|
|
||||||||
The Journal of Neurophysiology Vol. 88 No. 1 July 2002, pp. 29-40
Copyright ©2002 by the American Physiological Society
1Kinsmen Laboratory, Department of Psychiatry, University of British Columbia, Vancouver, British Columbia V6T 1Z3; 2Program in Brain and Behavior, The Hospital For Sick Children, Toronto, Ontario, M5G 1X8; and 3Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario M5G 1X5 Canada
| |
ABSTRACT |
|---|
|
|
|---|
Wang, Sabrina, Zhengping Jia, John Roder, and Timothy H. Murphy. AMPA Receptor-Mediated Miniature Synaptic Calcium Transients in GluR2 Null Mice. J. Neurophysiol. 88: 29-40, 2002. AMPA-type glutamate receptors are normally Ca2+ impermeable due to the expression of the GluR2 receptor subunit. By using GluR2 null mice we were able to detect miniature synaptic Ca2+ transients (MSCTs) associated with AMPA-type receptor-mediated miniature synaptic currents at single synapses in primary cortical cultures. MSCTs and associated Ca2+ transients were monitored under conditions that isolated responses mediated by AMPA or N-methyl-D-aspartate (NMDA) receptors. As expected, addition of the antagonist 6-cyano-7-nitroquinoxalene-2,3-dione (CNQX, 3 µM) blocked the AMPA receptor-mediated MSCTs. Voltage-gated Ca2+ channels did not contribute to AMPA MSCTs because CdCl2 (0.1-0.2 mM) did not significantly alter the frequency or the amplitude of the MSCTs. The amplitude of AMPA MSCTs appeared to be regulated independently from event frequency since the two measures were not correlated (R = 0.023). Synapses were identified that only expressed MSCTs attributed to either NMDA or AMPA receptors. At synapses with only NMDA responses, MSCT amplitude was significantly lower (by 40%) than synapses expressing both NMDA and AMPA responses. At synapses that showed MSCTs mediated by both AMPA and NMDA receptors, the amplitude of the transients in each condition was positively correlated (R = 0.94). Our results suggest that when AMPA and NMDA receptors are co-expressed at synapses, mechanisms exist to ensure proportional scaling of each receptor type that are distinct from the presynaptic factors controlling the frequency of miniature release.
| |
INTRODUCTION |
|---|
|
|
|---|
Fast excitatory
synaptic transmission in the CNS is mediated by
-amino-3-hydroxy-5-methyl-4-isoxazlepropionate receptors (AMPARs)
and N-methyl-D-aspartate type glutamate
receptors (NMDARs). The AMPARs are assembled of four to five homologous
subunits (Ferrer-Montiel and Montal 1996
; Mano
and Teichberg 1998
; Rosenmund et al. 1998
). There are four types of AMPA receptor subunits termed GluR1-4 (or
GluRA-D). Different combinations of these subunits determine the
functional properties of AMPA receptors (Dingledine et al. 1999
). In heteromeric receptors, the GluR2 subunit is dominant in determining both Ca2+ permeability and
rectification properties. The unique properties of GluR2 are attributed
to a single amino acid referred to as the Q/R site in the pore-lining
M2 segment (Burnashev et al. 1992
; Hume et al.
1991
; Mishina et al. 1991
). This site is
subjected to nuclear RNA editing. In the edited GluR2, a positively
charged arginine (R) is present, whereas in the unedited form, a
neutral glutamine (Q) is present (Seeburg 1996
).
Although the subunit composition of AMPA receptors varies, they must
contain at least one edited GluR2 subunit to be
Ca2+ impermeable (Jonas and Burnashev
1995
). Results from combined whole cell patch-clamp recording
and reverse-transcription (RT) PCR amplification experiments indicate
that Ca2+ permeability of AMPARs are
inversely correlated with the relative abundance of GluR2 mRNA
(Bochet et al. 1994
; Geiger et al. 1995
).
The edited GluR2 subunit makes up more than 99% of GluR2 subunits in
rat brain at all developmental stages (for reviews, see Jonas
and Burnashev 1995
; Seeburg 1996
), indicating
that the majority of AMPA receptors in the adult CNS are
Ca2+ impermeable. However, there are small
populations of cells lacking the GluR2 subunit and expressing
Ca2+ permeable AMPARs, for example, Bergmann glia
cells in cerebellum and most interneurons of the hippocampus and
cerebral cortex (Jonas and Burnashev 1995
;
Petralia et al. 1997
).
Given the importance of the AMPAR in processes ranging from plasticity
to cell death (Dingledine et al. 1999
), approaches that
directly evaluate the function of AMPARs at single synapses are
required. Previously NMDA receptor function has been assayed at single
synapses using Ca2+ imaging techniques
(Kovalchuk et al. 2000
; Mainen et al.
1999
; Malinow et al. 1994
; Muller and
Connor 1991
; Murthy et al. 2000
; Petrozzino et al. 1995
; Segal 1995
;
Yuste and Denk 1995
). In this study, we have used
cortical cultures from GluR2 null animals (Jia et al.
1996
), which have Ca2+-permeable
AMPARs on all neurons, combined with Ca2+
imaging techniques to assess the feasibility of imaging AMPAR function.
Although, the morphology of neurons in culture may change, they provide
a tractable system in which rapid pharmacological manipulations can be
made. For example by applying selective antagonists we can isolate
MSCTs mediated by either AMPA or NMDA receptors in cultures prepared
from the GluR2 null animals. AMPAR-mediated MSCTs were attributed to
direct entry of Ca2+ through the receptor. By
alternating between conditions specific for NMDA and AMPA
receptor-mediated MSCTs, we provide data suggesting that the degree of
NMDA and AMPA receptor activation is proportionally scaled at
individual synapses in a manner independent of the frequency of
miniature release.
| |
METHODS |
|---|
|
|
|---|
Animals and cell culture
Cortical neuron and glial cell cultures were derived from E19 to
20 GluR2 knockouts or wild-type (control) littermate mice. The GluR2
knockout animals originated from a colony of CD1 × 129 crosses
generated at the Samuel Lunenfeld Research Institute, Mount Sinai
Hospital, Toronto (Jia et al. 1996
). The animals used for these experiments were from two to seven generations held at
University of British Columbia animal facility. Our animal protocol was
approved by the Committee on Animal Care University of British Columbia
(animal-care certificate A99-0042) and followed Canadian Council on
Animal Care guidelines.
Culture methods and conditions were modified from Murphy and
Baraban (1990)
and Mackenzie et al. (1996)
.
Briefly, cortices and hippocampi were dissected from each fetus and
placed in separate dishes containing ice-cold phosphate-buffered
saline. A small tissue sample was taken from each carcass for
extraction of genomic DNA, and PCR was used to verify the genotype of
each fetus. Our experiments indicated that the cultures were best if
they were produced from embryonic animals. In this case, it was not
possible to genotype each embryo before culturing it. Therefore each
embryo was dissected and processed separately. To speed the process up (typically 5-6 fetuses were done) and increase the yield from each
animal, we combined the cortex and hippocampus neurons. The cortices
and hippocampi of each fetus were placed (dissociated together) in
conical tubes containing 10 ml papain solution (20 units/ml) in
Earle's balanced salt solution (EBSS) for 15 min at 37°C to
dissociate the cells. The dissociated cells (mixed hippocampal and
cortical) were then pelleted for 3-4 min and the supernatant
discarded. The pellets from each tube were transferred to fresh conical
tubes containing 5 ml DNAase (0.005%) solution containing 1 mg/ml
bovine albumin and trypsin inhibitor type II and triturated several
times with fire-polished glass pipettes to further separate the cells.
The DNAase digestion was stopped by slowly dripping 3-5 ml 0.1%
wt/vol bovine serum albumin and 0.1% wt/vol trypsin inhibitor type II
in EBSS down the side of the conical tube to create a DNAase- and
papain-free layer at the bottom of the tube. The cells were then
pelleted by low-speed centrifugation for 3-4 min. The supernatants
were discarded and the cells from each conical tube were re-suspended
in 8 ml plating medium and seeded (2 ml per dish; density = about
1.2 million cells/ml) into poly-D-lysine-coated 35-mm
glass-bottomed dishes (MatTek, Ashland, MA). The plating medium was
composed of minimal essential medium and 10% fetal calf serum, and
10% heat inactivated horse serum. Some cells were plated on
poly-D-lysine-coated 35-mm aclar 33C (a nonfluorescent
plastic substrate 0.127 mm thick)-bottomed dishes. Aclar was obtained
from Proplastics (Linden, NJ). Cultures were kept in vitro for at least
10 days before use in imaging experiments.
Genotype PCR assay
The PCR genotyping procedure was provided by Dr. Franco A. Taverna. To identify wild-type GluR2 allele, we used the following primers FTR2A (CAGCAGATTTAGCCCCTACG) and FTR2B (CCTCACAAACACACCATTTCC) to generate a 623-bp band. To identify the GluR2 null neo insertion, we used the FTR2B and FTneoA (GGATGATCTGGACGAAGAGC) primers to generate a 1,022-bp band. For each 20 µl reaction, we used 1 µg genomic DNA (in Tris-EDTA buffer), 2 µl 10 × buffer, 0.4 µl dNTPs (10 mM stock, 200 µM final), 200 ng primer (FTR2A, FTR2B or FTneoA), and 0.2 µl Taq DNA polymerase (1 U, Boehringer Mannheim GmbH, Germany). The balance of the solution contained milliQ H2O (added first to ensure that the DNA did not precipitate). A drop of DNAase-free mineral oil was placed on top of the reaction solution. The PCR cycles are 94°C for 40 s, 60°C for 30 s, 72°C for 1 min, 30 cycles, and a final 72°C for 7 min.
Experimental procedures
In all experiments, cultures were continuously perfused in a bathing medium containing (in mM) 137 NaCl, 5.0 KCl, 2.5 CaCl2, 1 MgSO4, 0.34 Na2HPO4(7H2O), 10 NaHEPES buffer, 1 NaHCO3, 0.0003 tetrodotoxin, 0.1 picrotoxin, and 22 glucose (pH 7.4 and approximately 315 mosM). MgSO4 and CaCl2 concentrations were altered as indicated. A double-barreled theta application tube was placed near the recording site to rapidly change solutions during imaging. One barrel was filled with a AMPAR-isolating condition solution that contained the bathing solution with the following changes: 5 mM CaCl2, 0 mM MgSO4, 5 µM glycine, 20-100 µM cyclothiazide, and 100 µM of the NMDA receptor blocker D,L-2-amino-5-phosphonovaleric acid (D,L-APV). The other barrel was filled with an NMDAR-isolating solution containing the bathing solution with the following changes: 5 mM CaCl2, 0 mM MgSO4, 5 µM glycine, 20-100 µM cyclothiazide, and 3 µM of the AMPA receptor blocker CNQX. The cells were alternately perfused with the two isolating solutions using solenoid-controlled valves (solutions changed at approximately 1-min intervals). In some experiments, the AMPA solution contained an additional 100-200 µM CdCl2 to block voltage-gated Ca2+ channels. The desired solution was perfused for about 2-3 s before simultaneous imaging, and voltage-clamp recording were started to provide adequate perfusion. The application of antagonists such as CNQX or APV for just 2-3 s before imaging helps to reduce potential nonspecific actions (such as a reduction in resting calcium level driven by ambient glutamate).
The perfusion was stopped immediately after a trial of imaging and electrical recording was complete (10 s). Before each experiment, the theta tube was filled with bath solution containing phenol red to monitor the perfusion area and the extent of solution exchange. Once an adequate perfusion and solution exchange position were determined the theta tube was left in the same position throughout the experiment. All experiments were conducted at room temperature (~23°C).
Whole cell voltage- and current-clamp experiments (Hamill et al.
1981
) were conducted using an Axon Instruments Axopatch 200B amplifier. Electrodes were pulled from 1.5-mm glass pipettes (Warner) and had a tip resistance of 6-9 M
when filled with intracellular solution containing (in mM) 0.5 fluo-3 K+ salt,
0.7 mag-fura-2, 122 K+MeSO4, 20 NaCl, 5 Mg-ATP,
0.3 GTP, and 10 HEPES (pH = 7.2). In some cases,
K+ was substituted with Cs+
for better clamp control. A calculated liquid junction potential of 12 mV was not corrected for (Neher 1995
); therefore all
membrane potentials and holding potentials are expected to be more
negative than reported.
Imaging of neuronal Ca2+ transients was performed
with wide field microscopy using an Axiovert TV inverted microscope
(Zeiss, Germany) equipped with an intensified CCD camera (Stanford
Photonics, Palo Alto, CA) as previously described (Mackenzie et
al. 1996
; Murphy et al. 1995
). We used an ×100
oil 1.3 NA objective (Zeiss, Germany) for optical recordings. The
camera acquired data at 30 frames/s (pixel size = 0.2 µm) and
the images were captured to a PC using a frame grabber (EPIX, Buffalo
Grove, IL). Mag-fura-2, a low-affinity Ca2+
indicator with high fluorescence at basal
[Ca2+]i at 380 nm
excitation (Raju et al. 1989
), was included in the pipette solution (0.7 mM) to resolve the fine processes under resting
conditions. For each optical recording trial, we collected 10 s of
Fluo-3 images (300 frames; at 490-nm excitation) and then switched to
380 nm excitation to collect 1 averaged (1 s) Mag-fura-2 image for
normalization (see following text). The excitation light was delivered
to the microscope using a flexible fiber optic cable coupled to a
Stanford Photonics DX-1000 optical switch/HBO 100 W arc lamp. On the
emission side we used a Fura/Fluo-3 dichroic mirror (Chromo
Technologies No. 74000) combined with a 540/40-nm emission filter.
Under these conditions, we found that the
F490/F380 signal was linear over the range of ratio values associated with MSCTs
(calibration procedure using voltage-gated Ca2+
current) (Umemiya et al. 2001
). We also observed a
strong positive correlation (by linear regression) between the integral
of the NMDAR component of the miniature excitatory postsynaptic current (mEPSC) and the peak MSCT amplitude for coincident MSCTs/mEPSCs that
were mapped to single sites (Umemiya et al. 1999
). These data indicated that measurement of the MSCT peak amplitude does provide
a measure of mEPSC amplitude despite the fact that the imaging
technique has a considerably lower sampling rate. Thus although the
peak [Ca2+]i reached would also reflect
buffering and other factors, it is nonetheless an indicator of the
degree of receptor activation. Relatively low excitation light levels
were used, and we did not observe detectable bleaching as determined by
no significant decline in basal fluorescence during trials without
miniature events (see Fig. 2C). To permit adequate filling
of the cells, we usually delayed recording by at least 5 min after seal rupture.
Fluo-3 and mag-fura-2 were purchased from Teflabs (Austin, TX) or Molecular Probes (Eugene, OR). D,L-APV were purchased from Precision Biochemicals (Vancouver, BC). Cyclothiazide was purchased from Sigma RBI (Oakville, Ontario). Tetrodotoxin and other chemicals were purchased from Sigma Chemical (St. Louis, MO).
Data analysis
To identify dendritic regions showing MSCTs, we constructed
difference images by first averaging fluorescence over 1-s periods (30 images) to obtain 10 averaged images (total sampling epoch is
approximately 10 s, 300 images). Images of fluorescence changes (difference images) were then produced by subtracting consecutive averaged images (image pairs) and determining their absolute value. The
difference images were then averaged and a single image was created
that reflected sites that exhibited greatest changes in fluorescence
over the 10-s sampling epoch. These potential sites of MSCTs were
further evaluated using plots (pixel value vs. time) from approximately
2.0 µm2 areas of interests (7 × 7 pixels;
see Fig. 2). The change in Fluo-3 fluorescence intensity
F of each area of interest was divided by the Mag-fura-2
fluorescence (F380) to adjust for
differences in dye filling and focus along the dendritic tree
(
F490/F380).
To improve the signal-to-noise ratio of the images and to reduce the
file sizes, we averaged two sequential frames of raw data (an averaged
image was 66 ms). The sites of MSCT origin were defined as previously
described (Murphy et al. 1995
) by monitoring the rising
phase of the Ca2+ transient and selecting the
dendritic region with the earliest rise. The initiation time of the
Ca2+ transient was defined as the first point of
three consecutive measurements (66-ms interval) that was more than 2 SDs above the mean baseline fluorescence intensity. Because three
consecutive points must be greater than 2 SD above the noise we
estimate that spurious MSCTs would be detected with a frequency of less
than once every 50 trials. The mean baseline fluorescence intensity was
calculated by averaging 20 consecutive points before the initiation of
a MSCT or a randomly selected control period. The amplitude of MSCT was
measured by selecting the maximum fluorescence value within five
consecutive points following the MSCT initiation point. Usually the
fluorescence peaked within the first three data points. In some cases
(in general less than 5%) slow transient elevations in
[Ca2+]i were observed
(more than 500-ms rise time); these types of events were not considered
MSCTs. In trials that lacked MSCTs, baseline noise was calculated by
selecting random sequences of frames and determining their peak
fluorescence change as described above for MSCT responses. A random
number generator was used to prevent the possibility that regions of
baseline might be arbitrarily selected that contained more or less
noise than others (see Fig. 2C for an example of baseline
variation in CNQX). To estimate the baseline fluorescence deviation
(noise), we took the maximum fluorescence value occurring within five
consecutive points of a randomly selected number. Because the absolute
changes in fluorescence levels due to MSCTs could be up to 50%,
significant increases in shot noise (photon counting noise) could
occur. In this case, baseline variance estimates would not necessarily
be a measure of the total MSCT variance due to the higher light levels
reached. Because variance due to shot noise is proportional to the mean fluorescence, we scaled the estimated baseline variance (to account for
higher shot noise associated with MSCTs) by multiplying it by the
fold-change in raw fluorescence attributed to MSCTs. In scaling the
entire baseline variance, we have assumed that the dominant source of
noise in this system is "shot noise" as previously described by us
and consistent with other data (Mackenzie et al. 1996
).
We then subtracted this estimated baseline variance (corrected for shot
noise) from the measured MSCT response variance for each site examined.
This manipulation gave us an estimate of MSCT variance free from
variance due to shot and dark noise (Sabatini and Svoboda 2000
). In general we found that the total fold change of Fluo-3 fluorescence was relatively small and that shot noise correction only
reduced coefficient of variation (CV, SD/mean) estimates by a small
amount (0.35-0.34 for AMPA responses and 0.30-0.28 for NMDA responses).
Data analysis was performed using custom routines written the IDL (Research System, Boulder, CO) programming language on a Pentium-processor-based computer. Statistical analysis was done by Prism V.3.0 (GraphPad Software, San Diego, CA) and Origin V.3.5 (Microcol Software, Northamptom, MA). Results are presented as the mean ± the SD unless indicated otherwise.
| |
RESULTS |
|---|
|
|
|---|
Calcium imaging was performed on cultured cortical neurons under
conditions that isolate miniature synaptic activity. To isolate the
postsynaptic Ca2+ response attributed to the
AMPAR-mediated mEPSC, we added picrotoxin and APV to block both GABA
and NMDA-type receptors. To slow the decay phase of the AMPAR-mediated
mEPSC and to increase charge transfer to facilitate
Ca2+ transient detection, we used cyclothiazide
(20-100 µM) to remove desensitization (Bertolino et al.
1993
; Partin et al. 1993
). Although cyclothiazide and its analogues may effect the gating of AMPA receptors
and the affinity for agonist (Arai et al. 1996
), most of
the properties of AMPAR mEPSCs appear to be preserved after cyclothiazide including considerable amplitude variability
(Atassi and Glavinovic 1999
). Cyclothiazide sensitivity
can also vary with AMPAR subunit combination (Partin et al.
1994
, 1995
). However, most synapses on hippocampal neurons
appear to be sensitive to cyclothiazide (or its analogs) because the
bulk of the mEPSC decay times are lengthened rather than a
subpopulation being effected (Atassi and Glavinovic
1999
; Vyklicky et al. 1991
). Our results suggest
that after cyclothiazide treatment mEPSC decay times can be described
by a single normal distribution, arguing against a significant
proportion of less sensitive synapses (Kolmogorov-Smirnov test;
P > 0.05, n = 4 neurons). Under the
conditions we used mEPSCs were reversibly suppressed by adding the
antagonist CNQX to the bathing media indicating that they were
attributed to AMPARs (Fig. 1,
A and B). In low-density cultures that had
reduced frequencies of mEPSCs, it was possible to correlate the local
appearance of MSCTs with AMPAR mEPSCs recorded from the cell soma as we
have previously done for NMDAR mEPSCs and MSCTs (Murphy et
al. 1995
; Umemiya et al. 1999
, 2001
). In the
example shown, a mEPSC (Fig. 1, C-E) with a 19-ms single
exponential time course of decay occurs within one frame (33 ms) of the
MSCT. The prolonged decay time course of the mEPSC was associated with
the use of cyclothiazide to remove desensitization (Atassi and
Glavinovic 1999
). In the low-density cultures, a significant
positive correlation was observed between the integrated mEPSC and the
MSCT peak amplitude (R = 0.67, P < 0.01, n = 14 coincident MSCTs/mEPSCs at
n = 9 synapses), indicating that
Ca2+ imaging provides an estimate of the AMPA
synaptic current amplitude as observed previously for NMDAR mediated
mEPSCs and MSCTs (Murphy et al. 1995
; Umemiya
et al. 1999
, 2001
). Although the low-density cultures permitted
the correlation of mEPSCs and MSCTs, it was difficult to collect a
large number of MSCTs from a variety of different locations due to the
lower frequency of mEPSCs. We thus have performed all additional
experiments in high-density cultures allowing us to maximize MSCT
frequency.
|
To characterize GluR2 knockout cultures, we first examined the
current-voltage relationship of AMPA mEPSCs and compared them with the
wild-type neurons. The cells were held at different membrane potentials
ranging from
70 to 50 mV, and mEPSCs were recorded and averaged at
each holding potential. As expected, the mEPSCs recorded from GluR2
knockout neurons showed inward rectification (Geiger et al.
1995
), which was not observed in the mEPSCs from wild-type
neurons. Most of the knockout neurons showed no clear mEPSCs at
positive potentials larger than the noise level of the traces. Among
five GluR2 knockout neurons only three AMPAR-mediated mEPSCs were
detected at +30 mV, in contrast, at
70 mV they were readily observed.
In the wild-type neurons, we saw clear outward currents at +30 mV
(n = 6 cells). We compared the ratio of mEPSC amplitude
at +30 mV and
70 mV holding potentials to assess the degree of
rectification. The ratio of event amplitude at +30 and
70 mV for
knockout neurons was 0.14 ± 0.30 (2.1 ± 4.5 pA at +30 mV,
27.1 ± 8.5 pA at
70 mV); whereas the ratio for wild-type, it
was 0.55 ± 0.16 (13.4 ± 0.3 pA at +30 mV, 20.7 ± 4.2 pA at
70 mV). The miniature current frequency of knockout neurons at +30 and
70 mV were 0.004 ± 0.009 and 12.4 ± 3.9 Hz,
respectively. For the wild-type neurons, the mEPSC frequency was
0.67 ± 0.20 Hz at 30 mV and 7.9 ± 2.4 Hz at
70 mV. The
relatively larger reduction in miniature frequency at +30 mV in
knockout neurons (than wild-type) is consistent with the AMPAR's
strong rectification. The apparent lower frequency of AMPAR mEPSCs at
positive potentials in wild-type neurons may be the result of some
rectification due to the presence of a subpopulation of homomeric GluR1
receptors. Or alternatively (more likely case), increased noise at
positive potentials precluded the measurement of smaller mEPSCs, thus
reducing their apparent frequency.
To assess where MSCTs attributed to AMPA and NMDA receptors were
occurring within dendrites, we used Ca2+ imaging.
An example of fluo-3 Ca2+ responses associated
with conditions that isolate miniature synaptic activity mediated by
AMPARs from a dendrite of a cultured GluR2 knockout neuron is shown in
Fig. 2. A single approximately 1.0 µm2 dendritic spine indicated in Fig.
2A showed a MSCT (normalized to basal mag-fura-2
fluorescence) under conditions that isolated AMPA-mediated mEPSCs. A
fluorescence ratiometric image demonstrated that the
Ca2+ transients were largely limited to the
dendritic spine (Fig. 2A, inset). Plots of
Ca2+ transients at this spine over twenty
consecutive trials are shown in Fig. 2B. In some trials we
observed multiple MSCTs over the 10-s sampling period. Addition of the
AMPA antagonist CNQX in alternate trials (even numbered) reversibly
suppressed these local changes in Ca2+. The
Ca2+ transient rose to the peak within one of the
sampling points (66 ms), and then decayed back to baseline over 1-1.5
s (Fig. 2B). In this study due to relatively high-frequency
of basal miniature synaptic activity (approximately 10 Hz, see above)
and the use of a 15-Hz sampling rate (to improve signal to noise
parameters), we did not investigate the relationship between miniature
current and calcium transient amplitude within the high-density
cultures. Previous data (Umemiya et al. 1999
) suggests
that mEPSCs associated with MSCTs are not significantly different in
amplitude from those belonging to the general population and therefore
the imaging alone provides an accurate estimate of mEPSC activity.
|
Although our cultures from GluR2 null animals would be expected to
contain Ca2+ permeable AMPARs, it is also
possible that activation of AMPARs during mEPSCs may lead to sufficient
postsynaptic depolarization to activate voltage-gated
Ca2+ channels. Therefore the optical responses we
monitored (proportional to changes in intracellular
Ca2+) may be secondary to AMPAR-mediated
activation of Ca2+ channels and not due to
Ca2+ permeable AMPARs directly. We have addressed
this possibility in several ways including the use of hyperpolarization
to clamp the membrane potential well away from potentials that would
activate voltage-gated Ca2+ channels. At
100 mV
holding potential, we still observed MSCTs when using pharmacological
conditions that would selectively activate AMPARs (data not shown,
n = 4 neurons). In these experiments, the MSCTs were
sensitive to CNQX, indicating that they were attributed to AMPARs.
Other evidence against the voltage-gated Ca2+
channels is the observation that these Ca2+
transients are usually quite localized and do not appear to invade the
surrounding dendrites; this would be expected if there were large local
changes in voltage that would not be well confined by the spine
(Koester and Sakmann 1998
; Svoboda et al.
1997
; Zador et al. 1990
).
Pharmacological experiments were carried out to further rule out
voltage-gated Ca2+ channels as the signal for
AMPA MSCTs. In the presence of 0.1-0.2 mM CdCl2,
we could greatly suppress all dendritic Ca2+
transients associated with step depolarization from
80 to 0 mV (Fig.
3A, 78.4 ± 0.04%
reduction, n = 7 cells). Under these conditions robust
AMPA MSCTs were still observed. We observed no significant change in
the MSCT frequency (0.08 ± 01 to 0.09 ± 0.01; SE) or
amplitude (2.2 ± 0.3 to 1.9 ± 0.2
F490/F380;
SE with Cd2+) during Cd2+
application. (Fig. 3, B and C, Kolmogorov-Smirnov
test, P > 0.05). These data argue strongly that direct
Ca2+ entry through
Ca2+-permeable AMPARs is sufficient to cause the
local Ca2+ transients we have observed.
|
As previously observed by others using a variety of techniques to map
quantal responses to single CNS synapses (Bekkers and Clements
1999
; Frerking et al. 1997
; Liu et al.
1999
; McAllister and Stevens 2000
; Tang
et al. 1994
; Umemiya et al. 1999
), we report a
high level of amplitude variability in Ca2+
transients associated with repeated AMPA mEPSCs occurring at single
synapses (Fig. 4A). The
corrected CV (for baseline noise) of AMPAR mediated MSCT amplitude was
0.34 ± 0.18 (SD) measured from 31 synapses from five cells,
whereas the CV of NMDAR-mediated MSCT amplitude was 0.28 ± 0.11 (SD, 25 synapses, 5 cells). This coefficient of variability was
significantly larger than that expected for baseline variation (CV:
AMPA baseline: 0.09 ± 0.06 SD, 28 synapses 5 cells, NMDA
baseline: 0.11 ± 0.06 SD, 25 synapses, 5 cells; P < 0.0001, Mann-Whitney test). Although the selection criteria for
MSCTs we used were strict (see METHODS) for a more stringent selection of MSCTs we also rejected responses smaller than
the mean of baseline value plus two SD of baseline noise (corrected for shot noise, see METHODS). These
selection criteria produced a clear separation between baseline noise
and MSCTs (Fig. 4B). Furthermore, overplotted sweeps
indicate that responses are easily resolved from baseline noise.
|
Although the trial-to-trial MSCT variability was high at a single
synapse, we observed that different synaptic sites could have
significantly different MSCT mean amplitudes (Fig.
5). Previous data on NMDAR-mediated MSCTs
indicated that MSCT amplitude was not necessarily higher at smaller
synapses due to reduced volume and that MSCT amplitude was positively
correlated with measures of synapse size (Mackenzie et al.
1999
). Presumably, these differences in amplitude reflect the
number of AMPARs expressed at these synapses (see
DISCUSSION). An ANOVA (1-way) indicated highly significant differences in the mean amplitude of AMPAR-mediated responses between
different sites within a cell (n = 8 cells, average
P = 0.012 ± 0.013). For n = 28 and 25 synapses under NMDAR and AMPAR conditions, respectively, we
calculated a between synapse CV of 0.77 for both conditions. This CV
was considerably larger than expected for within synapse MSCT baseline
variation for both AMPA and NMDA conditions (CV 0.34 and 0.28 respectively). Analysis of over-plotted traces as well as the use of
statistical criteria indicated that differences in average MSCT
amplitude between sites were not attributed to baseline variation.
These differences in response amplitude were also unrelated to
presynaptic characteristics such as the frequency of events
(correlation R = 0.023, P = 0.7, 238 synapses from 14 cells). Given that MSCT response amplitude is not
necessarily correlated with apparent differences in response frequency
(see preceding text) (Mackenzie et al. 2000
;
Murphy et al. 1994
, 1995
), we suggest that miniature
frequency and postsynaptic responsiveness can be regulated
independently. Because the probability of miniature and of evoked
synaptic activity is correlated in this system (Prange and
Murphy 1999
), we suggest that the frequency of AMPAR MSCTs may
provide an indication of evoked release probability; however, it is
conceivably that scenarios exist in which each may be regulated
independently.
|
In MSCT-imaging experiments, we tried to restrict ourselves to large
spine containing neurons of pyramidal morphology to avoid interneurons
that might endogenously exhibit Ca2+-permeable
AMPARs. The AMPAR-mediated MSCT frequency was significantly lower in
neurons from wild-type littermate controls (Fig.
6). In wild-type neurons, the
AMPAR-mediated MSCT frequency (per synapse) was 0.0046 ± 0.0065 Hz versus 0.034 ± 0.055 Hz in knockout animals. The amplitude of
the relatively small number of wild-type AMPAR-mediated MSCTs observed
was significantly smaller than those recorded from GluR2
/
neurons
(0.83 ± 0.12
F490/F380
for GluR2 +/+ neuron n = 19, 1.47 ± 0.1
F490/F380
for GluR2
/
neuron n = 238; mean ± SE,
P = 0.0002, unpaired t-test with Welch's
correction). The NMDAR-mediated MSCT frequency was not significantly
different among wild-type and GluR2 knockout neurons (Fig. 6),
indicating that the low AMPA MSCT frequency in wild-type neurons was
not due to a general large change in the mEPSC frequency or detection. In contrast, for GluR2
/
neurons, the AMPAR-mediated MSCT frequency was similar to the NMDAR-mediated MSCT frequency (Fig. 6).
|
Previous analysis of NMDAR-mediated MSCTs indicates that large
significant differences exist in mEPSC frequency between different synapses within a single neuron (Mackenzie et al. 2000
;
Murphy et al. 1994
, 1995
). When the rates of AMPA (mean
0.046 ± 0.036 Hz) and NMDA (mean 0.051 ± 0.037 Hz)
receptor-mediated MSCTs were compared at between synapses we observed a
significant positive correlation (R = 0.29, P = 0.001). This result suggests that difference in
miniature release probability and not postsynaptic responsiveness underlies the apparent differences in MSCT rates between synapses because they are reflected in the postsynaptic response of two different receptor classes.
Previous immunocytochemical data indicate that not all synapses
co-express AMPA and NMDARs (Racca et al. 2000
) By using
selective antagonists, we found that some sites show only
AMPAR-mediated MSCTs (41%, 81/197 synapses) where as others showed
only NMDAR-mediated MSCTs (21%, 43/197 synapses) and 37% of total
synapses expressed both NMDA and AMPA MSCTs (73/197 synapses). It is
possible that synapses only exhibiting AMPA MSCTs may be the result of
poor sampling. To test this, we excluded synapses exhibiting only one response per experiment and still observed AMPA only synapses (33%,
46/139 synapses) and NMDA only synapses (14%, 20/139 synapses). Further evidence that this was not a random phenomenon came when we
observed synapses exhibiting at least eight NMDA or AMPA only responses. When we compared the MSCT amplitude of each type of synapse,
we found that there were significant differences between classes of
synapses. The average NMDAR-mediated MSCT amplitude from the sites
showing only NMDAR mediated responses were significantly smaller
(approximately 40-60%) than the NMDA MSCTs from sites showing both
AMPA and NMDA or only AMPA responses (Fig.
7). These differences were still
significant even when we removed the sites showing only two responses
per experiment (data not shown). At the sites that showed both AMPA and
NMDA receptor-mediated MSCTs, the amplitude of each type of MSCT was
not significantly different (Fig. 7). We also compared the frequency of
MSCTs at the different type of synapses and found that there were no
significant differences. The frequency of AMPA MSCTs from sites
expressing only AMPA responses was 0.047 ± 0.045 Hz, whereas the
AMPA MSCT frequency from sites expressing both AMPA and NMDA responses
was 0.058 ± 0.066 Hz. The MSCT frequency at NMDA only synapse was
0.041 ± 0.032 and 0.047 ± 0.039 Hz for sites showing both
AMPA and NMDA responses. Thus although differences in the frequency of
MSCTs between synapses within a single neuron are apparent
(Mackenzie et al. 1999
), we did not observe any
significant difference (unpaired t-test with Welch's
correction) in MSCT frequency between synapses that apparently expressed only functional NMDARs or AMPARs versus those that express both classes of receptors, indicating that the probability of mEPSC
activity may be similar.
|
Previous electrophysiological data by Gomperts et al.
(1998)
, Umemiya et al. (1999)
, McAllister and
Stevens (2000)
, and Watt et al. (2000)
suggest
that the amplitudes of NMDA and AMPA components of miniature responses
at single synaptic sites are scaled proportionally. Although these
studies used high-resolution patch-clamp techniques, they were not able
to always map a particular mEPSC to a defined synapse. Therefore using
our MSCT imaging technique in combination with solutions that isolate
AMPAR and NMDAR activity, we have further addressed this issue. At
sites that showed three or more MSCTs, we found that there was a
positive correlation between the amplitude of AMPA and NMDA MSCTs
(R = 0.94), suggesting that the function of these
receptors were co-regulated at each synapse (Fig.
8).
|
| |
DISCUSSION |
|---|
|
|
|---|
We demonstrate that by using GluR2 null mutant animals MSCTs
mediated by Ca2+ permeable AMPARs can be detected
at single synapses using Ca2+ imaging. In GluR2
null neurons, the frequency of AMPAR-mediated MSCTs is not different
from those mediated by the NMDAR. In contrast, in wild-type
neurons, the frequency of AMPAR-mediated MSCTs was reduced by more than
85% when compared with those mediated by NMDARs. Interestingly,
occasional synapses in wild-type neurons showed MSCTs under conditions
that favor AMPARs, suggesting the presence of
Ca2+-permeable AMPARs as found in interneurons.
However, we had restricted our analysis to large spiny neurons of
pyramidal morphology to reduce the chance of recording from an
interneuron. Pyramidal neurons of the cerebral cortex are positively
labeled with antibodies specific to the GluR2 subunit (Petralia
et al. 1997
) and therefore should contain
Ca2+-impermeable AMPARs. However, the ratio of
GluR2 subunit expression to the other subunits and its subcellular
localization may be factors affecting Ca2+
permeability. Single-cell RT PCR studies have shown that even in an
apparently homogeneous population of neurons, the ratios of different
GluR subunit mRNAs can vary (Yin et al. 1999
). Because it is the proportion of the GluR2 subunit to other GluR subunits that
determines the Ca2+ permeability, it is possible
that even in wild-type neurons a small number of AMPARs do not have the
GluR2 subunit. Recently, Yin et al. (1999)
have shown
that a subpopulation of hippocampal pyramidal neurons exhibit GluR2
subunit expression in the soma but no labeling in the dendrites. They
then used Co2+ staining to assess the presence of
functional Ca2+ permeable AMPA/kainate receptors.
Interestingly, they detected Co2+ staining in
dendritic arbors, whereas little staining was observed in the soma of
this population of pyramidal neurons. Ca2+
imaging data by Yuste et al. (1999)
suggest that some
synapses within CA1 pyramidal neurons (that express edited GluR2) can
exhibit Ca2+-permeable AMPARs. Thus positive
labeling for the GluR2 subunit in a neuron does not necessarily mean
that all AMPARs are Ca2+ impermeable.
Furthermore, Wenthold et al. (1996)
using
immunoprecipitation with subunit-specific antibodies have shown that
about 8% of total AMPAR complexes are homomeric GluR1 (presumably
Ca2+ permeable) in the CA1/CA2. It is conceivable
that the subunit stoichiometry of glutamate receptors is regulated,
permitting selective pyramidal synapses to express
Ca2+-permeable AMPARs. Therefore given our and
other results, the Ca2+-permeable AMPARs might
have a wider distribution than previously thought and may not just be
limited to interneurons.
The AMPAR-mediated MSCTs recorded from GluR2 null animals are CNQX
sensitive. This suggests that either direct Ca2+
entry through the AMPAR or secondary activation of voltage-gated Ca2+ channels is responsible for the MSCT
signals. In general, miniature synaptic activity would be expected to
produce little depolarization and would be unlikely to activate voltage
gated Ca2+ channels. The addition of
CdCl2 effectively blocked 78% of voltage step
evoked Ca2+ transients (step from
70 to 0 mV),
whereas it has no significant effect on either MSCT frequency or
amplitude. Thus voltage-gated Ca2+ channels are
unlikely to play a role in the MSCTs mediated by AMPARs. These results
are consistent with previous findings that Cd2+
blocks evoked EPSCs, whereas it has no effect on spontaneous miniature
synaptic currents or miniature end-plate potentials (Bao et al.
1998
; Losavio and Muchnik 2000
). The inability
of Cd2+ to affect the frequency or amplitude of
MSCTs also makes it unlikely that these events are dependent on the
store-operated Ca2+ channels because they would
be expected to be potently blocked under these conditions (Hoth
and Penner 1993
; Nakamura et al. 2000
).
A variety of imaging and local perfusion approaches have generated data
suggesting that the amplitude of repeated miniature events at a single
synapse is not necessarily fixed (Bekkers and Clements
1999
; Forti et al. 1997
; Lin et al.
1998
; McAllister and Stevens 2000
; Murphy
et al. 1995
; Umemiya et al. 1999
). Consistent with these observations, the coefficient of variation of AMPAR-mediated MSCT amplitude at a single synaptic site was 0.34 and was significantly higher than that expected for baseline variation alone. Liu et al. (1999)
have provided evidence suggesting that the major
contributor to this variability is synaptic cleft glutamate
concentration assuming that AMPARs are not saturated by glutamate
released from a single vesicle. Data from Renger et al.
(2001)
suggest the amount of release per vesicle is
developmentally controlled leading to selective activation of NMDARs
early in development.
In addition to within synapse variability, AMPA MSCT imaging confirms
that the mean MSCT amplitude also varies between synapses as observed
by others (Gomperts et al. 1998
; Umemiya et al.
1999
). The source of this variability is likely due to synapse
size. Elegant quantitative immunogold labeling studies by Racca et al. have shown for both NMDARs and AMPARs, synapse size is positively correlated with receptor number (Racca et al. 2000
).
With regards to functional NMDARs, Mackenzie et al.
(1999)
have demonstrated that the NMDAR-mediated MSCT is
positively correlated with synapse size. In the present study, we found
that at synapses that showed both AMPAR- and NMDAR-mediated MSCTs, the
amplitude of the MSCTs are positively correlated (Fig. 8). Thus we
suggest that the amplitude of AMPAR-mediated MSCT is also positively
correlated with synapse size. Previous work by Gomperts et al.
(1998)
; Umemiya et al. (1999)
, Watt et
al. (2000)
, and McAllister and Stevens (2000)
support our finding and suggest that the amplitude of NMDA and AMPA
components of miniature responses are positively correlated (between
different synapses), suggesting that synapses scale the numbers of both
receptors proportionally.
At synapses showing only NMDAR-mediated MSCTs (silent synapses), the
MSCT amplitude was significantly smaller than the NMDA MSCT recorded
from synapses showing both AMPA and NMDA MSCTs. Perhaps, the smaller
MSCT amplitude could be due to the fact that silent synapses are still
immature. Immunogold electron microscopy (EM) studies indicate there is
no significant relationship (Takumi et al. 1999
) or a
weak positive correlation between synapse size and the number of NMDARs
(Kharazia and Weinberg 1999
; Racca et al.
2000
). Interestingly, data from Kharazia and Weinberg
(1999)
suggest that many of the smallest active zones may lack
functional AMPARs. Furthermore, Racca et al. (2000)
and
Takumi et al. (1999)
had shown that the AMPAR
immunonegative synapses (putative silent synapses) are smaller
than synapses containing both AMPA and NMDA receptors. On the other
hand, there is a strong positive correlation between synapse size and
the number of AMPARs (Kharazia and Weinberg 1999
;
Racca et al. 2000
; Takumi et al. 1999
).
Our data indicate that synapses containing only AMPARs had
significantly larger MSCTs than the synapses containing only NMDA
receptors. Interestingly, Kharazia and Weinberg reported that a
disproportionate number of the largest excitatory synapses appeared to
be immunonegative for NMDAR subunit NR1 thus providing a precedent for
synapses without NMDARs (Kharazia and Weinberg 1999
).
Furthermore, recent time lapse and retrospective immunocytochemistry
data by H.V. Friedman et al. (2000)
also suggested the
presence of synapses bearing only AMPARs. In the case of the GluR2 null
neurons, it is possible that NMDARs are not always necessary to provide
Ca2+-mediated signals to properly outfit synapses
given that the AMPAR can provide a local Ca2+
source. Data from developing spinal interneurons (Rohrbough and Spitzer 1999
) indicate that when Ca2+
permeable AMPARs are present, NMDARs are not necessarily co-localized at synapses.
The GluR2 subunit has been suggested to be involved in delayed neuronal
death after an ischemic insult or after kainate-induced status
epilepticus (Bennett et al. 1996
; Friedman
1998
; L. K. Friedman et al. 1994
, 2000
;
Gorter et al. 1997
; Pellegrini-Giampietro et al.
1992
; Pollard et al. 1993
). Interestingly,
studies by L. K. Friedman et al. (2000)
have shown
that after transient focal ischemia the area destined to undergo
infraction shows a down regulation of both GluR2 and NR1 after the
insult (L. K. Friedman et al. 2000
). The
downregulation of NR1 suggests a reduction of Ca2+ influx via NMDARs, whereas the down
regulation of GluR2 subunit indicates enhanced
Ca2+ influx through GluR1 and/or GluR3 homo- or
heteromeric AMPARs. Thus Ca2+ permeable AMPARs
that we show can directly elevate Ca2+ in spines
may play an important role in delayed neuronal death in stroke and epilepsy.
In conclusion, our results indicate that AMPAR MSCT imaging in GluR2
knockout mice can be used to confirm previous electrophysiological and
immunocytochemical data indicating heterogeneity of function both
within and between synapses (Bekkers and Clements 1999
;
Liu and Tsien 1995
; Murphy et al. 1995
;
Murthy et al. 1997
; Umemiya et al. 1999
;
Yuste et al. 1999
). Although some of our results are
confirmatory, they are importantly derived with a different experimental approach and provide additional confidence in these previous findings. We have also addressed issues that were not previously studied using whole cell recordings. For example, we have
shown no significant correlation between the estimated amplitude of
mEPSCs (from imaging data) and their frequency, suggesting that factors
regulating miniature release frequency can be distinct from those
regulating amplitude. Given that recent data indicates dynamic
regulation AMPA receptor levels in response to either occupancy of the
receptor by ligands or stimulation of NMDARs (Lissin et al.
1999a
,b
; Lu et al. 2001
), we suggest that
imaging of AMPAR MSCTs also provides an ideal system to localize the
sites of these functional changes and a provide a better link between immunocytochemical and electrophysiological experiments (Liao et
al. 2001
; Shi et al. 1999
). Given that prolonged
mEPSC stimulation is sufficient to alter the distribution of AMPARs
(Liao et al. 2001
; Lu et al. 2001
), it is
possible that we may be able to observe the redistribution of
functional receptors in future experiments designed to better detect
this phenomenon using our imaging approach.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dr. Franco A. Taverna for providing PCR genotyping protocol.
This research was supported by postdoctoral fellowship from the Heart and Stroke Foundation of British Columbia and Yukon to S. Wang and operating grant MT 12675 from the Canadian Institute for Health Research to T. H. Murphy.
| |
FOOTNOTES |
|---|
Address for reprint requests: T. H. Murphy, Kinsmen Laboratory, Dept. of Psychiatry, University of British Columbia, 2255 Wesbrook Mall, Vancouver, BC V6T 1Z3, Canada (E-mail: thmurphy{at}interchange.ubc.ca).
Received 27 September 2001; accepted in final form 4 March 2002.
| |
REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |