|
|
||||||||
The Journal of Neurophysiology Vol. 88 No. 2 August 2002, pp. 650-658
Copyright ©2002 by the American Physiological Society
Department of Neurology and Paralyzed Veterans of America/Eastern Paralyzed Veterans Association Neuroscience Research Center, Yale Medical School, New Haven 06510; and Rehabilitation Research Center, Veterans Affairs Connecticut Healthcare Center, West Haven, Connecticut 06516
| |
ABSTRACT |
|---|
|
|
|---|
Leffler, Andreas,
Theodore R. Cummins,
Sulayman D. Dib-Hajj,
William N. Hormuzdiar,
Joel A. Black, and
Stephen G. Waxman.
GDNF and NGF Reverse Changes in Repriming of TTX-Sensitive
Na+ Currents Following Axotomy of Dorsal Root Ganglion
Neurons.
J. Neurophysiol. 88: 650-658, 2002.
Uninjured C-type rat dorsal root ganglion
(DRG) neurons predominantly express slowly inactivating TTX-resistant
(TTX-R) and slowly repriming TTX-sensitive (TTX-S)
Na+ currents. After peripheral axotomy, TTX-R
current density is reduced and rapidly repriming TTX-S currents emerge
and predominate. The change in TTX-S repriming kinetics is paralleled
by an increase in the level of transcripts and protein for the
Nav1.3 sodium channel
-subunit, which is known
to exhibit rapid repriming. Changes in Na+
current profile and kinetics in DRG neurons may substantially alter
neuronal excitability and could contribute to some states of chronic
pain associated with injury of sensory neurons. In the present study,
we asked whether glial-derived neurotrophic factor (GDNF) and nerve
growth factor (NGF), which have been shown to prevent some
axotomy-induced changes such as the loss of TTX-R Na+ current expression in DRG neurons, can
ameliorate the axotomy-induced change in TTX-S
Na+ current repriming kinetics. We show that
intrathecally administered GDNF and NGF, delivered individually, can
partially reverse the effect of axotomy on the repriming kinetics of
TTX-S Na+ currents. When GDNF and NGF were
co-administered, the repriming kinetics were fully rescued. We observed
parallel effects of GDNF and NGF on the Nav1.3
sodium channel transcript levels in axotomized DRG. Both GDNF and NGF
were able to partially reverse the axotomy-induced increase in
Nav1.3 mRNA, with GDNF plus NGF producing the
largest effect. Our data indicate that both GDNF and NGF can partially reverse an important effect of axotomy on the electrogenic properties of sensory neurons and that their effect is additive.
| |
INTRODUCTION |
|---|
|
|
|---|
Changes in
excitability have been observed in sensory neurons after axonal injury
(Gurtu and Smith 1988
), and ion substitution and
pharmacological experiments indicate that sodium channels can
contribute to sensory neuron hyperexcitability associated with
neuropathic pain (Chabal et al. 1989
; Devor et
al. 1992
). In earlier studies, we demonstrated a significant
upregulation of the expression of the previously silent
TTX-sensitive (TTX-S) sodium channel gene Nav1.3
(Waxman et al. 1994
), previously referred to as type
III, and downregulation of two TTX-resistant (TTX-R) sodium channel
genes (Nav1.8 and Nav1.9,
previously termed SNS and NaN, respectively) (Dib-Hajj et al.
1996
, 1998b
) in dorsal root ganglion (DRG) neurons following
transection of the sciatic nerve. Patch-clamp studies of DRG neurons
have shown that, in parallel, peripheral axotomy causes a significant
attenuation of TTX-R sodium currents (Cummins and Waxman
1997
; Sleeper et al. 2000
), and a switch from
slowly repriming TTX-S currents to more rapidly repriming TTX-S
currents (Black et al. 1999
; Cummins and Waxman
1997
).
Nerve growth factor (NGF) and glial derived neurotrophic factor (GDNF)
can rescue TTX-R Na+ channel expression in DRG
neurons, both in vivo and in vitro (Aguayo and White
1992
; Black et al. 1997
; Cummins et al.
2000
; Dib-Hajj et al. 1998a
; Zur et al.
1995
). Several studies have shown that distinct, largely
nonoverlapping, populations of DRG neurons express receptors for either
NGF or GDNF (Averill et al. 1995
; Bennett et al.
1998
; Molliver et al. 1997
). NGF and GDNF can
also have distinct, nonoverlapping, effects on DRG neurons (Akkina et al. 2001
; Bennett et al.
1998
), and these two neuronal populations are thought to have
different functions (Stucky and Lewin 1999
). Because
these neurotrophins can have distinct effects on subpopulations of DRG
neurons, several studies have examined their potential for the
treatment of sensory neuropathies (Akkina et al. 2001
;
Boucher et al. 2000
; Ren et al. 1995
).
Ren et al. (1995)
reported that NGF has potent analgesic
effect following chronic constriction injury in rats. Recently,
Boucher et al. (2000)
reported that GDNF, but not NGF,
can alleviate neuropathic pain that follows partial sciatic ligation
and proposed that GDNF might achieve this by repressing
Nav1.3 expression. It has been suggested that the
expression of Nav1.3 contributes to the emergence of the rapidly-repriming sodium current in axotomized neurons (Cummins and Waxman 1997
) and recent patch-clamp studies
on Nav1.3 expressed in heterologous expression
systems and in DRG neurons tend to confirm this hypothesis
(Cummins et al. 2001
). Therefore we asked whether NGF
and/or GDNF could reverse the changes in TTX-S sodium channel repriming
kinetics that occur following peripheral axotomy.
| |
METHODS |
|---|
|
|
|---|
Surgery
Adult male rats were anesthetized with ketamine/xylazine (80/5
mg/kg ip), and right sciatic nerves were exposed at the mid-thigh level, ligated with 4-0 silk sutures, and transected, and the proximal
stumps were placed in silicon cuffs to prevent regeneration (Waxman et al. 1994
). Hydroxystilbamine methanesulfonate
(4% wt/vol; Molecular Probes, Eugene, OR), a retrogradely transported
fluorescent label, was placed in all cuffs prior to insertion of the
nerve stump. The fluorescent label identified neurons that gave rise to
axons that were transected. At the same time, an intrathecal cannula
attached to an osmotic mini-pump (Alzet), which delivered GDNF (12 µg · animal
1 · day
1), NGF (12 µg · animal
1 · day
1),
GDNF plus NGF, or vehicle (saline solution; CSS) to the lumbar enlargement, was implanted (Bennett et al. 1998
). NGF
was purchased from Alomone Labs (Jerusalem, Israel), and GDNF was
purchased from Peprotech (Rocky Hill, NJ).
Culture methods
Cultures of neurons were established from L4/L5 DRG of adult rats. Briefly, lumbar ganglia (L4, L5) were excised, freed from their connective tissue sheaths, and incubated sequentially in enzyme solutions containing collagenase and then papain. The tissue was triturated in culture medium containing 1:1 Dulbecco's modified Eagle's medium (DMEM) and Hank's F12 medium and 10% fetal calf serum, 1.5 mg/ml trypsin inhibitor, 1.5 mg/ml bovine serum albumin, 100 U/ml penicillin, and 0.1 mg/ml streptomycin and plated on polyornithine/laminin-coated coverslips. The cells were maintained at 37°C in a humidified 95% air-5% CO2 incubator.
In experiments involving sciatic nerve ligation and intrathecal
administration of GDNF and/or NGF, neurons derived from naive L4/L5 DRG, axotomized DRG
without neurotrophin administration, and axotomized DRG with
intrathecal GDNF and/or NGF administration were harvested from rats 7 days after surgery and examined within 24 h of plating. The
short-term culture provided cells with truncated axonal processes that
can be readily and reliably voltage clamped and allowed the cells
sufficient time to adhere to the glass coverslip. The spontaneous
electrical activity characteristic of DRG neurons following nerve
injury can be observed in isolated injured neurons but not in isolated
control neurons (Study and Kral 1996
), indicating that
dissociation does not drastically alter the electrophysiological properties of the DRG neurons. Furthermore, adult rat DRG neurons maintained in vitro for 24 h display a profile of sodium channel mRNA expression similar to that for DRG neurons in situ, indicating that short-term culture does not substantially alter the expression of
sodium channel mRNAs in these cells (Black et al. 1996
).
These results suggest that at less than 24 h in culture, changes
in sodium current properties are minimized. By contrast, changes in
both sodium currents and sodium channel mRNA expression can be seen
after 7 days in vitro (Fjell et al. 1999
), clearly
demonstrating that long-term culture can significantly alter the
electrical properties of DRG neurons.
Whole cell patch-clamp recordings
Sodium currents in small (18- to 30-µm diam) DRG neurons were
studied with whole cell patch-clamp techniques at room temperature (approximately 21°C) using an EPC-9 amplifier and the Pulse program (v 8.31). Fire-polished electrodes (0.8-1.2 M
) were fabricated from
1.7-mm capillary glass using a Sutter P-97 puller. Voltage errors were minimized using 80-90% series resistance
compensation. Linear leak subtraction was used for all recordings. The
pipette solution contained (in mM) 140 CsF, 1 EGTA, 10 NaCl, and 10 HEPES, pH 7.3. The standard bathing solution was (in mM) 140 NaCl, 3 KCl, 1 MgCl2, 1 CaCl2, and
10 HEPES, pH 7.3. Cadmium (100 µM) was included to block calcium
currents. The osmolarity of all solutions was adjusted to 310 mosM with
sucrose. TTX-S currents were separated from TTX-R currents using
prepulse inactivation and digital subtraction as previously described
(Black et al. 1999
; Cummins and Waxman
1997
). The time course for repriming of the TTX-S sodium
currents was generally well fit with a single-exponential function. In
some instances a dual-exponential function might have given a better
fit than the single-exponential function. However, to simplify the
comparisons between experimental groups, we used a single-exponential fit.
RNA preparation and cDNA synthesis
Total RNA from L4/L5 DRG was extracted using Qiagen RNeasy mini columns. DRGs from two rats per treatment were pooled and processed. The purified RNA was treated with RNase-free DNase-I (Roche) and re-purified over Qiagen RNeasy mini-column; RNA was eluted in 70 µl volume. First-strand cDNA was reverse transcribed in a final volume of 50 µl using 5 µl purified DNA-free total RNA, 1 mM random hexamer (Roche) 40 U SuperScript II reverse transcriptase (Life Technologies), and 40 U of RNase Inhibitor (Roche). The buffer consisted of (in mM) 50 Tris-HCl (pH 8.3), 75 KCl, 3 MgCl2, 10 DTT, and 5 dNTP. The reaction was allowed to proceed at 37°C for 90 min and 42°C for 30 min, then terminated by heating to 65°C for 10 min. A similar reaction mixture that lacks the reverse transcriptase enzyme was prepared and used as a template to demonstrate absence of contaminating genomic DNA (data not shown).
Real-time PCR
The concept and validation of real-time quantitative PCR have
been previously described (Gibson et al. 1996
;
Heid et al. 1996
; Winer et al. 1999
). We
have used the relative standard curve method to determine the effect of
CSS, GDNF, NGF, and GDNF plus NGF, provided via an intrathecal osmotic
pump on the expression of Nav1.3 Na channels in
DRG of rats with transected sciatic nerve. 18S rRNA was used as an
endogenous control to normalize the expression level of the sodium
channels nerves (Sleeper et al. 2000
). Standard curves
for 18 S rRNA and Nav1.3 were constructed using
serial dilution of cDNA of HEK293 cells transfected with a
Nav1.3 construct (Cummins et al.
2001
). Standards and unknowns were amplified in quadruplets.
The standard curves for the Nav1.3 and 18 S rRNA endogenous control (standards) were constructed from the respective mean Ct value, and the equation
describing the curve was derived using the Sequence Detection System
(SDS) software (Applied Biosystems). The normalized values of control
(nonaxotomized, no intrathecal pump) and treated samples were compared
with determine the effect of the treatment with the neurotrophic factors.
Primers and probes of the Na channel targets were designed using the
software Primer Express (Applied Biosystems) according to the
specification of the TaqMan protocols (see also Winer et al.
1999
). The forward (5' AGGACAATGTCCAGAAGGGTAC 3') and reverse primers (5' AGTAGTCCTGAGTCATGAGTCGAAAC 3') of
Nav1.3 were synthesized and purified at Life
Technologies (Rockville, MD) while the TaqMan probe (5'
FAM-TGGACGAAACCCCAACTACGGCTACAC-TAMRA 3') was synthesized and purified
at Applied Biosystems (Foster City, CA). Primers and probes for the 18 S rRNA were purchased from Applied Biosystems. Primers for
Nav1.3 and 18 S rRNA were used at a final
concentration of 900 and 50 nM, respectively, while the probes were
used at a final concentration of 200 nM. The primer/probe combinations are not limiting at these concentrations (data not shown).
Amplification was done in a 50 µl final volume as previously
described (Sleeper et al. 2000
).
Statistical analysis
Data are expressed as means ± SE. One-way ANOVA was used
to test for significant differences between the experimental groups. Multiple comparison test was used to determine the effectiveness of
different treatments, and Fisher's least-significant difference (LSD)
at
= 0.05 values were determined.
| |
RESULTS |
|---|
|
|
|---|
Analysis of recovery from inactivation for TTX-S sodium currents
DRG neurons express fast-inactivating TTX-S sodium currents and
slow-inactivating TTX-R sodium currents (Caffrey et
1992
; Kostyuk et al. 1981
; Roy and
Narahashi 1992
). Because the fast-inactivating sodium current
in adult small DRG neurons is sensitive to TTX and the
slow-inactivating sodium current is resistant to TTX (Cummins and Waxman 1997
; Cummins et al. 1999
, 2000
;
Dib-Hajj et al. 1999
; Sleeper et al.
2000
), we refer to these currents as TTX-S and TTX-R,
respectively. TTX-S currents have a more hyperpolarized voltage
dependence of inactivation than the TTX-R sodium currents (Fig.
1, A and B), and
therefore prepulse inactivation and digital subtraction can be used to
separate the TTX-S and TTX-R sodium current components (Cummins
and Waxman 1997
; Roy and Narahashi 1992
). This
is illustrated in Fig. 1, A-D. Prepulse inactivation and
digital subtraction give essentially the same result as TTX subtraction
(Cummins and Waxman 1997
).
|
An analogous approach exploiting kinetic differences between TTX-R and
TTX-S currents and using digital subtraction can be used to examine
recovery from inactivation (repriming) kinetics of DRG sodium currents.
Figure 1E shows the repriming time course at
100 mV
for sodium currents recorded from the same DRG neuron shown in Fig. 1,
A and B. The repriming time course is complex (Fig. 1F). As reported previously (Cummins and Waxman
1997
; Elliott and Elliott 1993
), while the TTX-R
current in small DRG neurons exhibits fast repriming (
<1 ms at
100 mV), repriming for the TTX-S current is more than 20-fold slower.
This substantial difference in repriming kinetics can be used to
separate the TTX-S and TTX-R sodium current components. We used 20-ms
pulses to
20 mV to optimize the separation of these currents for the
measurement of repriming kinetics. While a 20-ms pulse to
20 mV is
typically sufficient to fully inactivate TTX-S currents, it does not
fully inactivate the slow-inactivating TTX-R current (as is evident in
Fig. 1E). This enhances the rapid recovery of the TTX-R
current and aids the separation of the TTX-S and TTX-R currents. The
inflection point in the repriming time course (Fig. 1F,
), determined by visual examination of the data traces, was used to
identify the TTX-R current trace used for digital subtraction (Fig.
1E,
). The remaining current is predominantly fast
inactivating (Fig. 1G) and can be used to estimate the time
course for repriming of the TTX-S current (Fig. 1H). The
repriming time course for TTX-S currents is generally well fit with a
single-exponential equation (Fig. 1H;
= 69 ms at
100 mV).
Intrathecal GDNF and NGF rescue TTX-S repriming kinetics
Previously we have shown that the upregulation in
Nav1.3 mRNA levels that occurs following
peripheral axotomy is accompanied by a switch from TTX-S currents with
slow repriming kinetics to TTX-S currents with rapid repriming kinetics
(Black et al. 1999
; Cummins and Waxman
1997
). In the present study, we asked whether GDNF and/or NGF
treatment in vivo would reverse the changes in TTX-S sodium currents
following peripheral axotomy. The sciatic nerve of adult male rats was
transected, and 7-day intrathecal pumps containing GDNF (12 µg/day),
NGF (12 µg/day), both GDNF and NGF (each 12 µg/day), or vehicle
(complete saline solution, CSS) were implanted. Seven days after
surgery, the L4 and L5 DRG were harvested and cultured. Small (18-30 µm) neurons were studied using whole cell patch-clamp recordings within 24 h after
dissociation. Axotomized neurons were identified by the retrograde
uptake of the fluorescent tracer (see METHODS). Figure
2 shows representative TTX-S sodium
currents recorded from control (A), CSS-treated axotomized (B), GDNF-treated axotomized (C), NGF-treated
axotomized (D), and GDNF + NGF-treated (E)
axotomized neurons, illustrating the repriming time course at
80 mV.
The pulse protocol is shown in Fig. 2F. This is the same
pulse protocol used to collect the data shown in Fig. 1E.
However, in Fig. 2, A-E, the TTX-R current has been
subtracted out and the TTX-S currents are shown plotted against the
recovery duration. For all five groups, the repriming time course for
TTX-S currents was fit with a single-exponential equation (Fig.
2G).
|
The TTX-S sodium currents reprime significantly faster at
80 mV in
axotomized DRG neurons treated with CSS than in control neurons. The
TTX-S current repriming time constant at
80 mV was reduced from
150.8 ± 12.2 ms (n = 41 cells from 4 rats) in
control DRG neurons to 55.0 ± 4.7 ms (n = 32 cells from 4 rats) in CSS-treated axotomized neurons (Fig. 2,
G and H). This acceleration of repriming following peripheral axotomy is similar to what we previously reported
(Black et al. 1999
), indicating that intrathecal CSS treatment does not alter the effects of axotomy on TTX-S repriming kinetics.
GDNF and NGF each partially restored repriming toward control levels
(Fig. 2, G and H). The TTX-S sodium current
repriming time constants at
80 mV were larger in axotomized small DRG
neurons from animals with GDNF in the intrathecal pump (
= 92.0 ± 5.3 ms, n = 66 cells from 4 animals)
compared with CSS-treated axotomized neurons. The TTX-S currents in
axotomized small DRG neurons from animals with NGF in the intrathecal
pump also exhibited slower repriming compared with CSS-treated
axotomized neurons at
80 mV (
= 97.2 ± 9.4 ms,
n = 39 cells from 3 animals). ANOVA indicated that
there were significant differences between the groups
(P < 0.05). Pairwise comparisons (Fisher's LSD
multiple comparison test) revealed that the repriming kinetics of the
TTX-S sodium currents at
80 mV in NGF- and GDNF-treated neurons were
significantly different from the repriming kinetics in both CSS-treated
axotomized neurons and control neurons (P < 0.05).
However, the repriming kinetics of the TTX-S sodium currents in NGF-
and GDNF-treated neurons were not significantly different.
Because both GDNF and NGF each partially reversed the effect of axotomy
on the repriming time course of TTX-S currents in small neurons, we
examined the effect of supplying NGF and GDNF simultaneously in
intrathecal pumps. The TTX-S current repriming time constant at
80 mV
was 164.2 ± 16.6 ms (n = 32 cells from 2 animals)
in axotomized small DRG neurons from animals with both GDNF and NGF in
the intrathecal pump. Pairwise comparisons (Fisher's LSD multiple
comparison test) revealed that the repriming kinetics of the TTX-S
sodium currents at
80 mV in NGF + GDNF-treated neurons were
significantly different from the repriming kinetics in CSS-, NGF-, and
GDNF-treated axotomized neurons but not control neurons (P < 0.05). Thus only co-administration of GDNF and
NGF appears to completely reverse the effect of peripheral axotomy on
TTX-S repriming time course at
80 mV (Fig. 2, G and
H).
The time course for recovery from inactivation was also examined at
voltages ranging from
140 to
60 mV, using the same protocol as in
Fig. 2 except that the recovery voltage
(Vrec in Fig. 2F) was
changed accordingly. Figure 3 shows that
the TTX-S current in axotomized neurons treated with CSS reprimes more
rapidly than the TTX-S current in control neurons throughout this
voltage range. Both NGF and GDNF partially restored the TTX-S repriming
kinetics to control levels (Fig. 3). ANOVA plus pairwise comparisons
(Fisher's LSD multiple comparison test, P < 0.05) was
used to determine statistical significance of the observed changes in
the repriming time constant. The repriming kinetics of the TTX-S sodium
currents recorded from GDNF-treated neurons were significantly
different from the repriming kinetics in CSS-treated axotomized neurons at
70,
80,
100, and
140 mV and from control neurons at
80,
90,
100,
120, and
140 mV. The repriming kinetics of the TTX-S sodium currents in NGF-treated neurons were also significantly different from those in both CSS-treated axotomized neurons and control
neurons at
80,
90,
100,
120, and
140 mV. The repriming time
constants were larger for the TTX-S currents in small axotomized DRG
neurons treated with GDNF plus NGF than in those treated with GDNF or
NGF alone (Fig. 3). The repriming time constant was significantly slower in the axotomized DRG neurons treated with GDNF plus NGF than in
those treated with CSS at all recovery potentials examined ranging from
60 to
140 mV. However, the time constants were not significantly
different from those of control TTX-S sodium currents at
140,
100,
80, and
60 mV.
|
In an effort to better understand the effects of GDNF and NGF on
repriming kinetics, we categorized the TTX-S repriming kinetics as
either fast or slow for every cell in each group and then examined the
relative distribution of the two cell types (Fig.
4). The repriming kinetics were
considered fast if the time constant was smaller than 80.8 ms at
80
mV, otherwise they were considered slow. This value is derived from the
mean + 1 SD for the TTX-S repriming time constant calculated for the
CSS-treated axotomized cells at
80 mV. Differences between the groups
were compared using nonparametric
2 tests.
There was not a significant difference (P > 0.05)
between the control group and the GDNF + NGF-treated axotomized group. By contrast, a significantly (P < 0.02) larger
proportion of the neurons in the CSS-, GDNF-, and NGF-treated
axotomized groups exhibited fast repriming kinetics compared with the
control group. However, the GDNF- and NGF-treated axotomized groups
also had a significantly (P < 0.001) higher proportion
of neurons with predominantly slow repriming kinetics compared with the
CSS-treated axotomized group. Thus while the TTX-S currents in control
neurons and GDNF + NGF-treated axotomized neurons exhibited
predominantly slow repriming kinetics and the TTX-S currents in
CSS-treated axotomized neurons exhibited predominantly fast repriming
kinetics, the GDNF- and NGF-treated axotomized neurons were roughly
split between those with fast and those with slow TTX-S repriming
kinetics. Similar distributions were observed at the other voltages at
which repriming was examined (data not shown). This distribution is consistent with the known distribution of NGF- and GDNF-responsive small DRG neurons.
|
Intrathecal GDNF and NGF rescue Nav1.3 mRNA levels in vivo
The emergence of rapidly repriming TTX-S currents following
axotomy or chronic constriction injury (CCI) of rat sciatic nerve is
paralleled by an upregulation of Nav1.3 channel
transcription in DRG neurons (Dib-Hajj et al. 1996
,
1999
; Waxman et al. 1994
). To determine the
effect of GDNF and NGF delivered to the intrathecal space on the
expression level of Nav1.3 transcripts in
axotomized DRG neurons, the relative standard curve method of real-time
PCR, which is an accurate and sensitive method for quantifying mRNA levels (Gibson 1996
; Heid 1996
), was
used. Two standard curves for the endogenous control (18S rRNA) and
Nav1.3 were constructed using the respective
primers/probe set, and serial dilutions of transfected HEK293 cell line
as templates. The line formula for the two standard curves for
quantitation were y = 40.335
2.932x (R2 = 0.838) for
Nav1.3 and y = 20.243
3.212x (R2 = 0.923) for 18S rRNA. The unknown samples were also amplified using
the respective primers/probes (in separate reactions). The relative
amounts of the Nav1.3 channel were quantitated by
linear extrapolation of the Ct values
using the equation in the preceding text. These values were then
normalized by the relative amounts of the endogenous control 18S rRNA
determined by the linear extrapolation of the respective
Ct values and line formula. The
normalized values (no units) of Nav1.3 were then
compared between the treated and untreated samples for each experiment
(Fig. 5).
|
ANOVA indicated that there were significant differences between the groups. Pairwise comparisons (Fisher's LSD multiple comparison test; P < 0.05) revealed that GDNF and NGF individually or in combination attenuated the increase in the level of Nav1.3 transcripts in axotomized DRG neurons. The average level of Nav1.3 in axotomized DRG of rats that were treated with CSS (vehicle) showed a 3.3-fold increase in the transcription level of Nav1.3 compared with naïve animals (Fig. 5). The application of GDNF or NGF individually reduced the increase in Nav1.3 level following axotomy. GDNF appears to be more potent in reducing Nav1.3 level compared with NGF, although both GDNF and NGF were significantly different from CSS-treated animals. GDNF or NGF alone, however, did not reduce Nav1.3 expression to control levels. Only GDNF plus NGF reduced the transcription level of Nav1.3 to a level comparable to that of the control (means are not statistically different, Fisher's LSD multiple comparison test; P > 0.05).
| |
DISCUSSION |
|---|
|
|
|---|
Peripheral nerve injury has dramatic effects on both the
expression of sodium channel transcripts and the properties of sodium currents in small sensory neurons. In this study we show that GDNF and
NGF can substantially reverse the upregulation of mRNA for the sodium
channel Nav1.3 (previously referred to as
type III) and can reverse the switch from TTX-S currents with
predominantly slow repriming kinetics to TTX-S currents with more rapid
repriming kinetics in axotomized DRG neurons. When applied
intrathecally at a concentration that has been shown to have profound
analgesic effects on neuropathic pain (Boucher et al.
2000
), GDNF partially reverses the effect of axotomy on
Nav1.3 mRNA expression and TTX-S repriming
kinetics in axotomized small DRG neurons. NGF also partially reversed
these effects of axotomy. However, only GDNF plus NGF applied together
returned TTX-S repriming kinetics and Nav1.3 mRNA
levels in axotomized DRG neurons to the values found in control DRG.
Several lines of evidence indicate that NGF and GDNF act on largely
distinct populations of DRG cells (Akkina et al. 2001
; Averill et al. 1995
; Bennett et al. 1998
;
Kashiba et al. 1998
; Molliver et al.
1997
). While most small DRG neurons express receptors for NGF
or GDNF, it has been estimated that only approximately 15% express
receptors for both. Bennett et al. (1998)
found that while intrathecal application of either 12 µg/day NGF or 12 µg/day GDNF had partial yet significant effects on reducing the
axotomy-induced slowing of C-fiber conduction velocity, the effects
were slightly different. However, they reported that intrathecal
delivery of 12 µg/day NGF plus 12 µg/day GDNF produced a nearly
complete reversal of the effect of axotomy on C-fiber conduction
velocity. Thus the additive effects of GDNF and NGF on the transcript
levels of Nav1.3 could be a result of the action of these trophic
factors on distinct groups of DRG neurons.
An alternative possibility is that this additive effect of GDNF and NGF
is simply a reflection of the total amount of neurotrophin applied (24 vs. 12 µg/day). While we have not addressed this experimentally, we
think that it is unlikely because we used what appears to be a
saturating dose of 12 µg/day for each factor. Bennett et al. (1998)
found only slight increases in the effectiveness of NGF or GDNF when intrathecal dose was increased from 1.2 to 12 µg/day. For example, they reported that the 10-fold increase in GDNF or NGF
concentration enhanced only marginally the rescue of staining for the
lectin IB4, and calcitonin-gene-related peptide (CGRP), respectively, in axotomized DRG neurons (Bennett et al.
1998
). Bennett et al. (1998)
also showed that
intrathecal NGF did not significantly effect IB4 staining of axotomized
DRG neurons at either 1.2 or 12 µg/day, and GDNF, at either 1.2 or 12 µg/day, did not significantly rescue CGRP staining following axotomy
(Bennett et al. 1998
). Therefore the most likely
explanation for the complementary actions and larger response when GDNF
and NGF are combined is that they act on different receptors on
distinct neuronal populations.
The hypothesis that Nav1.3 channels underlie some
of the rapidly repriming current observed in axotomized small DRG
neurons is supported by our recent study, which showed that recombinant Nav1.3 sodium channels expressed in HEK293 cells
exhibit relatively rapid repriming at recovery potentials from
140 to
80 mV (Cummins et al. 2001
). However, although both
NGF and GDNF partially reversed the effect of axotomy on TTX-S
repriming kinetics and Nav1.3 mRNA expression
levels, this does not exclude the possibility that these factors affect
other TTX-S sodium channels. Indeed, D'Arcangelo et al.
(1993)
reported that NGF can regulate both
Nav1.2 and Nav1.7 channels
in PC12 cells. DRG neurons express multiple TTX-S and TTX-R sodium
channels (Black et al. 1996
; Dib-Hajj et al.
1998b
). Although DRG neurons do not express significant levels
of Nav1.2, Nav1.7 might be
the predominant TTX-S sodium channel expressed in control small DRG
neurons (Black et al. 1996
). Coward et al. (2001)
reported that expression of Nav1.7
is decreased after nerve injury. Because Nav1.7
channels exhibit slow repriming kinetics (Cummins et al.
1998
), it is possible that a reduction in expression of
Nav1.7 contributes, at least in part, to the loss
of slow repriming TTX-S current. However, uninjured rat small DRG
neurons also express mRNA for Nav1.1 and
Nav1.6 (Black et al. 1996
). The
repriming kinetics of Nav1.1 and
Nav1.6 have not been characterized, and it is not
known if expression of these channels is altered by nerve injury.
Changes in TTX-S repriming kinetics induced by axotomy and growth
factors might also be due to posttranslational modifications and/or
association with channel partners. Indeed, we have shown that the cell
background and presence of specific sodium channel
subunits can
alter the repriming kinetics of recombinant
Nav1.3 sodium channels (Cummins et al.
2001
).
The TTX-S repriming time constants were estimated following digital
subtraction of the slow-inactivating TTX-R currents. However, TTX-R
current density is greatly reduced after axotomy (Cummins and
Waxman 1997
), and NGF and GDNF can both partially reverse the
effects of axotomy on TTX-R current density (Cummins et al. 2000
; Dib-Hajj et al. 1998a
). Although this
raises the possibility that the TTX-S repriming kinetic estimates might
be affected by the digital subtraction technique that we used to
separate the TTX-S and TTX-R currents, we consider this unlikely. We
have also used the digital subtraction technique to examine the
repriming kinetics of TTX-S currents in large cutaneous afferent DRG
neurons, which also express substantial slow-inactivating TTX-R current generated by Nav1.8 sodium channels
(Akopian et al. 1999
, Renganathan et al.
2000
). The repriming kinetics of TTX-S currents measured in
these large-diameter DRG neurons, using the digital subtraction technique, are much faster (
approximately 20 ms at
80 mV) than the TTX-S repriming kinetics measured in small-diameter DRG neurons (Everill et al. 2001
). This shows that fast TTX-S
repriming kinetics can be measured in the presence of TTX-R currents.
In addition, the repriming kinetics measured for heterologously
expressed recombinant Nav1.7 sodium channels,
which may be the predominant TTX-S sodium channel isoform expressed in
small DRG neurons (Black et al. 1996
), are slow
(Cummins et al. 1998
). This shows that slow TTX-S
repriming kinetics can be measured in the absence of TTX-R currents.
Therefore our observation of slow repriming kinetics for TTX-S currents in control small DRG neurons, and in axotomized small DRG neurons exposed to NGF and GDNF, do not arise from the method used to subtract
the slow-inactivating TTX-R current.
There are several mechanisms by which changes in the properties of
sodium currents in DRG neurons may increase the excitability of DRG
neurons after injury to their axons. As a result of the more rapid
repriming of the TTX-sensitive sodium current in small DRG neurons
following axotomy, refractory period would be expected to be shorter in
injured DRG neurons so that they can sustain higher firing frequencies
(Cummins and Waxman 1997
). Black et al.
(1999)
also observed a dramatic accumulation of
Nav1.3 protein at the axonal tips in the neuroma
that forms following transection of the sciatic nerve. Increased sodium
conductance due to increased numbers of channels, per se, can lower the
threshold for action potential generation (Matzner and Devor
1992
) and might also contribute to ectopic impulse generation
following nerve injury.
Reversal of changes in repriming kinetics of the TTX-S current in
axotomized DRG neurons is predicted to reduce their hyperexcitability. Boucher et al. (2000)
reported that intrathecal GDNF was
able to reverse the mechanical and thermal hyperalgesia induced by L5 sciatic nerve ligation (SNL). They also show
that the L5 SNL, like the complete sciatic nerve
ligation, upregulates expression of Nav1.3
transcript and downregulates Nav1.8 and
Nav1.9 transcript levels and have observed that
GDNF partially reverses these changes in sodium channel expression.
Boucher et al. (2000)
also reported that intrathecal
GDNF, but not intrathecal NGF, prevented the development of mechanical
and thermal hyperalgesia that occurred after partial sciatic ligation
(PSL). However, Ren et al. (1995)
reported that NGF
applied to the site of a chronic constriction injury (CCI) was able to
alleviate both mechanical and thermal hyperalgesia. It is not clear why
NGF was effective at reducing hyperalgesia in CCI but not in PSL. Both
sciatic nerve ligation (Black et al. 1999
;
Boucher et al. 2000
) and CCI (Dib-Hajj et al.
1999
) increase expression of Nav1.3, and,
as we have shown in this study, both NGF and GDNF partially rescue the
slowly-repriming TTX-S sodium current in small DRG neurons after
sciatic nerve injury. Different injury models may involve different
pain mechanisms and possibly different subgroups of DRG neurons. As
mentioned in the preceding text, several studies indicate that NGF and
GDNF act on distinct subgroups of DRG neurons that have different
functional roles (Bennett et al. 1998
; Kashiba et
al. 1998
; Stucky and Lewin 1999
). This could
explain why NGF was more effective at reversing hyperalgesia in the CCI
model than in the PSL injury model.
In summary, our results demonstrate, for the first time, that GDNF and
NGF can reverse the changes in TTX-S sodium current repriming kinetics,
which are at least partially due to upregulation of
Nav1.3 sodium channels in axotomized DRG neurons
in vivo. Because neurotrophins regulate the expression of many genes,
including TTX-R sodium channels (Cummins et al. 2000
;
Fjell et al. 1999
) and potassium channels
(Everill et al. 2000
) in sensory neurons, the analgesic
actions of NGF and GDNF may not be only due to suppression of
Nav1.3 expression. However, because abnormal
sodium channel expression in DRG neurons has been implicated in the
pathogenesis of neuropathic pain, development of
Nav1.3 specific blockers may be relevant to the
development of therapeutic strategies for pain after nerve injury.
| |
ACKNOWLEDGMENTS |
|---|
We thank B. Toftness for excellent technical support.
This work was supported in part by grants from the National Multiple Sclerosis Society and the Medical Research Service and Rehabilitation Research Service, Department of Veterans Affairs (S. G. Waxman). We also thank the Eastern Paralyzed Veterans Association, the Paralyzed Veterans of America and the Nancy Davis Foundation for support.
| |
FOOTNOTES |
|---|
Address for reprint requests: S. G. Waxman, Dept. of Neurology, 707 LCI, Yale University School of Medicine, 333 Cedar St., PO Box 208018, New Haven, CT 06520-8018 (E-mail: Stephen.Waxman{at}Yale.Edu).
Received 27 September 2001; accepted in final form 3 April 2002.
| |
REFERENCES |
|---|
|
|
|---|
-subunit mRNAs.
Mol Brain Res
43:
117-132, 1996[Medline].
-SNS sodium channel expression in small dorsal root ganglion neurons after axotomy by nerve growth factor in vivo.
J Neurophysiol
79:
2668-2678, 1998a
-SNS in spinal sensory neurons following axotomy.
Proc Natl Acad Sci USA
93:
14950-14954, 1996
-type) adult cutaneous afferent dorsal root ganglion neurons display rapid recovery from inactivation before and after axotomy.
Neuroscience
106:
161-169, 2001[Web of Science][Medline].
-SNS produces the slow TTX-resistant sodium current in large cutaneous afferent DRG neurons.
J Neurophysiol
84:
710-718, 2000
- and
-subunit mRNAs in cultured embryonic DRG neurons following exposure to NGF.
Mol Brain Res
30:
97-103, 1995[Medline].
This article has been cited by other articles:
![]() |
C.-N. Liu and C. J. Somps Na+/H+ Exchanger-1 Inhibitors Reduce Neuronal Excitability and Alter Na+ Channel Inactivation Properties in Rat Primary Sensory Neurons Toxicol. Sci., June 1, 2008; 103(2): 346 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brugeaud, C. Travo, D. Dememes, M. Lenoir, J. Llorens, J.-L. Puel, and C. Chabbert Control of Hair Cell Excitability by Vestibular Primary Sensory Neurons J. Neurosci., March 28, 2007; 27(13): 3503 - 3511. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Rush, T. R. Cummins, and S. G. Waxman Multiple sodium channels and their roles in electrogenesis within dorsal root ganglion neurons J. Physiol., February 15, 2007; 579(1): 1 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
P Sarchielli, A Alberti, A Candeliere, A Floridi, G Capocchi, and P Calabresi Glial Cell Line-Derived Neurotrophic Factor and Somatostatin Levels in Cerebrospinal Fluid of Patients Affected by Chronic Migraine and Fibromyalgia Cephalalgia, April 1, 2006; 26(4): 409 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yu and J. D. Kocsis Schwann Cell Engraftment Into Injured Peripheral Nerve Prevents Changes in Action Potential Properties J Neurophysiol, August 1, 2005; 94(2): 1519 - 1527. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Shah, A. M. Rush, S. Liu, L. Tyrrell, J. A. Black, S. D. Dib-Hajj, and S. G. Waxman Contactin Associates with Sodium Channel Nav1.3 in Native Tissues and Increases Channel Density at the Cell Surface J. Neurosci., August 18, 2004; 24(33): 7387 - 7399. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Hains, C. Y. Saab, J. P. Klein, M. J. Craner, and S. G. Waxman Altered Sodium Channel Expression in Second-Order Spinal Sensory Neurons Contributes to Pain after Peripheral Nerve Injury J. Neurosci., May 19, 2004; 24(20): 4832 - 4839. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Hains, J. P. Klein, C. Y. Saab, M. J. Craner, J. A. Black, and S. G. Waxman Upregulation of Sodium Channel Nav1.3 and Functional Involvement in Neuronal Hyperexcitability Associated with Central Neuropathic Pain after Spinal Cord Injury J. Neurosci., October 1, 2003; 23(26): 8881 - 8892. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yanagita, H. Kobayashi, Y. Uezono, H. Yokoo, T. Sugano, T. Saitoh, S.-I. Minami, S. Shiraishi, and A. Wada Destabilization of Nav1.7 Sodium Channel alpha -Subunit mRNA by Constitutive Phosphorylation of Extracellular Signal-Regulated Kinase: Negative Regulation of Steady-State Level of Cell Surface Functional Sodium Channels in Adrenal Chromaffin Cells Mol. Pharmacol., May 1, 2003; 63(5): 1125 - 1136. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |