel, E. C. Burgard, C. R. Faltynek, and M. F. Jarvis Capsaicin Infused Into the PAG Affects Rat Tail Flick Responses to Noxious Heat and Alters Neuronal Firing in the RVM J Neurophysiol, October 1, 2003; 90(4): 2702 - 2710. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Petrenko, T. Yamakura, H. Baba, and K. Shimoji The Role of N-Methyl-D-Aspartate (NMDA) Receptors in Pain: A Review Anesth. Analg., October 1, 2003; 97(4): 1108 - 1116. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Liu, Z. Zhuang, P. W. Hoffman, and G. Bai Functional Analysis of the Rat N-Methyl-D-aspartate Receptor 2A Promoter: MULTIPLE TRANSCRIPTION START POINTS, POSITIVE REGULATION BY Sp FACTORS, AND TRANSLATIONAL REGULATION J. Biol. Chem., July 11, 2003; 278(29): 26423 - 26434. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Marinelli, C. W. Vaughan, S. A. Schnell, M. W. Wessendorf, and M. J. Christie Rostral Ventromedial Medulla Neurons That Project to the Spinal Cord Express Multiple Opioid Receptor Phenotypes J. Neurosci., December 15, 2002; 22(24): 10847 - 10855. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |