JN Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Neurophysiol 90: 155-164, 2003. First published March 20, 2003; doi:10.1152/jn.00244.2003
0022-3077/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
90/1/155    most recent
00244.2003v2
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bao, H.
Right arrow Articles by Eatock, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bao, H.
Right arrow Articles by Eatock, R. A.

Voltage-Gated Calcium Channel Currents in Type I and Type II Hair Cells Isolated From the Rat Crista

Hong Bao1, Weng Hoe Wong1, Jay M. Goldberg2 and Ruth Anne Eatock1

1The Bobby R. Alford Department of Otorhinolaryngology and Communicative Sciences, Baylor College of Medicine, Houston, Texas 77030; and 2Department of Neurobiology, Pharmacology, and Physiology, University of Chicago, Chicago, Illinois 60637

Submitted 3 April 2002; accepted in final form 13 March 2003


 ABSTRACT
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
When studied in vitro, type I hair cells in amniote vestibular organs have a large, negatively activating K+ conductance. In type II hair cells, as in nonvestibular hair cells, outwardly rectifying K+ conductances are smaller and more positively activating. As a result, type I cells have more negative resting potentials and smaller input resistances than do type II cells; large inward currents fail to depolarize type I cells above –60 mV. In nonvestibular hair cells, afferent transmission is mediated by voltage-gated Ca2+ channels that activate positive to –60 mV. We investigated whether Ca2+ channels in type I cells activate more negatively so that quantal transmission can occur near the reported resting potentials. We used the perforated patch method to record Ca2+ channel currents from type I and type II hair cells isolated from the rat anterior crista (postnatal days 4–20). The activation range of the Ca2+ currents of type I hair cells differed only slightly from that of type II cells or nonvestibular hair cells. In 5 mM external Ca2+, currents in type I and type II cells were half-maximal at –41.1 ± 0.5 (SE) mV (n = 10) and –37.2 ± 0.2 mV (n = 10), respectively. In physiological external Ca2+ (1.3 mM), currents in type I cells were half-maximal at –46 ± 1 mV (n = 8) and just 1% of maximal at –72 mV. These results lend credence to suggestions that type I cells have more positive resting potentials in vivo, possibly through K+ accumulation in the synaptic cleft or inhibition of the large K+ conductance. Ca2+ channel kinetics were also unremarkable; in both type I and type II cells, the currents activated and deactivated rapidly and inactivated only slowly and modestly even at large depolarizations. The Ca2+ current included an L-type component with relatively low sensitivity to dihydropyridine antagonists, consistent with the {alpha} subunit being CaV1.3 ({alpha}1D). Rat vestibular epithelia and ganglia were probed for L-type {alpha}-subunit expression with the reverse transcription-polymerase chain reaction. The epithelia expressed CaV1.3 and the ganglia expressed CaV1.2 ({alpha}1C).


 INTRODUCTION
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Transmitter release from hair cells requires Ca2+ influx through voltage-gated Ca2+ channels (reviewed in Fuchs 1996Go; Sewell 1996Go). In auditory hair cells, most of the voltage-gated Ca2+ current appears to be carried by L-type channels (Platzer et al. 2000Go; Schnee and Ricci 2002Go; Zidanic and Fuchs 1995Go). Such channels are selectively affected by dihydropyridines with sensitivity that varies across L-channel subtypes. Dihydropyridine (DHP) antagonists partly block both Ca2+ currents and exocytosis in mouse cochlear hair cells (Moser and Beutner 2000Go) and partly block the Ca2+ currents but completely block exocytosis in chick cochlear hair cells (Spassova et al. 2001Go). The spontaneous and sound-evoked discharges of guinea pig cochlear afferents are depressed by DHP antagonists but not by a blocker of N-type Ca2+ channels (Robertson and Paki 2002Go). The pore-forming {alpha} subunit that predominates in the chick cochlea is the CaV1.3 ({alpha}1D) subunit (Kollmar et al. 1997Go), which, among L-type channels, is relatively insensitive to DHP antagonists (Koschak et al. 2002Go; Xu and Lipscombe 2001Go). Mice that are null for CaV1.3 lack most of the cochlear inner hair cell Ca2+ current, have no discernable auditory brain stem response, and are deaf (Platzer et al. 2000Go). Remarkably, there are no obvious vestibular deficits in the CaV1.3-null mice (Platzer et al. 2000Go), raising the possibility that other Ca2+ channel types operate in mammalian vestibular hair cells. Here we have investigated whether hair cells from the sensory epithelium (crista) of the rat anterior semicircular canal have an L-type component and whether that component is CaV1.3.

In auditory hair cells of all vertebrates and in all hair cells of fish and amphibians, the primary afferent neuron forms bouton endings on hair cells, opposite presynaptic ribbons. In the vestibular organs of mammals, birds, and reptiles, however, there are two kinds of afferent terminals: bouton endings on type II hair cells and unusual cup-shaped endings, called calyces, on type I hair cells (Wersäll and Bagger-Sjöbäck 1974Go). The calyx ending differs from the much-studied calyces of Held and of the superior cervical ganglia (reviewed in Catterall 1999Go; von Gersdorff and Borst 2002Go) in being postsynaptic rather than presynaptic. It envelopes much of the basolateral membrane of the hair cell. Although this unusual morphology has long excited speculation about the nature of transmission at this synapse, the presence of numerous synaptic dense bodies and vesicles in type I hair cells of the mature rodent crista (Lysakowski and Goldberg 1997Go) implies that quantal transmission takes place, possibly in combination with other forms of transmission.

According to the prevailing view of quantal transmission at the hair cell synapse, some hair cell Ca2+ channels must be open near the resting potential, VR, to account for background firing levels in afferent fibers. For most hair cells, VR is –60 mV or more positive and therefore reasonably close to the activation range of Ca2+ channels in hair cells of the frog saccule and chick and mouse cochleas (positive to –60 or –50 mV) (reviewed in Zidanic and Fuchs 1995Go). Type I hair cells, however, have unusually negative resting potentials (–70 to –85 mV) and low input resistances (10–100 M{Omega}) because they express a large, negatively activating K+ conductance (gK,L or gKI) (Brichta et al. 2002Go; Chen and Eatock 2000Go; Correia and Lang 1990Go; Rennie and Correia 1994Go; Rennie et al. 1996Go; Rüsch and Eatock 1996bGo). This is true for diverse preparations (semicircular canals and utricles from reptiles, birds, and mammals) and recording conditions (isolated hair cells vs. excised, intact epithelia; ruptured-patch vs. perforated-patch modes of whole cell recording). If these properties hold in vivo, then there should be little quantal transmitter release because even large transduction currents would not depolarize the hair cell into the activation range of the Ca2+ channels. Yet "calyx afferents," which innervate type I cells, have both background and evoked discharges (Baird et al. 1988Go; Goldberg et al. 1990Go; Schessel et al. 1991Go).

Two kinds of solution have been proposed. Transmission at the type I/calyx synapse may be partly mediated by other mechanisms, such as ephaptic transmission (Gulley and Bagger-Sjöbäck 1979Go; Hamilton 1968Go; Trussell 2000Go; Yamashita and Ohmori 1990Go, 1991Go) or depolarization by extracellular K+ accumulation (Chen 1995Go; Goldberg 1996Go). A second kind of proposal is that in vivo, modulation of gK,L reduces its activation at VR (Behrend et al. 1997Go; Chen and Eatock 2000Go), thereby depolarizing the cells and increasing their input resistances. For this study, we considered a third possibility: that the activation range of Ca2+ channels in type I hair cells is unusually negative and therefore overlaps the membrane potential for background levels of stimulation. We report that in type I cells of the rat crista, the Ca2+ channel activation range is only slightly negative to that in type II cells, not enough to compensate for the type I cell's much more negative resting potential and low input resistance.


 METHODS
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Cell preparation

Hair cells were dissociated from the sensory epithelia of anterior cristas from young Long-Evans rats (postnatal days, P, 4–20) as previously described (Chen and Eatock 2000Go). All procedures for handling animals were approved by the animal care review committee at Baylor College of Medicine. All dissections were done in L-15 (GIBCO BRL; additionally buffered with 10 mM HEPES, pH 7.3, 330 mmol/kg). The ampulla was excised and placed in L-15 medium, supplemented with 1.2 mM EGTA, to lower Ca2+ to 100 µM, and the following enzymes: protease XXVII (Sigma, St. Louis MO; 500 µg/ml) for 10 min at room temperature and papain (crude papain, Sigma, 500 µg/ml) and L-cysteine (300 µg/ml) for 45 min at 37°C. All subsequent procedures, including recording, were at room temperature (22–25°C). The ampulla was transferred from the papain solution to L-15 containing bovine serum albumen (500 µg/ml; 10 min) and then to the experimental chamber. Cells were brushed off the sensory epithelium with an eyelash and allowed to settle on the glass floor of the chamber. The cells were viewed on an inverted microscope at x400 or x600 with differential interference contrast optics (Olympus IMT-2, Olympus, Lake Success NY). The chamber was superfused at a low rate with "standard external solution" (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. External solutions

 

Solutions

Whole cell recordings were made with the perforated-patch method (Horn and Marty 1988Go). The internal solution contained (in mM) 75 Cs2SO4, 35 CsCl, 5 MgSO4, 0.1 CaCl2, 5 HEPES, and 5 EGTA and 480 µg/ml amphotericin B; pH 7.4 and osmolality 285 mmol/kg. The external solutions used during recordings are given in Table 1. The channel blockers tetraethylammonium chloride (TEA-Cl), 4-aminopyridine (4-AP), and tetrodotoxin (TTX) were all obtained from Sigma. Seal formation was always made in the standard external solution. We ascertained that recordings were in perforated-patch mode rather than ruptured-patch mode by the gradual reduction in access resistance and by the persistence of the Ca2+ channel currents, which washed out rapidly in ruptured-patch mode because of the lack of ATP in the internal solution (Forscher and Oxford 1985Go). Final series resistance, Rs, was between 5 and 25 M{Omega} and was electronically compensated with the amplifier circuitry by 50–80%.

Drug- and blocker-containing solutions were applied by local perfusion. Separate lines containing the standard external solution and the test solution were fed through a peristaltic pump into needles, which were lowered into the bath after whole cell currents were recorded in the bath solution (standard external solution). The cell was then moved into the flow of solution from each needle.

Junction potentials were calculated with JPCalc software (Barry 1994Go). The calculated liquid junction potential in standard external solution (Table 1) was 9 mV. Local perfusion with the other solutions, in which TEA-Cl replaced NaCl as the dominant salt, added 4 mV to the total junction potential correction. No corrections were made for Donnan potentials that might arise across the perforated patch if there were differences between the impermeant ion concentrations in the hair cell's endogenous solution and the pipette solution. Such potentials are likely to be small based on other experiments on delayed rectifier currents in type II hair cells. The pipette solution was similar to that used here except that K+ replaced Cs+. Half-maximal activation voltages were –29 ± 2 (SE) mV (n = 8 cells) in the ruptured-patch mode and –30 ± 1 mV (20 cells) in the perforated-patch mode, suggesting that Donnan potentials across the perforated patch were negligible (K. M. Hurley and R. A. Eatock, unpublished observations).

Recording

Recordings were made with a patch-clamp amplifier (L/M EPC-7, Adams and List Associates, Great Neck, NY) and a 12-bit acquisition board (Digidata 1200, Axon Instruments, Foster City, CA), controlled by pClamp 6.1 software (Axon Instruments). The clamp rise time was on the order of ≤50 µs [(Rs ≤ 10 M{Omega}) x (Cm < 5 pF)]. The amplifier output was low-pass filtered at 5 kHz with an 8-pole Bessel filter (Model 901, Frequency Devices, Haverhill, MA). In most protocols, test steps were 10 ms, and the filtered Ca2+-channel data were sampled at 10-µs intervals. For longer test steps to study Ca2+-channel inactivation, sampling intervals were 1.5 ms, and the data during this portion of the sweep were filtered off-line at 200 Hz with digital filtering algorithms in Clampfit (v. 8, Axon Instruments).

LEAK SUBTRACTION. We usually used a voltage protocol, called "P, –P/4", which provides on-line leak subtraction (Armstrong and Bezanilla 1974Go). Before each trial, the entire test waveform (P) was divided by –4 and the resulting –P/4 waveform was presented four times from a potential of –103 mV (to be out of the range of activation of gK,L). The method assumes that the –P/4 waveform evokes only linear leak current and that the total current summed over the four –P/4 steps is equal and opposite to the linear leak current evoked by P. The sum of the currents evoked by the –P/4 waveform was summed with the current evoked by P, leaving only nonlinear current.

For our usual protocol (10-ms test steps with an inter-trial interval of 100 ms), each trial comprised, in order, four small 10-ms steps (–P/4; from –103 mV), the test step (P; from –73 mV), and a final 40-ms interval at –73 mV.

Data analysis

Voltages were corrected off-line for liquid junction potentials but not for uncompensated series resistance. Maximum voltage errors were ≤5 mV (corresponding to total currents ≤500 pA and residual Rs ≤ 10 M{Omega}) and most often on the order of 1 mV.

To study the voltage dependence of activation, we delivered a series of 10-ms voltage steps from the holding potential and plotted the current values at 9 ms after the step, well after activation was complete and before significant inactivation occurred. The I-V curves are nonmonotonic; at large depolarizations, when the channels are fully activated, current decreases as driving force decreases. The increasing part of the I-V relation, from –83 mV to the voltage corresponding to the peak current, was fitted with a first-order Boltzmann function

(1)
where Imax is the maximum current, V is the voltage, V1/2 is the voltage at half-maximal activation, and S is the voltage change per e-fold increase of I(V).

The activation time course of Ca2+ channel currents was fitted with a Hodgkin-Huxley equation

(2)
in which I(t) is the current at time t, Iss is the steady-state current, {tau} is a time constant of activation, and {alpha} is the power, usually 3.

The decay of the current (inactivation) during a 500-ms pulse was fitted by a single exponential function

(3)
in which I(t) is the current at time t, Iss is the steady-state current, A is the amplitude of the decaying component at time 0, and {tau} is the time constant of decay.

Results are presented as means ± SE.

RT-PCR

We did reverse transcription-polymerase chain reaction (RT-PCR) to look for expression of the pore-forming {alpha} subunits of known L-type Ca2+ channels. To prepare vestibular epithelia for RT-PCR, we dissected ampullas, utricles, and vestibular ganglia using methods similar to those described in the preceding text. We then exposed the ampullas and utricles to protease XXIV (Sigma; 100 µg/ml in standard external solution) for 10 min at room temperature to loosen connections to overlying accessory structures, which were then removed. To loosen the epithelia from the underlying stroma, we then treated the ampullas and utricles with protease X (thermolysin; 500 µg/ml in standard external solution) for 1 h at 37°C (Saffer et al. 1996Go). The epithelia were then peeled off and frozen on dry ice. The frozen tissue was disrupted with a pestle, lysed, and homogenized on a QiaShredder column (Qiagen, Valencia CA). The resulting lysate was spun, and the supernatant applied to a silica-gel membrane column (RNAeasy; Qiagen). To eliminate contamination by genomic DNA, we did oncolumn digestion by RNase-free DNase I (Qiagen). The DNase was removed by washing and the RNA was eluted.

Reverse transcription of the eluted RNA to cDNA and subsequent PCR were done with a PTC-100 thermocycler (M-J Research, Incline Village, NV). The RNA was reverse transcribed with random hexamer primers and MMLV reverse transcriptase (Clontech Laboratories, Palo Alto CA). cDNA was amplified with TAQ polymerase (AmpliTaq, Applied Biosystems, Foster City CA) and the following primer pairs directed against the alpha subunits of L-type channels (5'-3'): 1) Cav1.2 ({alpha}1C): forward primer: AAGATGACTCCAACGCCACC; reverse primer: GATGATGACGAAGAGCACGAGG; 2) Cav1.3 ({alpha}1D): forward: TGAGACACAGACGAAGCGAAGC; reverse: GTTGTCACTGTTGGCTATCTGG; 3) Cav1.4 ({alpha}1F): forward: GGAGGAGGTCACTGTGGGAA; reverse: GTTGGGATCCAGCCTGTAGC.

As a positive control, we tested for calmodulin expression with the following primers: forward: CTGAAGAGCAGATYGCAGAATTCA; reverse: TCACTTTGCTGTCATCATTTGTAC.

The primer pairs were directed against a region in the first repeat domain for CaV1.2 (Snutch et al. 1991Go), against part of the second repeat domain for CaV1.3 (Hui et al. 1991Go), and against the C-terminus for CaV1.4 (Morgans et al. 2001Go). We used the following PCR program: hot start at 94°C for 4 min; cycle 40 times between 94°C for 30 s, 59°C for 30 s, 72°C for 35 s; final extension at 72°C for 7 min. Primer pairs for CaV1.2 and CaV1.3 were designed by García-Palomero et al. (2000Go).

For each tissue and primer pair, we ran two kinds of negative control. In the negative control for contamination, water replaced the template made from the inner ear organs. In the negative control for genomic DNA ("–RT" control), reverse transcriptase was omitted to prevent transcription of cDNA from mRNA. For positive controls for the primers, we used the same primer pairs on cDNA made from rat brain poly-A RNA (Clontech) for CaV1.3 and 1.4 and from rat heart poly-A RNA (Clontech) for CaV1.2. For positive controls for the quality of the inner ear tissues, we used the calmodulin primers on each batch of cDNA and also ran all three CaV1.x primer sets on the same batch of cDNA. PCR products were resolved on a 1.2% agarose gel and visualized with ethidium bromide. PCR product identity was confirmed by restriction digest and direct sequencing (SeqWright, Houston TX).


 RESULTS
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Ca2+ channel current is present in cells with and without gK,L

Hair cells were classified according to whether they had gK,L, an outwardly rectifying K+ conductance that activates at unusually negative potentials. This conductance is strongly correlated with the distinctive amphora shape of type I hair cells in various vestibular organs (Eatock et al. 1998Go; Ricci et al. 1996Go). In a previous study of hair cells enzymatically dissociated from rat cristas (Chen and Eatock 2000Go), 86% (31/36) of cells that looked like type I cells had gK,L, compared with 11% (4 /29) of cells that looked like type II cells and 48% (11/23) of cells that could not be classified morphologically. The data in the present study are from 15 cells with gK,L and 19 cells without gK,L. We have pooled data according to whether the cells had gK,L, rather than by hair cell shape, because 1) gK,L expression is less sensitive to dissociation procedures than is hair cell shape and 2) gK,L is the relevant attribute, as we are interested in the activation ranges of Ca2+ channel currents in cells with gK,L (see INTRODUCTION).

We began each recording with our standard internal solution, which contained Cs+ instead of K+, and standard external solution, which lacked channel blockers (Table 1). To determine whether gK,L was present, we used the voltage protocol shown in Fig. 1, A and B. gK,L was recognized by its substantial permeability to Cs+, slow activation kinetics, and, in many cells, its relatively negative activation range. Cs+ is poorly permeant in many K+ channels, but for gK,L, the Cs+ permeability was calculated from reversal potential measurements to be about one-third that of K+ (Rüsch and Eatock 1996aGo). gK,L is also unusual in that in many cases (10/15 in this data set) it is significantly activated at the holding potential of –69 mV. In such cells, there was a significant inward current at –69 mV, reflecting K+ influx through gK,L. As voltage was stepped to –129 mV, the current transiently increased because of the increased driving force, then decayed to zero as gK,L deactivated (Fig. 1A). Subsequent voltage steps to between –89 and –9 mV re-activated gK,L. At the most negative voltages, the inward K+ currents activated slowly (see trace at –79 mV), consistent with the activation kinetics of gK,L in this voltage range (Rüsch and Eatock 1996aGo). Positive to –49 mV, the current became outward and was presumably carried by Cs+.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 1. Isolation of Ca2+ channel currents in a cell with gK,L (A and C) and a cell without gK,L (B and D). Refer to Table 1 for details of the solutions. In all figures, currents have been recorded in perforated patch mode with standard internal solution. A: in the standard external solution used at the onset of recording, an inward holding current through gK,L at –69 mV was deactivated by a prepulse to –129 mV (thick arrow). Steps positive to –99 mV activated current through gK,L (thin arrow), with a reversal potential of approximately –45 mV. Inward current was carried by K+ and outward current by Cs+. Not averaged. B: in the same solutions, the same voltage protocol elicited very small currrents in cells without gK,L. In such cells, outwardly rectifying K+ channels activate positive to –60 mV, but outward current is blocked by the internal Cs+. Average of 2 traces. C and D: the cells in A and B, respectively, were perfused with an external medium containing 5 mM Ca2+, the Na+ channel blocker TTX (1 µM), and the K+ channel blockers TEA (130 mM), 4-aminopyridine (4-AP, 5 mM), and Cs+ (5 mM). Steps to –28 mV from the holding potential of –73 mV evoked fast-activating, noninactivating inward Ca2+ current. Averages of 3 traces each. Leak current was subtracted during recording with a (P,–P/4) protocol (see METHODS).

 

In 5 of 15 cells with substantial Cs+ outward currents, there was relatively little current activated at –69 mV. Four of the five cells were from relatively young animals (3 from P5 animals, 1 from P9, and the 5th from P18). Data from rodent utricles show that the very negative activation range is acquired during or after the first postnatal week: after P2 in semi-intact mouse utricles (Rüsch et al. 1998Go) and after P7 in isolated rat utricular hair cells (K. M. Hurley and R. A. Eatock, unpublished observations). We therefore think that this is more likely to be an immature, more positively activating version of gK,L than a completely different Cs+-permeant conductance. Ca2+ channel currents from these 5 cells were inspected for differences from the 10 cells with negatively activating gK,L; none were found and these cells are therefore included in the category "cells with gK,L."

In cells without gK,L (Fig. 1B), little current flowed during the depolarizing voltage steps, showing that the influx of K+ was largely blocked by the intracellular Cs+ ions. The small currents that did flow had fast kinetics, unlike gK,L. The step from –69 to –129 mV evoked little inward current as few channels were open at –69 mV, and no change in the steady current level, indicating that no major conductance was deactivated by the step.

To study current through Ca2+ channels, we applied external solutions containing 1.3 or 5 mM Ca2+ or 5 mM Ba2+, 0 K+, and the following K+ channel blockers: 130 mM TEA-Cl and 5 mM 4-AP to block outward rectifiers and 5 mM CsCl to block inward rectifiers (Table 1). TTX was also present at 1 µM to block a voltage-sensitive Na+ current that was present in every cell studied. In these solutions, depolarizing steps from –73 mV evoked linear leak currents (subtracted out by the "P/–P/4" routine) and small, voltage-dependent, fast-activating, sustained inward currents in cells with gK,L (Fig. 1C) and in cells without gK,L (Fig. 1D). Several observations showed that the inward current flowed through Ca2+ channels. First, it could be carried by Ba2+ (e.g., Figs. 2C and 3). Second, removal of extracellular Ca2+ eliminated the current (Fig. 2, A and B). Note that in our 0-Ca2+ external solution, Ca2+ was present at trace levels (~10 µM) because we did not add a Ca2+ chelating agent; at lower Ca2+ levels, Ca2+ channels become nonselective (Almers and McCleskey 1984Go; Art and Fettiplace 1987Go). Third, 25 µM Cd2+ blocked peak current by 82 ± 5% (n = 4 cells; 5 Ba2+ solution; Fig. 2, C and D), consistent with reported IC50 values for Cd2+ block of L-type and N-type channels (range: 10–300 µM across preparations) (reviewed in Brammar 1999Go).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 2. The inward currents are through Ca2+ channels, as shown by removing external Ca2+ (A and B) and adding the Ca2+ channel blocker, Cd2+(C and D). A: current responses to voltage steps from –73 to –18 mV in 5 Ca2+ solution and 0 Ca2+ solution; averages of 3 and 2 traces, respectively. Morphological type II, without gK,L, at P9. B: in this and Figs. 3 and 5, isochronal I-V relations were taken near the end of the test pulses, at 9 ms. Data were from current traces in A plus traces not shown, plus data showing recovery in a wash solution. The outward current at positive potentials in 0 Ca2+ is presumably carried by Cs+ ions through Ca2+ channels. In support of this interpretation, the outward current is blocked by external Cd2+ (see D). C: inward currents recorded from a type II cell in 5 Ba2+ external solution (control), with 25 µM CdCl2 added to the 5 Ba2+ solution, and back in 5 Ba2+ (wash). Averages of 4, 2, and 3 traces, respectively. Morphological type II, without gK,L, P15. D: isochronal I-V relations from the traces in C and traces not shown.

 


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3. A dihydropyridine-sensitive component in the Ca2+ channel current. (A and B) Bay K 8644 enhanced and slowed the Ca2+ channel current. Cell with gK,L, type I morphology, P11. A: peak currents evoked in 5 Ba2+ solution (2 traces averaged) and in 5 Ba2+ solution plus 40 µM Bay K 8644 (not averaged). Steps were from the holding potential, –73 to –18 mV (5 Ba2+) and to –33 mV (in Bay K 8644); a negative shift in the voltage eliciting the peak current is expected with Bay K 8644. B: isochronal I-V relations for the traces in A and others not shown. C and D: nimodipine blocked the current weakly. Cell without gK,L, type II morphology, P10. C: current evoked by a step from –73 to –13 mV in 5 Ba2+ solution and in 5 Ba2+ solution plus 40 µM nimodipine; each record is the average of 3 traces. Time scale applies to A and C. D: isochronal I-V relations for the data in C plus other traces.

 



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 5. Voltage dependence of Ca2+ currents. A: comparison of mean I-V relations in cells with and without gK,L; 5 Ca2+ external solution. Averages of isochronal I-V relations for 10 cells of each type, taken at 9 ms. Points between –83 mV and the peak current were fitted with a Boltzmann function (Eq. 1, —). Cells with gK,L: Imax = –58.5 ± 0.4 pA; Imin = –0.4 ± 0.5 pA; V1/2 = –41.1 ± 0.5 mV; S = 6.8 ± 0.4 mV. Cells without gK,L: Imax = –77.3 ± 0.6 pA; Imin = –0.7 ± 0.3 pA; V1/2 = –37.2 ± 0. 2 mV; S = 6.6 ± 0.2 mV. B: isochronal I-V relation in physiological Ca2+ (1.3 mM). Morphological type I cell with gK,L, P11. Fitted between –83 and –23 mV with Eq. 1 (—): Imax = –59.4 pA, Imin = –0.4 pA, V1/2 = –44.1 mV, S = 5.8 mV. Average of 7 current families. Inset: current evoked by voltage step from –73 to –38 mV.

 

It has been suggested that guinea pig vestibular hair cells have T-type Ca2+ currents, based on the presence of a Cd2+-sensitive transient inward current (Rennie and Ashmore 1991Go) andaNi2+-sensitive depolarization-evoked Ca2+ influx (Boyer et al. 1998Go). Ni2+ sensitivity has been considered a hallmark of T-type channels (Fox et al. 1987Go), although more recent studies suggest that this may not be generally true (Zamponi et al. 1996Go). We found no evidence for T-type Ca2+ currents in rat crista cells. When TTX was not present and a hyperpolarizing prepulse was used, depolarizing steps evoked inward currents with a rapidly inactivating component (data not shown). This component was entirely through voltage-gated Na+ channels, however, as it was eliminated in TTX or when external Na+ was replaced by choline+.

Ca2+channel current has a dihydropyridine-sensitive component

PHARMACOLOGY. To test for an L-type component in the Ca2+ channel current, we added the DHP agonist, Bay K 8644, or the DHP antagonist, nimodipine, to the external solution. Bay K 8644 favors long channel openings (Hess et al. 1984; Nowycky et al. 1985) and therefore enhances and slows the current (Fig. 3, A and B). In four cells (2 of each type), the maximum current (Imax; Eq. 1) in 40 µM Bay K 8644 was 214 ± 17% of that in control. Nimodipine reduced the current but only weakly even at high doses (Fig. 3, C and D). Imax was blocked 34.1 ± 8.6% by 40 µM nimodipine [range: 20–59%, n = 4 (2 cells of each type), P5–P12]. This relatively small block raises the possibility that the Ca2+ channel current includes a non-L-type component, but for reasons discussed later (Subunit composition) is not strong evidence for it.

RT-PCR. The {alpha} subunit of Ca2+ channels forms the pore and in L-type channels includes the DHP binding site. L-type {alpha} subunits that are expressed in the brain are CaV1.2 ({alpha}1C) and CaV1.3 ({alpha}1D); CaV1.4 ({alpha}1F) is expressed in retina. In chick and mouse cochlear hair cells, the CaV1.3 ({alpha}1D) subunit predominates (Kollmar et al. 1997Go; Platzer et al. 2000Go). We reverse transcribed mRNA from vestibular ganglia and from the epithelia of cristas and utricles of P13 rats. The epithelia were peeled from the underlying stroma after treatment with thermolysin (see METHODS) and presumably include hair cells, support cells, and nerve terminals. The cDNA was probed with primers for CaV1.2 and CaV1.3 (Fig. 4), as well as CaV1.4 (data not shown) and, as a positive control, calmodulin. All tissues were positive for calmodulin.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 4. Expression of mRNA for the CaV1.3 ({alpha}1D) subunit in epithelia isolated from rat vestibular organs and for the CaV1.2 ({alpha}1C) subunit in vestibular ganglia. All tissues were taken on P13. PCR products of the correct size (383 bp) were obtained with primers for the CaV1.3 subunit in utricular maculas (U+), cristas (C+) and brain (B+) but not in vestibular ganglia (G+). PCR products of the correct size (411 bp) were obtained with primers for the CaV1.2 ({alpha}1C) subunit in vestibular ganglia and brain but not in utricular maculas and cristas. For each reaction (either + or – reverse transcriptase, RT), we used 1 ganglion, 2 utricular maculas, and 4 cristas. All PCR products were confirmed by sequencing. Lanes from left to right: L, ladder (in 100-bp steps; arrows point to 400 bp); W, water control (water substituted for cDNA in PCR reactions); C–, cristas (–RT control, no reverse transcriptase added to reverse transcription steps); C+, cristas (+RT); U– utricular maculas (–RT control); U+, utricular maculas (+RT); G–, vestibular ganglia (–RT control); G+, vestibular ganglia (+RT); B+, brain (B, +RT, adult rat); and L, ladder.

 

In the vestibular epithelia, products of the appropriate size and sequence were obtained for CaV1.3 but not for CaV1.2 or CaV1.4; the primer sets were tested on the same batch of cDNA. For both the utricle and the cristas, the sequenced product (285 nucleotides, excluding the first 20) was 100% identical to the published sequence for CaV1.3 from rat brain (Hui et al. 1991Go). It is possible that the PCR product includes a contribution from the supporting cells (Mori et al. 1998Go) or nerve terminals. Nevertheless, given the evidence for an L-type current of low DHP sensitivity in the hair cells and the lack of PCR products for CaV1.2 and CaV1.4 in the epithelium, we conclude that the hair cell Ca2+ current is at least partly carried by CaV1.3 subunits.

In the vestibular ganglia, a PCR product was only obtained with CaV1.2 ({alpha}1C) primers. This argues that CaV1.3 expression found in the epithelia does not originate in the nerve terminals. The product obtained with CaV1.2 primers was identical to the published sequence for CaV1.2 from rat brain (Snutch et al. 1991Go). PCR products corresponding to CaV1.2 were previously obtained after reverse transcription of total RNA from the mouse cochlea (Green et al. 1996Go). DHP-sensitive voltagegated Ca2+ currents have been recorded in dissociated mouse vestibular neurons (Chambard et al. 1999Go).

A PCR product of the correct size (442 bp) and sequence was obtained with primers for the CaV1.4 ({alpha}1F) subunit in brain but not in vestibular organs or ganglia (data not shown). This subunit is predominantly expressed in retina (Bech-Hansen et al. 1998Go; Naylor et al. 2000Go).

In summary, our pharmacological and RT-PCR data indicate that mammalian vestibular hair cells express an L-type Ca2+ current carried by CaV1.3 subunits. It is possible that there are additional contributions from other Ca2+ channel types (see Subunit composition).

Current-voltage relations

Figure 5A compares the mean isochronal I-V relations for cells with and without gK,L in 5 mM external Ca2+. The current of the mean relations peaked at approximately –60 pA for cells with gK,L (range: –45 to –85 pA in individual cells) and approximately –80 pA for cells without gK,L (range: –45 to –125 pA). Boltzmann fits to the mean curves yielded V1/2 values that were on average slightly but significantly more negative in cells with gK,L (–41.1 ± 0.5 mV) than in cells without gK,L (–37.2 ± 0.2 mV) and S values that were similar (6.8 ± 0.4 vs. 6.6 ± 0.2 mV). The differences in peak currents and activation ranges have complementary effects between –70 and –40 mV, with the result that the two cell types have similar mean currents over much of the physiological range of voltages.

Figure 5B shows the I-V relation for a cell with gK,L in 1.3 mM Ca2+. The mean current in 1.3 mM Ca2+ for eight cells with gK,L (not shown) was 1% of its peak value at –72 mV, half-maximal at –46 mV, and 90% of its peak value at –34 mV. Similar results were obtained in mouse cochlear inner hair cells in 1.3 mM Ca2+ (Platzer et al. 2000Go).

Time course

Activation kinetics were fitted with a Hodgkin-Huxley scheme (Eq. 2). A similar scheme has been used to fit Ca2+ channel activation in other hair cells, with the exponent, {alpha}, set to 2 (Art and Fettiplace 1987Go; Perin et al. 2001Go; Zidanic and Fuchs 1995Go) and 3 (Lewis and Hudspeth 1983Go). For our cells, {alpha} assumed values between 2 and 4 when it was allowed to vary. To compare activation time constants ({tau}) across cells, we set {alpha} at 3. Examples of fits are shown in Fig. 6A. Figure 6B shows the voltage dependence of mean {tau} values averaged from four type I and five type II cells, all in 5 Ca2+ medium. Values ranged from 400 µs at –13 mV to 730 µs at –48 mV. On average, the time constants were ~100 µs slower for the type I cells. Even the values from type II cells (100–500 µs across the voltage range) are somewhat slower than those reported from other hair cells (Art and Fettiplace 1987Go; Hudspeth and Lewis 1988aGo; Perin et al. 2001Go; Zidanic and Fuchs 1995Go).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 6. Ca2+ channel activation and inactivation kinetics. A and B: activation was slightly faster in cells without gK,L; 5 Ca2+ external solution. A: currents evoked by steps from –73 to –28 mV, in a cell without gK,L (top) and a cell with gK,L (bottom). Averages of 3 curves each. The smooth curves are fits of Eq. 2 with {alpha} = 3. Fit values for ISS and {tau}: Cell without gK,L: 59.9 pA, 546 µs; Cell with gK,L: 54.4 pA, 663 µs. B: mean {tau} values from fits for cells with and without gK,L in 5 Ca2+ external solution. Five values averaged at each voltage for cells without gK,L; 2–4 were averaged for cells with gK,L. Smooth curves show fits of an exponential decay function, y = y0 + Ae-V/X, weighted by the standard errors. For the cells without gK,L, y0 = 76 µs, A = 254 µs, X = 58 mV. For the cells with gK,L, y0 = 220 µs, A = 206 µs, X = 45 mV. C: slow inactivation during large depolarizations. Currents at the holding potential of –73 mV and during 600-ms steps to –3 and –43 mV in 5 Ca2+ and 5 Ba2+ external solutions. In 5 Ca2+, slow inactivation occurred at –3 mV but not at –43 mV. Inactivation was eliminated in external Ba2+, suggesting that it was Ca2+ dependent. The current decay at –3 mV in 5 Ca2+ was fitted with a monoexponential function (gray line, Eq. 3). Fit values: ISS = –35.2 pA, A = –39.3 pA, {tau} = 355 ms. Cell without gK,L, P9. Traces not averaged, filtered at 200 Hz.

 

INACTIVATION. In 5 mM external Ca2+, no inactivation was seen during small depolarizations lasting hundreds of milliseconds (Fig. 6C, top). For large depolarizations, however, inward currents decayed with time constants of several hundred milliseconds. The example in Fig. 6C decayed during a step to –3 mV with a time constant of ~350 ms to a steady-state value ~50% of its peak value. Similar results were obtained in five other cells without gK,L. Inward currents during long depolarizing steps also decayed in cells with gK,L. In the latter, however, slow kinetic components in the tail currents at the offset of long steps suggest that the Ca2+ current recorded during long steps was contaminated by currents flowing through imperfectly blocked, slowly activating channels. Such currents did not contaminate the responses to our usual 10-ms protocols.

Currents through heterologously expressed human CaV1.3 channels show inactivation with Ca2+-dependent and -independent components (Bell et al. 2001Go). In the rat crista cells, Ba2+ currents did not decay (Fig. 6C, bottom), consistent with Ca2+-dependent inactivation being responsible for the decay in 5 Ca2+.


 DISCUSSION
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Transmission at the type I-calyx synapse

In vitro measurements of resting potential from type I hair cells are generally negative to –70 mV because of the large K+ conductance at negative potentials; in the rat crista, ruptured-patch recordings with standard solutions yielded a mean resting potential of –81.3 ± 0.2 mV (n = 144) (Chen and Eatock 2000Go). At –70 mV and in physiological Ca2+, Ca2+ current is ~1% maximal (Fig. 5B). One would predict on this basis that there would be little background release of quanta. Furthermore, the observation that Ca2+ current is not appreciable negative to –60 mV (Fig. 5B) together with other information from in vitro studies argues that there would be little stimulated quantal release, as follows. For a cell with a large gK,L, the input resistance is frequently as low as 20 M{Omega}. The largest transduction currents that have been recorded from rodent vestibular hair cells are ~400 pA (M. A. Vollrath and R. A. Eatock, unpublished results). Such a current would depolarize such a cell by just 8 mV, barely into the voltage range at which significant Ca2+ current flows. In vivo, however, rodent calyx afferents do have both background and evoked discharges (Baird et al. 1988Go; Goldberg et al. 1990Go). The background rates and gains (evoked rates per unit stimulus) can be lower than for other afferents but are nevertheless substantial. Although other transmission mechanisms may operate at this synapse, the presence of the presynaptic machinery makes it likely that chemical transmission operates at least some of the time. In that case, type I cells must have, at least some of the time, more positive resting potentials, larger input resistances, or both. The responsible mechanisms may include down-modulation of gK,L, which would have both effects (Behrend et al. 1997Go; Chen and Eatock 2000Go), and accumulation of K+ in the synaptic cleft, which would depolarize the hair cells (Chen 1995Go; Goldberg 1996Go).

Comparison with Ca2+channel currents in other hair cells

BIOPHYSICAL PROPERTIES. We were interested in the possibility that the Ca2+ channels of type I cells have distinctive properties that explain how they control transmitter release in these low-resistance, negatively resting hair cells. But the differences that we saw were modest: type I Ca2+ channel currents were slightly slower and smaller and activated at slightly more negative potentials relative to type II Ca2+ channel currents. More striking are the similarities between the currents of both hair cell types and those described for hair cells from other inner ear organs. All are fast to activate and deactivate, show little inactivation for small depolarizations, and activate at fairly similar voltages.

The aspect in which we were most interested, the voltage dependence of type I Ca2+ currents, is a few millivolts more negative than that of type II Ca2+ currents (Fig. 5A). The source of this modest difference and the small difference in activation kinetics is not clear. If there are multiple Ca2+ channel types—reflecting differences in {alpha} or {beta} subunits or posttranslational modifications—the differences in biophysical properties between the two cell types might reflect a difference in the proportions of channel types. The slightly more negative activation range in cells with gK,L is in the right direction to function with the more negative resting potentials encountered in these cells. On the other hand, because the average peak current was smaller in cells with gK,L, the average current levels in the voltage range of the greatest physiological significance, between –70 and –40 mV, were indistinguishable (Fig. 5A).

The voltage ranges of activation for both cell types span the range reported in other hair cells in comparable concentrations of charge carrier. In 2.8 mM Ca2+, Ca2+ currents in isolated turtle cochlear cells were half-maximal at approximately –40 mV (Art et al. 1993Go). In 4–5 mM external Ca2+, Ca2+ currents in hair cells from the frog amphibian papilla (an auditory organ) and frog crista were half-maximal at –40 to –45 mV (Martini et al. 2000Go; Perin et al. 2001Go; Smotherman and Narins 1999Go). In 1.8 mM Ca2+, Ca2+ current is half-maximal at –38 mV in enzymatically dissociated cells from the frog saccule (Armstrong and Roberts 1998Go). In the latter study, the papain dissociation shifted the activation range by +7 mV. Our dissociation procedure includes a lengthy exposure to papain and a –5- to –10-mV shift would go a long way to aligning the Ca2+ channel activation range with type I membrane potentials at background levels of stimulation: the current might be 1% of maximal at –80 mV (rather than –72 mV, Fig. 5B) and 10% of maximal at –65 mV. Any papain effect would act on both cell types, however, so that there still would not be a major difference in their Ca2+ channel activation ranges.

The activation kinetics of the Ca2+ currents in rat crista hair cells were slightly slower than reported in other hair cells. Assuming a thermal Q10 of 2–3, correction for mammalian body temperature brings the time constants into line with time constants measured at room temperature in poikilotherms: turtle cochlea (Art and Fettiplace 1987Go), frog saccule (Hudspeth and Lewis 1988aGo), and frog crista (Perin et al. 2001Go), but they are still slower than those in chick cochlea (Zidanic and Fuchs 1995Go) after correction for chick body temperature. The kinetics of rat crista channels may have been slowed by the papain dissociation (Armstrong and Roberts 1998Go). Alternatively, cochlear Ca2+ channels may really have faster kinetics to reduce low-pass filtering of the afferent signal at acoustic frequencies. A single exponential fit of activation in the rat crista cells at –28 mV yields time constants at room temperature of ~1 ms, for a half-power low-pass frequency of 160 Hz—in the acoustic frequency range and well above the frequencies of head movements. We therefore know of no functional significance for the small difference between the activation time constants of type I and type II hair cells. Inactivation was modest in overall extent and quite slow; even for large depolarizations, the time constant at room temperature was several hundred milliseconds, corresponding to a high-pass corner frequency of ~0.4 Hz, and there was a substantial steady-state component.

Maximal Ca2+ current amplitudes and estimated conductances in hair cells vary over an order of magnitude, from ~50 pA to 1 nA. In the frog saccule, voltage-gated Ca2+ channels are localized at presynaptic active zones (Issa and Hudspeth 1994Go; Roberts et al. 1990Go; Rodriguez-Contreras and Yamoah 2001Go). In chick cochlear hair cells, Martinez-Dunst et al. (1997Go) found that Ca2+ channel number varies with "presynaptic release area" [(the area of hair cell membrane adjacent to each presynaptic dense body) x (the number of dense bodies)] and showed that data from the turtle cochlea and frog saccule lie along the same continuum. This relationship accounts for the increase in Ca2+ current amplitude with best frequency in the chick cochlea and possibly in the auditory organs of other nonmammals (Art et al. 1993Go; Smotherman and Narins 1999Go). In a vestibular organ, the frog crista, Ca2+ channel current amplitude and presynaptic release area may also co-vary. Perin et al. (2001Go) found that Ba2+ current amplitude varies considerably with region of origin, and noted that the larger Ba2+ currents occur in cells with larger synaptic bodies (Lysakowski 1996Go).

The presynaptic release areas, numbers of such areas per hair cell, and current amplitudes of rodent crista hair cells appear to be comparable to those of chick tall hair cells. Inspection of Figs. 15 and 16 in Lysakowski and Goldberg (1997Go) suggests that presynaptic release areas are similar to those in chick cells (Martinez-Dunst et al. 1997Go). There are 17–18 dense bodies in mature rodent crista hair cells (Lysakowski and Goldberg 1997Go) and ~15 in chick tall hair cells (Martinez-Dunst et al. 1997Go). Peak Ca2+ channel currents are also consistent with each other given that they were recorded in different concentrations of Ba2+. For rat crista type II hair cells, currents doubled when we increased the Ca2+ or Ba2+ concentration fourfold, from 1.3 to 5 mM (data not shown). Thus the ~80-pA currents that we got in 5 mM Ba2+ are comparable to the 100- to 300-pA currents recorded at fourfold higher Ba2+ concentration in chick hair cells (Martinez-Dunst et al. 1997Go; Zidanic and Fuchs 1995Go). Presynaptic release areas can be larger in type II hair cells than in type I hair cells (Lysakowski and Goldberg 1997Go), which might contribute to the difference in peak current size between type I and type II cells (Fig. 5).

Another possible factor in the relative sizes of Ca2+ currents in hair cells from different inner ear organs is whether the currents are used to drive the activation of Ca2+-gated K+ channels in addition to synaptic transmission. Those hair cells with the largest Ca2+ currents also have sizeable Ca2+-gated K+ currents, and both channel types participate in electrical tuning (Art and Fettiplace 1987Go; Hudspeth and Lewis 1988aGo,bGo; Lewis and Hudspeth 1983Go). In rodent vestibular hair cells, in contrast, K(Ca) conductances are not the dominant outward rectifiers and electrical tuning is broad (Rennie and Correia 1994Go; Rennie et al. 1996Go; Rüsch and Eatock 1996aGo,bGo).

SUBUNIT COMPOSITION. Our pharmacological and RT-PCR data suggest that rat crista hair cells express L-type channels made up of CaV1.3 ({alpha}1D) {alpha}-subunits as do other hair cells (Green et al. 1996Go; Kollmar et al. 1997Go; Platzer et al. 2000Go).

Are there other components to the whole cell Ca2+ current? The evidence so far is equivocal. By itself, modest block by high doses of nimodipine does not constitute strong evidence for non-L-type components. DHP block is strongly enhanced by depolarization (Bean 1984Go; Koschak et al. 2001); thus the efficacy of the blocker in our experiments was reduced by holding at relatively negative potentials and using short depolarizations. Heterologously expressed CaV1.3 subunits form channels that are less sensitive to DHP block at any voltage than are those channels formed by other L-type subunits (Koschak et al. 2001; Xu and Lipscombe 2001Go). The DHP-sensitive component of the mouse inner hair cell current is even less sensitive to DHP block than are heterologous CaV1.3 channels (Koschak et al. 2001). For a voltage protocol similar to ours, the Ca2+ channel currents of mouse inner hair cells are blocked ~40% by 10 µM nimodipine (Platzer et al. 2001), similar to the effect that we observed at 40 µM nimodipine. The DHP sensitivities of heterologously expressed CaV1.2 and CaV1.3 channels and hair cell Ca2+ channels follow the same progression as the amounts by which the channels inactivate (CaV1.2 > CaV1.3 > hair cell Ca2+ channels), consistent with the proposal that DHP blockers preferentially bind inactivated channels (Bean 1984Go).

Nevertheless, a number of observations make it likely that there is a non-L-type component. First, there is evidence from CaV1.3 null mutants. The inner hair cells in the CaV1.3-null mice have a small residual current (<10% of wild-type) (Platzer et al. 2000Go). This small current may not sustain synaptic transmission; the animals are deaf. They lack obvious vestibular deficits, however, suggesting that non-CaV1.3 components may be more important in vestibular hair cells (Platzer et al. 2000Go). Second, an R-type current component has been proposed in frog crista cells, based on its resistance to L- and N-type blockers (Martini et al. 2000Go). Third, there is evidence for N-type subunits in hair cells. An antibody to N-type subunits (CaV2.2, {alpha}1B) labeled the basolateral membranes of type I and type II hair cells in the chinchilla crista (Lopez et al. 1999Go). In frog saccular hair cells, single-channel recordings reveal both L-type channels and a second type with some N-type properties (Rodriguez-Contreras and Yamoah 2001Go; Su et al. 1995Go), and antibody to N-type channels labels discrete spots on the basolateral membrane (Rodriguez-Contreras and Yamoah 2001Go). Further experiments with different pharmacological agents and/or single-channel recordings are required to determine whether there are multiple voltage-gated Ca2+ channels in mammalian vestibular hair cells.


 ACKNOWLEDGMENTS
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
We thank Drs. Julian Wooltorton and Melissa Vollrath for comments on the manuscript and D. Himes for technical help.

This work was supported by National Institute on Deafness and Other Communication Disorders Grant DC-02058.

Present address of H. Bao: Section of Neurobiology, University of Texas, Austin, TX 78712.


 FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Address for reprint requests: R. A. Eatock, Dept. of Otolaryngology, Rm. NA-511, Baylor College of Medicine, One Baylor Plaza, Houston TX 77030 (E-mail: eatock{at}bcm.tmc.edu).


 REFERENCES
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Almers W and McCleskey EW. Non-selective conductance in calcium channels of frog muscle: calcium selectivity in a single-file pore. J Physiol 353: 585–608, 1984.[Abstract/Free Full Text]

Armstrong CE and Roberts WM. Electrical properties of frog saccular hair cells: distortion by enzymatic dissociation. J Neurosci 18: 2962–2973, 1998.[Abstract/Free Full Text]

Armstrong CM and Bezanilla F. Charge movement associated with the opening and closing of the activation gates of the Na channels. J Gen Physiol 63: 533–552, 1974.[Abstract/Free Full Text]

Art JJ and Fettiplace R. Variation of membrane properties in hair cells isolated from the turtle cochlea. J Physiol 385: 207–242, 1987.[Abstract/Free Full Text]

Art JJ, Fettiplace R, and Wu YC. The effects of low calcium on the voltage-dependent conductances involved in tuning of turtle hair cells. J Physiol 470: 109–126, 1993.[Abstract/Free Full Text]

Baird RA, Desmadryl G, Fernández C, and Goldberg JM. The vestibular nerve of the chinchilla. II. Relation between afferent response properties and peripheral innervation patterns in the semicircular canals. J Neurophysiol 60: 182–203, 1988.[Abstract/Free Full Text]

Barry PH. JPCalc, a software package for calculating liquid junction potential corrections in patch-clamp, intracellular, epithelial and bilayer measurements and for correcting junction potential measurements. J Neurosci Methods 51: 107–116, 1994.[Web of Science][Medline]

Bean BP. Nitrendipine block of cardiac calcium channels: high-affinity binding to the inactivated state. Proc Natl Acad Sci USA 81: 6388–6392, 1984.[Abstract/Free Full Text]

Bean BP and Mintz IM. Pharmacology of different types of calcium channels in rat neurons. In: Handbook of Membrane Channels: Molecular and Cellular Physiology, edited by Peraccio C. San Diego: Academic, 1994, p. 199–210.

Bech-Hansen NT, Naylor MJ, Maybaum TA, Pearce WG, Koop B, Fishman GA, Mets M, Musarella MA, and Boycott KM. Loss-of-function mutations in a calcium-channel alpha1-subunit gene in Xp11.23 cause incomplete X-linked congenital stationary night blindness. Nat Genet 19: 264–267, 1998.[Web of Science][Medline]

Behrend O, Schwark C, Kunihiro T, and Strupp M. Cyclic GMP inhibits and shifts the activation curve of the delayed-rectifier (IK1) of type I mammalian vestibular hair cells. Neuroreport 8: 2687–2690, 1997.[Web of Science][Medline]

Bell DC, Butcher AJ, Berrow NS, Page KM, Brust PF, Nesterova A, Stauderman KA, Seabrook GR, Nurnberg B, and Dolphin AC. Biophysical properties, pharmacology, and modulation of human, neuronal L-type (alpha(1D), Ca(V)1.3) voltage-dependent calcium currents. J Neurophysiol 85: 816–827, 2001.[Abstract/Free Full Text]

Boyer C, Lehouelleur J, and Sans A. Potassium depolarization of mammalian vestibular sensory cells increases [Ca2+]i through voltage-sensitive calcium channels. Eur J Neurosci 10: 971–975, 1998.[Web of Science][Medline]

Brammar WJ. Voltage-gated calcium channels. In: The Ion Channel Facts Book. IV. Voltage-Gated Channels, edited by Conley EC and Brammar WJ. London, UK: Academic, 1999, p. 22–153.

Brichta AM, Aubert A, Eatock RA, and Goldberg JM. Regional analysis of whole cell currents from hair cells of the turtle posterior crista. J Neurophysiol 88: 3259–3278, 2002.[Abstract/Free Full Text]

Catterall WA. Interactions of presynaptic Ca2+ channels and snare proteins in neurotransmitter release. Ann NY Acad Sci 868: 144–159, 1999.[Web of Science][Medline]

Chambard JM, Chabbert C, Sans A, and Desmadryl G. Developmental changes in low and high voltage-activated calcium currents in acutely isolated mouse vestibular neurons. J Physiol 518: 141–149, 1999.[Abstract/Free Full Text]

Chen JWY. The Properties and Functions of a Low-Voltage-Activated K+ Current in Type I Hair Cells of Rat Semicircular Canal Organs (PhD thesis). Rochester, NY: University of Rochester, 1995.

Chen JWY and Eatock RA. Major potassium conductance in type I hair cells from rat semicircular canals: characterization and modulation by nitric oxide. J Neurophysiol 84: 139–151, 2000.[Abstract/Free Full Text]

Correia MJ and Lang DG. An electrophysiological comparison of solitary type I and type II vestibular hair cells. Neurosci Lett 116: 106–111, 1990.[Web of Science][Medline]

Eatock RA, Rüsch A, Lysakowski A, and Saeki M. Hair cells in mammalian utricles. Otolaryngol Head Neck Surg 119: 172–181, 1998.[Web of Science][Medline]

Forscher P and Oxford GS. Modulation of calcium channels by norepinephrine in internally dialyzed avian sensory neurons. J Gen Physiol 85: 743–763, 1985.[Abstract/Free Full Text]

Fox AP, Nowycky MC, and Tsien RW. Kinetic and pharmacological properties distinguishing three types of calcium currents in chick sensory neurones. J Physiol 394: 149–172, 1987.[Abstract/Free Full Text]

Fuchs PA. Synaptic transmission at vertebrate hair cells. Curr Opin Neurobiol 6: 514–519, 1996.[Web of Science][Medline]

García-Palomero E, Cuchillo-Ibanez I, Garcia AG, Renart J, Albillos A, and Montiel C. Greater diversity than previously thought of chromaffin cell Ca2+ channels, derived from mRNA identification studies. FEBS Lett 481: 235–239, 2000.[Web of Science][Medline]

Goldberg JM. A theoretical analysis of intercellular communication between the vestibular type I hair cell and its calyx ending. J Neurophysiol 76: 1942–1957, 1996.[Abstract/Free Full Text]

Goldberg JM, Desmadryl G, Baird RA, and Fernández C. The vestibular nerve of the chinchilla. V. Relation between afferent discharge properties and peripheral innervation patterns in the utricular macula. J Neurophysiol 63: 791–804, 1990.[Abstract/Free Full Text]

Green GE, Khan KM, Beisel KW, Drescher MJ, Hatfield JS, and Drescher DG. Calcium channel subunits in the mouse cochlea. J Neurochem 67: 37–45, 1996.[Web of Science][Medline]

Gulley RL and Bagger-Sjöbäck D. Freeze-fracture studies on the synapse between the type I hair cell and the calyceal terminal in the guinea pig vestibular system. J Neurocytol 8: 591–603, 1979.[Web of Science][Medline]

Hamilton DW. The calyceal synapse of type I vestibular hair cells. J Ultrastruct Res 23: 98–114, 1968.[Web of Science][Medline]

Hess P, Lansman JB, and Tsien RW. Different modes of calcium channel gating behavior favored by dihydropyridine agonists and antagonists. Nature 311: 538–544.

Hille B. Ionic Channels of Excitable Membranes (3rd ed.). Sunderland, MA: Sinauer, 2001.

Horn R and Marty A. Muscarinic activation of ionic currents measured by a new whole cell recording method. J Gen Physiol 92: 145–159, 1988.[Abstract/Free Full Text]

Hudspeth AJ and Lewis RS. Kinetic analysis of voltage- and ion-dependent conductances in saccular hair cells of the bull-frog, Rana catesbeiana. J Physiol 400: 237–274, 1988a.[Abstract/Free Full Text]

Hudspeth AJ and Lewis RS. A model for electrical resonance and frequency tuning in saccular hair cells of the bull-frog, Rana catesbeiana. J Physiol 400: 275–297, 1988b.[Abstract/Free Full Text]

Hui A, Ellinor PT, Krizanova O, Wang JJ, Diebold RJ, and Schwartz A. Molecular cloning of multiple subtypes of a novel rat brain isoform of the alpha 1 subunit of the voltage-dependent calcium channel. Neuron 7: 35–44, 1991.[Web of Science][Medline]

Ishii Y, Matsuura S, and Furukawa T. Quantal nature of transmission at the synapse between hair cells and eighth nerve fibers. Jpn J Physiol 21: 79–89, 1971.[Web of Science][Medline]

Issa NP and Hudspeth AJ. Clustering of Ca2+ channels and Ca2+-activated K+ channels at fluorescently labeled presynaptic active zones of hair cells. Proc Natl Acad Sci USA 91: 7578–7582, 1994.[Abstract/Free Full Text]

Kollmar R, Montgomery LG, Fak J, Henry LJ, and Hudspeth AJ. Predominance of the {alpha}1D subunit in L-type voltage-gated Ca2+ channels of hair cells in the chicken's cochlea. Proc Natl Acad Sci USA 94: 14883–14888, 1997.[Abstract/Free Full Text]

Koschak A, Reimer D, Huber I, Grabner M, Glossmann H, Engel J, and Striessnig J. {alpha}1D (CaV1.3) subunits can form L-type Ca2+ channels activating at negative voltages. J Biol Chem 276: 22100–22106, 2002.[Abstract/Free Full Text]

Lenzi D, Runyeon JW, Crum J, Ellisman MH, and Roberts WM. Synaptic vesicle populations in saccular hair cells reconstructed by electron tomography. J Neurosci 19: 119–132, 1999.[Abstract/Free Full Text]

Lewis RS and Hudspeth AJ. Voltage- and ion-dependent conductances in solitary vertebrate hair cells. Nature 304: 538–541, 1983.[Medline]

Lopez I, Ishiyama G, Ishiyama A, Jen JC, Liu F, and Baloh RW. Differential subcellular immunolocalization of voltage-gated calcium channel alpha1 subunits in the chinchilla cristae ampullaris. Neuroscience 92: 773–782, 1999.[Web of Science][Medline]

Lysakowski A. Synaptic organization of the crista ampullares in vertebrates. Ann NY Acad Sci 781: 164–182, 1996.[Web of Science][Medline]

Lysakowski A and Goldberg JM. Regional variations in the cellular and synaptic architecture of the chinchilla cristae. J Comp Neurol 389: 419–443, 1997.[Web of Science][Medline]

Martinez-Dunst C, Michaels RL, and Fuchs PA. Release sites and calcium channels in hair cells of the chick's cochlea. J Neurosci 17: 9133–9144, 1997.[Abstract/Free Full Text]

Martini M, Rossi ML, Rubbini G, and Rispoli G. Calcium currents in hair cells isolated from semicircular canals of the frog. Biophys J 78: 1240–1254, 2000.[Web of Science][Medline]

Morgans CW, Gaughwin P, and Maleszka R. Expression of the alpha1F calcium channel subunit by photoreceptors in the rat retina. Mol Vis 7: 202–209, 2001.[Web of Science][Medline]

Mori Y, AmanoT, Sasa M, and Yajin K. Cytochemical and patch-clamp studies of calcium influx through voltage-dependent Ca2+ channels in vestibular supporting cells of guinea pigs. Eur Arch Otorhinolaryngol 255: 235–239, 1998.[Medline]

Moser T and Beutner D. Kinetics of exocytosis and endocytosis at the cochlear inner hair cell afferent synapse of the mouse. Proc Natl Acad Sci USA 97: 883–888, 2000.[Abstract/Free Full Text]

Naylor MJ, Rancourt DE, and Bech-Hansen NT. Isolation and characterization of a calcium channel gene, Cacna1f, the murine orthologue of the gene for incomplete X-linked congenital stationary night blindness. Genomics 66: 324–327, 2000.[Web of Science][Medline]

Nowycky MC, Fox AP, and Tsien RW. Long-opening mode of gating of neuronal calcium channels and its promotion by the dihydropyridine calcium agonist BAY K 8644. Proc Natl Acad Sci USA 82: 2178–2182.

Perin P, Masetto S, Martini M, Rossi ML, Rubbini G, Rispoli G, Guth P, Zucca G, and Valli P. Regional distribution of calcium currents in frog semicircular canal hair cells. Hear Res 152: 67–76, 2001.[Web of Science][Medline]

Platzer J, Engel J, Schrott-Fischer A, Stephan K, Bova S, Chen H, Zheng H, and Striessnig J. Congenital deafness and sinoatrial node dysfunction in mice lacking class D L-type Ca2+ channels. Cell 102: 89–97, 2000.[Web of Science][Medline]

Rennie KJ and Ashmore JF. Ionic currents in isolated vestibular hair cells from the guinea pig crista ampullaris. Hear Res 51: 279–291, 1991.[Web of Science][Medline]

Rennie KJ and Correia MJ. Potassium currents in mammalian and avian isolated type I semicircular canal hair cells. J Neurophysiol 71: 317–329, 1994.[Abstract/Free Full Text]

Rennie KJ, Ricci AJ, and Correia MJ. Electrical filtering in gerbil isolated type I semicircular canal hair cells. J Neurophysiol 75: 2117–2123, 1996.[Abstract/Free Full Text]

Ricci AJ, Rennie KJ, and Correia MJ. The delayed rectifier, IKI, is the major conductance in type I vestibular hair cells across vestibular end organs. Pfluegers 432: 34–42, 1996.

Roberts WM, Jacobs RA, and Hudspeth AJ. Colocalization of ion channels involved in frequency selectivity and synaptic transmission at presynaptic active zones of hair cells. J Neurosci 10: 3664–3684, 1990.[Abstract]

Robertson D and Paki B. Role of L-type Ca2+ channels in transmitter release from mammalian inner hair cells. II. Single-neuron activity. J Neurophysiol 87: 2734–2740, 2002.[Abstract/Free Full Text]

Rodriguez-Contreras A and Yamoah EN. Direct measurement of single-channel Ca2+ currents in bullfrog hair cells reveals two distinct channel subtypes. J Physiol 534: 669–689, 2001.[Abstract/Free Full Text]

Rossi ML, Martini M, Pelucchi B, and Fesce R. Quantal nature of synaptic transmission at the cytoneural junction in the frog labyrinth. J Physiol 478: 17–35, 1994.[Abstract/Free Full Text]

Rüsch A and Eatock RA. A delayed rectifier conductance in type I hair cells of the mouse utricle. J Neurophysiol 76: 995–1004, 1996a.[Abstract/Free Full Text]

Rüsch A and Eatock RA. Voltage responses of mouse utricular hair cells to injected currents. Ann NY Acad Sci 781: 71–84, 1996b.[Web of Science][Medline]

Rüsch A, Lysakowski A, and Eatock RA. Postnatal development of type I and type II hair cells in the mouse utricle: acquisition of voltage-gated conductances and differentiated morphology. J Neurosci 18: 7487–7501, 1998.[Abstract/Free Full Text]

Saffer LD, Gu R, and Corwin JT. A RT-PCR analysis of mRNA for growth factor receptors in damaged and control sensory epithelia of rat utricles. HearRes 94: 14–23, 1996.

Schessel DA, Ginzberg R, and Highstein SM. Morphophysiology of synaptic transmission between type I hair cells and vestibular primary afferents. An intracellular study employing horseradish peroxidase in the lizard, Calotes versicolor. Brain Res 544: 1–16, 1991.[Web of Science][Medline]

Schnee ME and Ricci AJ. Calcium channels in turtle auditory hair cells. Assoc Res Otolaryngol Abstr 25: 158, 2002.

Sewell WF. Neurotransmitters and synaptic transmission. In: The Cochlea, edited by Dallos P, Popper AN, and Fay RR. New York: Springer-Verlag, 1996, p. 503–533.

Smotherman MS and Narins PM. The electrical properties of auditory hair cells in the frog amphibian papilla. J Neurosci 19: 5275–5292, 1999.[Abstract/Free Full Text]

Snutch TP, Tomlinson WJ, Leonard JP, and Gilbert MM. Distinct calcium channels are generated by alternative splicing and are differentially expressed in the mammalian CNS. Neuron 7: 45–57, 1991.[Web of Science][Medline]

Spassova M, Eisen MD, Saunders JC, and Parsons TD. Chick cochlear hair cell exocytosis mediated by dihydropyridine-sensitive calcium channels. J Physiol 535: 689–696, 2001.[Abstract/Free Full Text]

Su Z-L, Jiang SC, Gu R, and Yang WP. Two types of calcium channels in bullfrog saccular hair cells. Hear Res 87: 62–68, 1995.[Web of Science][Medline]

Trussell L. Mutant ion channel in cochlear hair cells causes deafness. Proc Natl Acad Sci USA 97: 3786–3788, 2000.[Free Full Text]

Von Gersdorff H and Borst JG. Short-term plasticity at the calyx of Held. Nat Rev Neurosci 1: 53–64, 2002.

Wersäll J and Bagger-Sjöbäck. Morphology of the vestibular sense organ. In: Handbook of Sensory Physiology. Vestibular System, Basic Mechanisms, edited by Kornhuber HH. New York: Springer-Verlag, vol. VI/1, 1974, p. 123–170.

Xu W and Lipscombe D. Neuronal Ca(V)1.3 {alpha}(1) L-type channels activate at relatively hyperpolarized membrane potentials and are incompletely inhibited by dihydropyridines. J Neurosci 21: 5944–5951, 2001.[Abstract/Free Full Text]

Yamashita M and Ohmori H. Synaptic responses to mechanical stimulation in calyceal and bouton type vestibular afferents studied in an isolated preparation of semicircular canal ampullae of chicken. Exp Brain Res 80: 475–488, 1990.[Web of Science][Medline]

Yamashita M and Ohmori H. Synaptic bodies and vesicles in the calix type synapse of chicken semicircular canal ampullae. Neurosci Lett 129: 43–46, 1991.[Web of Science][Medline]

Zamponi GW, Bourinet E, and Snutch TP. Nickel block of a family of neuronal calcium channels: subtype- and subunit-dependent action at multiple sites. J Membr Biol 151: 77–90, 1996.[Web of Science][Medline]

Zidanic M and Fuchs PA. Kinetic analysis of barium currents in chick cochlear hair cells. Biophys J 68: 1323–1336, 1995.[Web of Science][Medline]




This article has been cited by other articles:


Home page
J. Neurosci.Home page
D. Dulon, S. Safieddine, S. M. Jones, and C. Petit
Otoferlin Is Critical for a Highly Sensitive and Linear Calcium-Dependent Exocytosis at Vestibular Hair Cell Ribbon Synapses
J. Neurosci., August 26, 2009; 29(34): 10474 - 10487.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Martini, R. Canella, A. Leparulo, I. Prigioni, R. Fesce, and M. L. Rossi
Ionic currents in hair cells dissociated from frog semicircular canals after preconditioning under microgravity conditions
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2009; 296(5): R1585 - R1597.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
L. Nie, J. Zhu, M. A. Gratton, A. Liao, K. J. Mu, W. Nonner, G. P. Richardson, and E. N. Yamoah
Molecular Identity and Functional Properties of a Novel T-Type Ca2+ Channel Cloned From the Sensory Epithelia of the Mouse Inner Ear
J Neurophysiol, October 1, 2008; 100(4): 2287 - 2299.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Levic, L. Nie, D. Tuteja, M. Harvey, B. H. A. Sokolowski, and E. N. Yamoah
Development and regeneration of hair cells share common functional features
PNAS, November 27, 2007; 104(48): 19108 - 19113.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. Lee, O. Briklin, H. Hiel, and P. Fuchs
Calcium-dependent inactivation of calcium channels in cochlear hair cells of the chicken
J. Physiol., September 15, 2007; 583(3): 909 - 922.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
J. C. Holt, S. Chatlani, A. Lysakowski, and J. M. Goldberg
Quantal and Nonquantal Transmission in Calyx-Bearing Fibers of the Turtle Posterior Crista
J Neurophysiol, September 1, 2007; 98(3): 1083 - 1101.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
J. R. A. Wooltorton, S. Gaboyard, K. M. Hurley, S. D. Price, J. L. Garcia, M. Zhong, A. Lysakowski, and R. A. Eatock
Developmental Changes in Two Voltage-Dependent Sodium Currents in Utricular Hair Cells
J Neurophysiol, February 1, 2007; 97(2): 1684 - 1704.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
A. Almanza, F. Navarrete, R. Vega, and E. Soto
Modulation of Voltage-Gated Ca2+ Current in Vestibular Hair Cells by Nitric Oxide
J Neurophysiol, February 1, 2007; 97(2): 1188 - 1195.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. C. Holt, A. Lysakowski, and J. M. Goldberg
Mechanisms of Efferent-Mediated Responses in the Turtle Posterior Crista
J. Neurosci., December 20, 2006; 26(51): 13180 - 13193.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. Bonsacquet, A. Brugeaud, V. Compan, G. Desmadryl, and C. Chabbert
AMPA type glutamate receptor mediates neurotransmission at turtle vestibular calyx synapse
J. Physiol., October 1, 2006; 576(1): 63 - 71.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
V. Zampini, P. Valli, G. Zucca, and S. Masetto
Single-Channel L-Type Ca2+ Currents in Chicken Embryo Semicircular Canal Type I and Type II Hair Cells
J Neurophysiol, August 1, 2006; 96(2): 602 - 612.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
K. J. Rennie and M. A. Streeter
Voltage-Dependent Currents in Isolated Vestibular Afferent Calyx Terminals
J Neurophysiol, January 1, 2006; 95(1): 26 - 32.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
R. D. Rabbitt, R. Boyle, G. R. Holstein, and S. M. Highstein
Hair-Cell Versus Afferent Adaptation in the Semicircular Canals
J Neurophysiol, January 1, 2005; 93(1): 424 - 436.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
G. S. G. Geleoc, J. R. Risner, and J. R. Holt
Developmental Acquisition of Voltage-Dependent Conductances and Sensory Signaling in Hair Cells of the Embryonic Mouse Inner Ear
J. Neurosci., December 8, 2004; 24(49): 11148 - 11159.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
90/1/155    most recent
00244.2003v2
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bao, H.
Right arrow Articles by Eatock, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bao, H.
Right arrow Articles by Eatock, R. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the The American Physiological Society.