INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Changes in excitability have been observed in sensory neurons after axonal injury (Gurtu and Smith 1988), and ion substitution and pharmacological experiments indicate that sodium channels can contribute to sensory neuron hyperexcitability associated with neuropathic pain (Chabal et al. 1989; Devor et al. 1992). In earlier studies, we demonstrated a significant upregulation of the expression of the previously silent TTX-sensitive (TTX-S) sodium channel gene Na_v1.3 (Waxman et al. 1994), previously referred to as type III, and downregulation of two TTX-resistant (TTX-R) sodium channel genes (Na_v1.8 and Na_v1.9, previously termed SNS and NaN, respectively) (Dib-Hajj et al. 1996, 1998b) in dorsal root ganglion (DRG) neurons following transection of the sciatic nerve. Patch-clamp studies of DRG neurons have shown that, in parallel, peripheral axotomy causes a significant attenuation of TTX-R sodium currents (Cummins and Waxman 1997; Sleeper et al. 2000), and a switch from slowly repriming TTX-S currents to more rapidly repriming TTX-S currents (Black et al. 1999; Cummins and Waxman 1997).

Nerve growth factor (NGF) and glial derived neurotrophic factor (GDNF) can rescue TTX-R Na⁺ channel expression in DRG neurons, both in vivo and in vitro (Aguayo and White 1992; Black et al. 1997; Cummins et al. 2000; Dib-Hajj et al. 1998a; Zur et al. 1995). Several studies have shown that distinct, largely nonoverlapping, populations of DRG neurons express receptors for either NGF or GDNF (Averill et al. 1995; Bennett et al. 1998; Molliver et al. 1997). NGF and GDNF can also have distinct, nonoverlapping, effects on DRG neurons (Akkina et al. 2001; Bennett et al. 1998), and these two neuronal populations are thought to have different functions (Stucky and Lewin 1999). Because these neurotrophins can have distinct effects on subpopulations of DRG neurons, several studies have examined their potential for the treatment of sensory neuropathies (Akkina et al. 2001; Boucher et al. 2000; Ren et al. 1995). Ren et al. (1995) reported that NGF has potent analgesic effect following chronic constriction injury in rats. Recently, Boucher et al. (2000) reported that GDNF, but not NGF, can alleviate neuropathic pain that follows partial sciatic ligation and proposed that GDNF might achieve this by repressing Na_v1.3 expression. It has been suggested that the expression of Na_v1.3 contributes to the emergence of the rapidly-repriming sodium current in axotomized neurons (Cummins and Waxman 1997) and recent patch-clamp studies on Na_v1.3 expressed in heterologous expression systems and in DRG neurons tend to confirm this hypothesis (Cummins et al. 2001). Therefore we asked whether NGF and/or GDNF could reverse the changes in TTX-S sodium channel repriming kinetics that occur following peripheral axotomy.

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Surgery

Adult male rats were anesthetized with ketamine/xylazine (80/5 mg/kg ip), and right sciatic nerves were exposed at the mid-thigh level, ligated with 4-0 silk sutures, and transected, and the proximal stumps were placed in silicon cuffs to prevent regeneration (Waxman et al. 1994). Hydroxystilbamine methanesulfonate (4% wt/vol; Molecular Probes, Eugene, OR), a retrogradely transported fluorescent label, was placed in all cuffs prior to insertion of the nerve stump. The fluorescent label identified neurons that gave rise to axons that were transected. At the same time, an intrathecal cannula attached to an osmotic mini-pump (Alzet), which delivered GDNF (12 µg · animal¹ · day¹), NGF (12 µg · animal¹ · day¹), GDNF plus NGF, or vehicle (saline solution; CSS) to the lumbar enlargement, was implanted (Bennett et al. 1998). NGF was purchased from Alomone Labs (Jerusalem, Israel), and GDNF was purchased from Peprotech (Rocky Hill, NJ).

Culture methods

Cultures of neurons were established from L₄/L₅ DRG of adult rats. Briefly, lumbar ganglia (L₄, L₅) were excised, freed from their connective tissue sheaths, and incubated sequentially in enzyme solutions containing collagenase and then papain. The tissue was triturated in culture medium containing 1:1 Dulbecco's modified Eagle's medium (DMEM) and Hank's F12 medium and 10% fetal calf serum, 1.5 mg/ml trypsin inhibitor, 1.5 mg/ml bovine serum albumin, 100 U/ml penicillin, and 0.1 mg/ml streptomycin and plated on polyornithine/laminin-coated coverslips. The cells were maintained at 37°C in a humidified 95% air-5% CO₂ incubator.

In experiments involving sciatic nerve ligation and intrathecal administration of GDNF and/or NGF, neurons derived from naive L₄/L₅ DRG, axotomized DRG without neurotrophin administration, and axotomized DRG with intrathecal GDNF and/or NGF administration were harvested from rats 7 days after surgery and examined within 24 h of plating. The short-term culture provided cells with truncated axonal processes that can be readily and reliably voltage clamped and allowed the cells sufficient time to adhere to the glass coverslip. The spontaneous electrical activity characteristic of DRG neurons following nerve injury can be observed in isolated injured neurons but not in isolated control neurons (Study and Kral 1996), indicating that dissociation does not drastically alter the electrophysiological properties of the DRG neurons. Furthermore, adult rat DRG neurons maintained in vitro for 24 h display a profile of sodium channel mRNA expression similar to that for DRG neurons in situ, indicating that short-term culture does not substantially alter the expression of sodium channel mRNAs in these cells (Black et al. 1996). These results suggest that at less than 24 h in culture, changes in sodium current properties are minimized. By contrast, changes in both sodium currents and sodium channel mRNA expression can be seen after 7 days in vitro (Fjell et al. 1999), clearly demonstrating that long-term culture can significantly alter the electrical properties of DRG neurons.

Whole cell patch-clamp recordings

Sodium currents in small (18- to 30-µm diam) DRG neurons were studied with whole cell patch-clamp techniques at room temperature (approximately 21°C) using an EPC-9 amplifier and the Pulse program (v 8.31). Fire-polished electrodes (0.8-1.2 M) were fabricated from 1.7-mm capillary glass using a Sutter P-97 puller. Voltage errors were minimized using 80-90% series resistance compensation. Linear leak subtraction was used for all recordings. The pipette solution contained (in mM) 140 CsF, 1 EGTA, 10 NaCl, and 10 HEPES, pH 7.3. The standard bathing solution was (in mM) 140 NaCl, 3 KCl, 1 MgCl₂, 1 CaCl₂, and 10 HEPES, pH 7.3. Cadmium (100 µM) was included to block calcium currents. The osmolarity of all solutions was adjusted to 310 mosM with sucrose. TTX-S currents were separated from TTX-R currents using prepulse inactivation and digital subtraction as previously described (Black et al. 1999; Cummins and Waxman 1997). The time course for repriming of the TTX-S sodium currents was generally well fit with a single-exponential function. In some instances a dual-exponential function might have given a better fit than the single-exponential function. However, to simplify the comparisons between experimental groups, we used a single-exponential fit.

RNA preparation and cDNA synthesis

Total RNA from L4/L5 DRG was extracted using Qiagen RNeasy mini columns. DRGs from two rats per treatment were pooled and processed. The purified RNA was treated with RNase-free DNase-I (Roche) and re-purified over Qiagen RNeasy mini-column; RNA was eluted in 70 µl volume. First-strand cDNA was reverse transcribed in a final volume of 50 µl using 5 µl purified DNA-free total RNA, 1 mM random hexamer (Roche) 40 U SuperScript II reverse transcriptase (Life Technologies), and 40 U of RNase Inhibitor (Roche). The buffer consisted of (in mM) 50 Tris-HCl (pH 8.3), 75 KCl, 3 MgCl₂, 10 DTT, and 5 dNTP. The reaction was allowed to proceed at 37°C for 90 min and 42°C for 30 min, then terminated by heating to 65°C for 10 min. A similar reaction mixture that lacks the reverse transcriptase enzyme was prepared and used as a template to demonstrate absence of contaminating genomic DNA (data not shown).

Real-time PCR

The concept and validation of real-time quantitative PCR have been previously described (Gibson et al. 1996; Heid et al. 1996; Winer et al. 1999). We have used the relative standard curve method to determine the effect of CSS, GDNF, NGF, and GDNF plus NGF, provided via an intrathecal osmotic pump on the expression of Na_v1.3 Na channels in DRG of rats with transected sciatic nerve. 18S rRNA was used as an endogenous control to normalize the expression level of the sodium channels nerves (Sleeper et al. 2000). Standard curves for 18 S rRNA and Na_v1.3 were constructed using serial dilution of cDNA of HEK293 cells transfected with a Na_v1.3 construct (Cummins et al. 2001). Standards and unknowns were amplified in quadruplets. The standard curves for the Na_v1.3 and 18 S rRNA endogenous control (standards) were constructed from the respective mean C_t value, and the equation describing the curve was derived using the Sequence Detection System (SDS) software (Applied Biosystems). The normalized values of control (nonaxotomized, no intrathecal pump) and treated samples were compared with determine the effect of the treatment with the neurotrophic factors.

Primers and probes of the Na channel targets were designed using the software Primer Express (Applied Biosystems) according to the specification of the TaqMan protocols (see also Winer et al. 1999). The forward (5' AGGACAATGTCCAGAAGGGTAC 3') and reverse primers (5' AGTAGTCCTGAGTCATGAGTCGAAAC 3') of Na_v1.3 were synthesized and purified at Life Technologies (Rockville, MD) while the TaqMan probe (5' FAM-TGGACGAAACCCCAACTACGGCTACAC-TAMRA 3') was synthesized and purified at Applied Biosystems (Foster City, CA). Primers and probes for the 18 S rRNA were purchased from Applied Biosystems. Primers for Na_v1.3 and 18 S rRNA were used at a final concentration of 900 and 50 nM, respectively, while the probes were used at a final concentration of 200 nM. The primer/probe combinations are not limiting at these concentrations (data not shown). Amplification was done in a 50 µl final volume as previously described (Sleeper et al. 2000).

Statistical analysis

Data are expressed as means ± SE. One-way ANOVA was used to test for significant differences between the experimental groups. Multiple comparison test was used to determine the effectiveness of different treatments, and Fisher's least-significant difference (LSD) at  = 0.05 values were determined.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Analysis of recovery from inactivation for TTX-S sodium currents

DRG neurons express fast-inactivating TTX-S sodium currents and slow-inactivating TTX-R sodium currents (Caffrey et 1992; Kostyuk et al. 1981; Roy and Narahashi 1992). Because the fast-inactivating sodium current in adult small DRG neurons is sensitive to TTX and the slow-inactivating sodium current is resistant to TTX (Cummins and Waxman 1997; Cummins et al. 1999, 2000; Dib-Hajj et al. 1999; Sleeper et al. 2000), we refer to these currents as TTX-S and TTX-R, respectively. TTX-S currents have a more hyperpolarized voltage dependence of inactivation than the TTX-R sodium currents (Fig. 1, A and B), and therefore prepulse inactivation and digital subtraction can be used to separate the TTX-S and TTX-R sodium current components (Cummins and Waxman 1997; Roy and Narahashi 1992). This is illustrated in Fig. 1, A-D. Prepulse inactivation and digital subtraction give essentially the same result as TTX subtraction (Cummins and Waxman 1997).

View larger version (18K): [in this window] [in a new window]   Fig. 1. A-D: separation of TTX-sensitive (TTX-S) and TTX-resistant (TTX-R) sodium currents using prepulse inactivation and digital subtraction. A: family of traces from representative control small neurons are shown. The currents were elicited by 20-ms test pulses to 10 mV after 500-ms prepulses to potentials over the range of 130 to 10 mV. B: the corresponding steady-state inactivation curve is shown for A. The steady-state inactivation curve for this cell is bimodal because of the different inactivation properties of the 2 components ( in B, point of inflection). Two current components can be clearly resolved; a slowly inactivating component that has a relatively depolarized voltage dependence of inactivation (Vh) and a fast inactivating component that has a more negative Vh. C: the TTX-S current component was obtained by subtracting the trace in A corresponding to the inflection point (A, ) from the data in A obtained with the more hyperpolarized prepulses. D: the steady-state inactivation curve for the TTX-S current in C is shown. E-H: estimation of TTX-S repriming kinetics using digital subtraction. E: family of current traces from the same small DRG neuron showing the rate of recovery from inactivation at 100 mV. The cells were prepulsed to 20 mV for 20 ms to inactivate all of the current, then brought back to 100 mV for increasing recovery durations prior to the test pulse to 20 mV. The maximum pulse rate was 0.5 Hz. The recovery durations were 1, 2, 3, 5, 9, 17, 33, 65, 129, 257, 513, and 1025 ms. F: the time course for recovery from inactivation at 100 mV of peak currents in E is shown. For clarity, only the data corresponding to recovery durations 257 ms are shown. The time course is complex and could not be well fit with a single exponential function. The curve is drawn to guide the eye. The arrow in F identifies the inflection point and the arrow in E identifies the corresponding current trace. G: family of current traces showing the TTX-S component of the sodium currents shown in E. The TTX-S current component was obtained by subtracting the trace in E corresponding to the inflection point (obtained with the 5-ms recovery duration, ) from the data in E obtained with the longer recovery durations. The corresponding recovery durations were 9, 17, 33, 65, 129, 257, 513, and 1,025 ms. H: the time course for recovery from inactivation at 100 mV of the peak of the TTX-S currents in G is shown. For clarity, only the data corresponding to recovery durations 257 ms are shown. The solid curve is a single exponential function fitted to the data, with a time constant of 69 ms. In B, D, F, and H, the current is plotted as a fraction of peak current.

An analogous approach exploiting kinetic differences between TTX-R and TTX-S currents and using digital subtraction can be used to examine recovery from inactivation (repriming) kinetics of DRG sodium currents. Figure 1E shows the repriming time course at 100 mV for sodium currents recorded from the same DRG neuron shown in Fig. 1, A and B. The repriming time course is complex (Fig. 1F). As reported previously (Cummins and Waxman 1997; Elliott and Elliott 1993), while the TTX-R current in small DRG neurons exhibits fast repriming ( <1 ms at 100 mV), repriming for the TTX-S current is more than 20-fold slower. This substantial difference in repriming kinetics can be used to separate the TTX-S and TTX-R sodium current components. We used 20-ms pulses to 20 mV to optimize the separation of these currents for the measurement of repriming kinetics. While a 20-ms pulse to 20 mV is typically sufficient to fully inactivate TTX-S currents, it does not fully inactivate the slow-inactivating TTX-R current (as is evident in Fig. 1E). This enhances the rapid recovery of the TTX-R current and aids the separation of the TTX-S and TTX-R currents. The inflection point in the repriming time course (Fig. 1F, ), determined by visual examination of the data traces, was used to identify the TTX-R current trace used for digital subtraction (Fig. 1E, ). The remaining current is predominantly fast inactivating (Fig. 1G) and can be used to estimate the time course for repriming of the TTX-S current (Fig. 1H). The repriming time course for TTX-S currents is generally well fit with a single-exponential equation (Fig. 1H;  = 69 ms at 100 mV).

Intrathecal GDNF and NGF rescue TTX-S repriming kinetics

Previously we have shown that the upregulation in Na_v1.3 mRNA levels that occurs following peripheral axotomy is accompanied by a switch from TTX-S currents with slow repriming kinetics to TTX-S currents with rapid repriming kinetics (Black et al. 1999; Cummins and Waxman 1997). In the present study, we asked whether GDNF and/or NGF treatment in vivo would reverse the changes in TTX-S sodium currents following peripheral axotomy. The sciatic nerve of adult male rats was transected, and 7-day intrathecal pumps containing GDNF (12 µg/day), NGF (12 µg/day), both GDNF and NGF (each 12 µg/day), or vehicle (complete saline solution, CSS) were implanted. Seven days after surgery, the L₄ and L₅ DRG were harvested and cultured. Small (18-30 µm) neurons were studied using whole cell patch-clamp recordings within 24 h after dissociation. Axotomized neurons were identified by the retrograde uptake of the fluorescent tracer (see METHODS). Figure 2 shows representative TTX-S sodium currents recorded from control (A), CSS-treated axotomized (B), GDNF-treated axotomized (C), NGF-treated axotomized (D), and GDNF + NGF-treated (E) axotomized neurons, illustrating the repriming time course at 80 mV. The pulse protocol is shown in Fig. 2F. This is the same pulse protocol used to collect the data shown in Fig. 1E. However, in Fig. 2, A-E, the TTX-R current has been subtracted out and the TTX-S currents are shown plotted against the recovery duration. For all five groups, the repriming time course for TTX-S currents was fit with a single-exponential equation (Fig. 2G).

View larger version (27K): [in this window] [in a new window]   Fig. 2. Glial derived neurotrophic factor (GDNF) and nerve growth factor (NGF) reverse the effects of axotomy on the repriming kinetics of TTX-S sodium currents in small DRG neurons. Families of TTX-sensitive current traces illustrating the rate of recovery from inactivation at 80 mV for a control DRG neuron (A) and axotomized neurons treated with intrathecal complete saline solution (CSS, vehicle; B), GDNF (C), NGF (D), or GDNF + NGF (E) are shown. F: protocol used for measurement of recovery from inactivation. The recovery voltage (Vrec) was set at 80 mV. Cells were prepulsed to 20 mV for 20 ms to inactivate all of the TTX-S current then brought back to 80 mV for increasing recovery durations before the test pulse to 0 mV. Maximum pulse rate was 0.5 Hz. Slow-inactivating TTX-R currents were digitally subtracted as described in Fig. 1. G: The time course for recovery from inactivation at 80 mV for the peak currents shown in A-E. Single-exponential functions fitted to the data are shown (). H: the estimated time constant constants for recovery from inactivation of TTX-S currents at 80 mV are shown. ANOVA and Fisher's least significance difference (LSD) multiple comparison test was used to determine statistical significance (P < 0.05) between the groups. *, significant difference from both the control (C) neurons and the axotomized neurons treated with vehicle (CSS). **, a significant difference from the axotomized neurons treated with vehicle (CSS) but not from the control neurons.

The TTX-S sodium currents reprime significantly faster at 80 mV in axotomized DRG neurons treated with CSS than in control neurons. The TTX-S current repriming time constant at 80 mV was reduced from 150.8 ± 12.2 ms (n = 41 cells from 4 rats) in control DRG neurons to 55.0 ± 4.7 ms (n = 32 cells from 4 rats) in CSS-treated axotomized neurons (Fig. 2, G and H). This acceleration of repriming following peripheral axotomy is similar to what we previously reported (Black et al. 1999), indicating that intrathecal CSS treatment does not alter the effects of axotomy on TTX-S repriming kinetics.

GDNF and NGF each partially restored repriming toward control levels (Fig. 2, G and H). The TTX-S sodium current repriming time constants at 80 mV were larger in axotomized small DRG neurons from animals with GDNF in the intrathecal pump ( = 92.0 ± 5.3 ms, n = 66 cells from 4 animals) compared with CSS-treated axotomized neurons. The TTX-S currents in axotomized small DRG neurons from animals with NGF in the intrathecal pump also exhibited slower repriming compared with CSS-treated axotomized neurons at 80 mV ( = 97.2 ± 9.4 ms, n = 39 cells from 3 animals). ANOVA indicated that there were significant differences between the groups (P < 0.05). Pairwise comparisons (Fisher's LSD multiple comparison test) revealed that the repriming kinetics of the TTX-S sodium currents at 80 mV in NGF- and GDNF-treated neurons were significantly different from the repriming kinetics in both CSS-treated axotomized neurons and control neurons (P < 0.05). However, the repriming kinetics of the TTX-S sodium currents in NGF- and GDNF-treated neurons were not significantly different.

Because both GDNF and NGF each partially reversed the effect of axotomy on the repriming time course of TTX-S currents in small neurons, we examined the effect of supplying NGF and GDNF simultaneously in intrathecal pumps. The TTX-S current repriming time constant at 80 mV was 164.2 ± 16.6 ms (n = 32 cells from 2 animals) in axotomized small DRG neurons from animals with both GDNF and NGF in the intrathecal pump. Pairwise comparisons (Fisher's LSD multiple comparison test) revealed that the repriming kinetics of the TTX-S sodium currents at 80 mV in NGF + GDNF-treated neurons were significantly different from the repriming kinetics in CSS-, NGF-, and GDNF-treated axotomized neurons but not control neurons (P < 0.05). Thus only co-administration of GDNF and NGF appears to completely reverse the effect of peripheral axotomy on TTX-S repriming time course at 80 mV (Fig. 2, G and H).

The time course for recovery from inactivation was also examined at voltages ranging from 140 to 60 mV, using the same protocol as in Fig. 2 except that the recovery voltage (V_rec in Fig. 2F) was changed accordingly. Figure 3 shows that the TTX-S current in axotomized neurons treated with CSS reprimes more rapidly than the TTX-S current in control neurons throughout this voltage range. Both NGF and GDNF partially restored the TTX-S repriming kinetics to control levels (Fig. 3). ANOVA plus pairwise comparisons (Fisher's LSD multiple comparison test, P < 0.05) was used to determine statistical significance of the observed changes in the repriming time constant. The repriming kinetics of the TTX-S sodium currents recorded from GDNF-treated neurons were significantly different from the repriming kinetics in CSS-treated axotomized neurons at 70, 80, 100, and 140 mV and from control neurons at 80, 90, 100, 120, and 140 mV. The repriming kinetics of the TTX-S sodium currents in NGF-treated neurons were also significantly different from those in both CSS-treated axotomized neurons and control neurons at 80, 90, 100, 120, and 140 mV. The repriming time constants were larger for the TTX-S currents in small axotomized DRG neurons treated with GDNF plus NGF than in those treated with GDNF or NGF alone (Fig. 3). The repriming time constant was significantly slower in the axotomized DRG neurons treated with GDNF plus NGF than in those treated with CSS at all recovery potentials examined ranging from 60 to 140 mV. However, the time constants were not significantly different from those of control TTX-S sodium currents at 140, 100, 80, and 60 mV.

View larger version (22K): [in this window] [in a new window]   Fig. 3. Time constants for recovery from inactivation for control neurons (n = 43), peripherally axotomized neurons treated with intrathecal CSS (n = 26), with NGF (n = 39), with GDNF (n = 50), and with NGF plus GDNF (n = 33) are shown plotted as a function of voltage. The protocol illustrated in Fig. 2F was used. Cells were prepulsed to 20 mV for 20 ms to inactivate all of the TTX-S current, then brought back to the indicated recovery voltage (Vrec in Fig. 2F) for increasing recovery durations before the test pulse to 0 mV. Time constants were estimated from single exponential fits to time courses measured with this protocol.

In an effort to better understand the effects of GDNF and NGF on repriming kinetics, we categorized the TTX-S repriming kinetics as either fast or slow for every cell in each group and then examined the relative distribution of the two cell types (Fig. 4). The repriming kinetics were considered fast if the time constant was smaller than 80.8 ms at 80 mV, otherwise they were considered slow. This value is derived from the mean + 1 SD for the TTX-S repriming time constant calculated for the CSS-treated axotomized cells at 80 mV. Differences between the groups were compared using nonparametric ² tests. There was not a significant difference (P > 0.05) between the control group and the GDNF + NGF-treated axotomized group. By contrast, a significantly (P < 0.02) larger proportion of the neurons in the CSS-, GDNF-, and NGF-treated axotomized groups exhibited fast repriming kinetics compared with the control group. However, the GDNF- and NGF-treated axotomized groups also had a significantly (P < 0.001) higher proportion of neurons with predominantly slow repriming kinetics compared with the CSS-treated axotomized group. Thus while the TTX-S currents in control neurons and GDNF + NGF-treated axotomized neurons exhibited predominantly slow repriming kinetics and the TTX-S currents in CSS-treated axotomized neurons exhibited predominantly fast repriming kinetics, the GDNF- and NGF-treated axotomized neurons were roughly split between those with fast and those with slow TTX-S repriming kinetics. Similar distributions were observed at the other voltages at which repriming was examined (data not shown). This distribution is consistent with the known distribution of NGF- and GDNF-responsive small DRG neurons.

View larger version (43K): [in this window] [in a new window]   Fig. 4. The percentage of small DRG neurons expressing fast or slow repriming TTX-S sodium currents are shown for control neurons (n = 41) and axotomized neurons treated with intrathecal CSS (n = 32), GDNF (n = 66), NGF (n = 39), or GDNF + NGF (n = 32). TTX-S repriming was classified as fast if the time constant was smaller than the mean + 1 SD for the axotomized neurons treated with CSS. If the time constant was larger than the mean + 1 SD, then the TTX-S repriming was classified as slow. The cutoff value was 80.8 ms at 80 mV.

Intrathecal GDNF and NGF rescue Na_v1.3 mRNA levels in vivo

The emergence of rapidly repriming TTX-S currents following axotomy or chronic constriction injury (CCI) of rat sciatic nerve is paralleled by an upregulation of Na_v1.3 channel transcription in DRG neurons (Dib-Hajj et al. 1996, 1999; Waxman et al. 1994). To determine the effect of GDNF and NGF delivered to the intrathecal space on the expression level of Na_v1.3 transcripts in axotomized DRG neurons, the relative standard curve method of real-time PCR, which is an accurate and sensitive method for quantifying mRNA levels (Gibson 1996; Heid 1996), was used. Two standard curves for the endogenous control (18S rRNA) and Na_v1.3 were constructed using the respective primers/probe set, and serial dilutions of transfected HEK293 cell line as templates. The line formula for the two standard curves for quantitation were y = 40.335  2.932x (R² = 0.838) for Na_v1.3 and y = 20.243  3.212x (R² = 0.923) for 18S rRNA. The unknown samples were also amplified using the respective primers/probes (in separate reactions). The relative amounts of the Na_v1.3 channel were quantitated by linear extrapolation of the C_t values using the equation in the preceding text. These values were then normalized by the relative amounts of the endogenous control 18S rRNA determined by the linear extrapolation of the respective C_t values and line formula. The normalized values (no units) of Na_v1.3 were then compared between the treated and untreated samples for each experiment (Fig. 5).

View larger version (21K): [in this window] [in a new window]   Fig. 5. Effect of GDNF and NGF on the expression of Nav1.3 in axotomized DRG neurons as measured by real-time RT-PCR. Effect of GDNF, NGF, or vehicle (CSS) treatment on Nav1.3 expression normalized to the endogenous control 18S rRNA. Each measurement was done in quadruplets except for GDNF alone (8 replicates), and the relative amount of target was quantitated by the relative standard curve method. Two rats were used for each treatment. The means ± SE for each condition are: C (control), 1.13 ± 0.29; vehicle, 3.84 ± 0.32; GDNF, 2.06 ± 0.15; NGF, 2.76 ± 0.48; GDNF plus NGF, 1.62 ± 0.19. *, the values for control and GDNF plus NGF treatment were not statistically different (Fisher's LSD, P > 0.05).

ANOVA indicated that there were significant differences between the groups. Pairwise comparisons (Fisher's LSD multiple comparison test; P < 0.05) revealed that GDNF and NGF individually or in combination attenuated the increase in the level of Na_v1.3 transcripts in axotomized DRG neurons. The average level of Na_v1.3 in axotomized DRG of rats that were treated with CSS (vehicle) showed a 3.3-fold increase in the transcription level of Na_v1.3 compared with naïve animals (Fig. 5). The application of GDNF or NGF individually reduced the increase in Na_v1.3 level following axotomy. GDNF appears to be more potent in reducing Na_v1.3 level compared with NGF, although both GDNF and NGF were significantly different from CSS-treated animals. GDNF or NGF alone, however, did not reduce Na_v1.3 expression to control levels. Only GDNF plus NGF reduced the transcription level of Na_v1.3 to a level comparable to that of the control (means are not statistically different, Fisher's LSD multiple comparison test; P > 0.05).

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Peripheral nerve injury has dramatic effects on both the expression of sodium channel transcripts and the properties of sodium currents in small sensory neurons. In this study we show that GDNF and NGF can substantially reverse the upregulation of mRNA for the sodium channel Na_v1.3 (previously referred to as type III) and can reverse the switch from TTX-S currents with predominantly slow repriming kinetics to TTX-S currents with more rapid repriming kinetics in axotomized DRG neurons. When applied intrathecally at a concentration that has been shown to have profound analgesic effects on neuropathic pain (Boucher et al. 2000), GDNF partially reverses the effect of axotomy on Na_v1.3 mRNA expression and TTX-S repriming kinetics in axotomized small DRG neurons. NGF also partially reversed these effects of axotomy. However, only GDNF plus NGF applied together returned TTX-S repriming kinetics and Na_v1.3 mRNA levels in axotomized DRG neurons to the values found in control DRG.

Several lines of evidence indicate that NGF and GDNF act on largely distinct populations of DRG cells (Akkina et al. 2001; Averill et al. 1995; Bennett et al. 1998; Kashiba et al. 1998; Molliver et al. 1997). While most small DRG neurons express receptors for NGF or GDNF, it has been estimated that only approximately 15% express receptors for both. Bennett et al. (1998) found that while intrathecal application of either 12 µg/day NGF or 12 µg/day GDNF had partial yet significant effects on reducing the axotomy-induced slowing of C-fiber conduction velocity, the effects were slightly different. However, they reported that intrathecal delivery of 12 µg/day NGF plus 12 µg/day GDNF produced a nearly complete reversal of the effect of axotomy on C-fiber conduction velocity. Thus the additive effects of GDNF and NGF on the transcript levels of Nav1.3 could be a result of the action of these trophic factors on distinct groups of DRG neurons.

An alternative possibility is that this additive effect of GDNF and NGF is simply a reflection of the total amount of neurotrophin applied (24 vs. 12 µg/day). While we have not addressed this experimentally, we think that it is unlikely because we used what appears to be a saturating dose of 12 µg/day for each factor. Bennett et al. (1998) found only slight increases in the effectiveness of NGF or GDNF when intrathecal dose was increased from 1.2 to 12 µg/day. For example, they reported that the 10-fold increase in GDNF or NGF concentration enhanced only marginally the rescue of staining for the lectin IB4, and calcitonin-gene-related peptide (CGRP), respectively, in axotomized DRG neurons (Bennett et al. 1998). Bennett et al. (1998) also showed that intrathecal NGF did not significantly effect IB4 staining of axotomized DRG neurons at either 1.2 or 12 µg/day, and GDNF, at either 1.2 or 12 µg/day, did not significantly rescue CGRP staining following axotomy (Bennett et al. 1998). Therefore the most likely explanation for the complementary actions and larger response when GDNF and NGF are combined is that they act on different receptors on distinct neuronal populations.

The hypothesis that Na_v1.3 channels underlie some of the rapidly repriming current observed in axotomized small DRG neurons is supported by our recent study, which showed that recombinant Na_v1.3 sodium channels expressed in HEK293 cells exhibit relatively rapid repriming at recovery potentials from 140 to 80 mV (Cummins et al. 2001). However, although both NGF and GDNF partially reversed the effect of axotomy on TTX-S repriming kinetics and Na_v1.3 mRNA expression levels, this does not exclude the possibility that these factors affect other TTX-S sodium channels. Indeed, D'Arcangelo et al. (1993) reported that NGF can regulate both Na_v1.2 and Na_v1.7 channels in PC12 cells. DRG neurons express multiple TTX-S and TTX-R sodium channels (Black et al. 1996; Dib-Hajj et al. 1998b). Although DRG neurons do not express significant levels of Na_v1.2, Na_v1.7 might be the predominant TTX-S sodium channel expressed in control small DRG neurons (Black et al. 1996). Coward et al. (2001) reported that expression of Na_v1.7 is decreased after nerve injury. Because Na_v1.7 channels exhibit slow repriming kinetics (Cummins et al. 1998), it is possible that a reduction in expression of Na_v1.7 contributes, at least in part, to the loss of slow repriming TTX-S current. However, uninjured rat small DRG neurons also express mRNA for Na_v1.1 and Na_v1.6 (Black et al. 1996). The repriming kinetics of Na_v1.1 and Na_v1.6 have not been characterized, and it is not known if expression of these channels is altered by nerve injury. Changes in TTX-S repriming kinetics induced by axotomy and growth factors might also be due to posttranslational modifications and/or association with channel partners. Indeed, we have shown that the cell background and presence of specific sodium channel  subunits can alter the repriming kinetics of recombinant Na_v1.3 sodium channels (Cummins et al. 2001).

The TTX-S repriming time constants were estimated following digital subtraction of the slow-inactivating TTX-R currents. However, TTX-R current density is greatly reduced after axotomy (Cummins and Waxman 1997), and NGF and GDNF can both partially reverse the effects of axotomy on TTX-R current density (Cummins et al. 2000; Dib-Hajj et al. 1998a). Although this raises the possibility that the TTX-S repriming kinetic estimates might be affected by the digital subtraction technique that we used to separate the TTX-S and TTX-R currents, we consider this unlikely. We have also used the digital subtraction technique to examine the repriming kinetics of TTX-S currents in large cutaneous afferent DRG neurons, which also express substantial slow-inactivating TTX-R current generated by Na_v1.8 sodium channels (Akopian et al. 1999, Renganathan et al. 2000). The repriming kinetics of TTX-S currents measured in these large-diameter DRG neurons, using the digital subtraction technique, are much faster ( approximately 20 ms at 80 mV) than the TTX-S repriming kinetics measured in small-diameter DRG neurons (Everill et al. 2001). This shows that fast TTX-S repriming kinetics can be measured in the presence of TTX-R currents. In addition, the repriming kinetics measured for heterologously expressed recombinant Na_v1.7 sodium channels, which may be the predominant TTX-S sodium channel isoform expressed in small DRG neurons (Black et al. 1996), are slow (Cummins et al. 1998). This shows that slow TTX-S repriming kinetics can be measured in the absence of TTX-R currents. Therefore our observation of slow repriming kinetics for TTX-S currents in control small DRG neurons, and in axotomized small DRG neurons exposed to NGF and GDNF, do not arise from the method used to subtract the slow-inactivating TTX-R current.

There are several mechanisms by which changes in the properties of sodium currents in DRG neurons may increase the excitability of DRG neurons after injury to their axons. As a result of the more rapid repriming of the TTX-sensitive sodium current in small DRG neurons following axotomy, refractory period would be expected to be shorter in injured DRG neurons so that they can sustain higher firing frequencies (Cummins and Waxman 1997). Black et al. (1999) also observed a dramatic accumulation of Na_v1.3 protein at the axonal tips in the neuroma that forms following transection of the sciatic nerve. Increased sodium conductance due to increased numbers of channels, per se, can lower the threshold for action potential generation (Matzner and Devor 1992) and might also contribute to ectopic impulse generation following nerve injury.

Reversal of changes in repriming kinetics of the TTX-S current in axotomized DRG neurons is predicted to reduce their hyperexcitability. Boucher et al. (2000) reported that intrathecal GDNF was able to reverse the mechanical and thermal hyperalgesia induced by L₅ sciatic nerve ligation (SNL). They also show that the L₅ SNL, like the complete sciatic nerve ligation, upregulates expression of Na_v1.3 transcript and downregulates Na_v1.8 and Na_v1.9 transcript levels and have observed that GDNF partially reverses these changes in sodium channel expression. Boucher et al. (2000) also reported that intrathecal GDNF, but not intrathecal NGF, prevented the development of mechanical and thermal hyperalgesia that occurred after partial sciatic ligation (PSL). However, Ren et al. (1995) reported that NGF applied to the site of a chronic constriction injury (CCI) was able to alleviate both mechanical and thermal hyperalgesia. It is not clear why NGF was effective at reducing hyperalgesia in CCI but not in PSL. Both sciatic nerve ligation (Black et al. 1999; Boucher et al. 2000) and CCI (Dib-Hajj et al. 1999) increase expression of Na_v1.3, and, as we have shown in this study, both NGF and GDNF partially rescue the slowly-repriming TTX-S sodium current in small DRG neurons after sciatic nerve injury. Different injury models may involve different pain mechanisms and possibly different subgroups of DRG neurons. As mentioned in the preceding text, several studies indicate that NGF and GDNF act on distinct subgroups of DRG neurons that have different functional roles (Bennett et al. 1998; Kashiba et al. 1998; Stucky and Lewin 1999). This could explain why NGF was more effective at reversing hyperalgesia in the CCI model than in the PSL injury model.

In summary, our results demonstrate, for the first time, that GDNF and NGF can reverse the changes in TTX-S sodium current repriming kinetics, which are at least partially due to upregulation of Na_v1.3 sodium channels in axotomized DRG neurons in vivo. Because neurotrophins regulate the expression of many genes, including TTX-R sodium channels (Cummins et al. 2000; Fjell et al. 1999) and potassium channels (Everill et al. 2000) in sensory neurons, the analgesic actions of NGF and GDNF may not be only due to suppression of Na_v1.3 expression. However, because abnormal sodium channel expression in DRG neurons has been implicated in the pathogenesis of neuropathic pain, development of Na_v1.3 specific blockers may be relevant to the development of therapeutic strategies for pain after nerve injury.