| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1Programa de Fisiología y Biofísica, Instituto de Ciencias Biomédicas, Facultad de Medicina, Universidad de Chile, Independencia 1027 Santiago, Chile; 2Department of Physiology and Biophysics, University of Colorado Health Sciences Center, Denver, Colorado 80262; and 3Instituto de Nutrición y Tecnología de los Alimentos, Universidad de Chile, Av. J.P. Alessandri 5540, Santiago, Chile
Submitted 22 April 2003; accepted in final form 13 July 2003
 |
ABSTRACT |
|---|
|
|
|
INTRODUCTION |
|---|
|
subunit of large-conductance calcium-activated potassium (BK) channels (Atkinson et al. 1991
; Butler et al. 1993). Neuronal activity produces both membrane depolarization and intracellular calcium elevations, resulting in activation of Slo potassium channels and repolarization of the membrane potential. The calcium sensitivity of Slo channels plays an important role in determining its physiological role.
Even though a single gene encodes Slo channel subunits, hundreds of different Slo transcripts and protein products can be generated as a result of extensive alternative splicing (Adelman et al. 1992; Atkinson et al. 1991; Butler et al. 1993; Navaratnam et al. 1997; Rosenblatt et al. 1997; Tseng-Crank et al. 1994). Alternative exon usage regulates channel properties including both voltage and calcium sensitivities (Lagrutta et al. 1994; Rosenblatt et al. 1997; Saito et al. 1997). Alternative splicing may account for tissue specific differences in the functional properties of BK channels that allow fine tuning of cellular excitability. (Latorre et al. 1989).
Given the significant functional consequences of alternative exon usage, expression of specific variants may be subject to extensive regulation. Indeed, the hormonal state of the organism determines whether the STREX-2 exon within the large carboxyl-terminus of rSlo is expressed (Xie and McCobb 1998). Inclusion of the STREX-2 exon alters the calcium and voltage sensitivities of the channel, and, thereby, modulates firing properties of chromaffin cells and secretion of epinephrine (Lovell and McCobb 2001). Inclusion of specific alternative exons in Slo transcripts thus matches cellular excitability to physiological requirements.
Given that alternative exon usage of Slo transcripts is regulated and affects cellular excitability, it is possible that developmental regulation of alternative splicing of the Slo gene may occur in embryonic neurons as they acquire their mature functional phenotype. Primary neurons of the developing spinal cord of the frog, Xenopus laevis, have served as a powerful system for addressing questions regarding developmental regulation of excitability (Spitzer and Ribera 1998). Xenopus spinal neurons display profound changes in cellular excitability as they progress from the electrically silent state to neurons that fire stereotypic brief sodium-dependent action potentials (Spitzer and Ribera 1998). Further, calcium-activated potassium currents have been recorded from these neurons (Blair and Dionne 1985; O'Dowd et al. 1988). Moreover, the properties of calcium-activated currents in these neurons show developmental regulation (Blair and Dionne 1985; O'Dowd et al. 1988).
In view of these considerations, we cloned the Xenopus Slo gene (xSlo) and analyzed alternative exon usage during the period when the action potential of primary spinal neurons undergoes dramatic developmental regulation (1-2 days in vivo). We report evidence for four alternative splice variants. One of the alternative variants, xSlo59, demonstrates neural-specific and developmentally specific expression. Inclusion of this exon in xSlo subunits renders recombinant channels sensitive to physiological levels of membrane depolarization and intracellular calcium.
|
|
METHODS |
|---|
|
Isolation of Xenopus Slo (xSlo) cDNAs was accomplished by a combination of DNA library screening and reverse transcription-polymerase chain reaction (RT-PCR) amplification of mRNA. For screening of cDNA libraries, 32P-labeled (New England Nuclear, Boston, MA) random-primed probes (Prime-It Kit, Stratagene, La Jolla, CA) were generated initially using the 3' end of mSlo (kindly provided by Dr. Lawrence Salkoff, Dept. of Anatomy and Neurobiology, Washington University) and subsequently from 5' ends of previously isolated xSlo partial cDNAs. Phage DNA was transferred to nitrocellulose filters and hybridized to 32P-labeled probes following standard procedures (Burger and Ribera 1996; Ribera 1990; Ribera and Nguyen 1993). Isolated clones were sequenced over both strands using the Sanger dideoxy method using either radiolabeled or fluorescent precursors. DNA sequences were read and analyzed using Gel Reader (CBS Scientific, Del Mar, CA) and DNASTAR software (Madison, WI).
RNA isolation and RT-PCR of xSlo cDNA
Cellular mRNA was isolated from whole embryos or cultured dissociated neural plate cells by homogenization and proteinase K treatment as previously described (Ribera 1990). cDNA synthesis was performed using oligo dT (Gibco BRL, Gaithersburg, MD)and Superscript II RT (GIBCO-BRL). The cDNA was used as input for subsequent PCRs using degenerate oligonucleotide primers that recognized regions of Slo that are highly conserved across species. The PCR conditions were five cycles at 95° for 2 min (denaturation), 48° for 2 min (annealing), 72° for 2 min (extension) followed by 35 cycles at 95° for 2 min, 58° for 2 min, and 72° for 2 min 45 s. Two different negative control reactions were run. The first tested for amplification of genomic DNA and consisted of preparing a RT reaction tube but omitting the RT enzyme. The second negative control tested for contamination in the PCR and consisted of preparing a RT reaction tube without RNA. Both of these negative controls were subjected to the two rounds of PCR as described in the preceding text. PCR products were gel purified and cloned (TA Cloning kit, Invitrogen, Carlsbad, CA). DNA sequencing confirmed their identity as Slo cDNAs.
Construction of an xSlo cDNA containing the entire coding region
The entire coding region of xSlo was contained within five overlapping cDNA clones. In a 5' to 3' order, these clones were xSlo4 (N terminus to beginning of S2), xSlo26 (S0 -S3), xSlo25 (S3-S6), xSlo6 (S6 -S10), and xSlo2 (S9 to 3'UTR). A single clone containing a continuous complete coding region (xSlo0) was assembled from the five overlapping cDNAs by a combination of further RT-PCR and attachment of clones using appropriate restriction sites. In brief, xSlo25 and xSlo6 were joined at a common HindIII site to yield clone 25/6. A clone encompassing xSlo4, xSlo26, xSlo25, and a portion of xSlo6 was generated by RT-PCR and called R4. R4 was joined to 25/6 at a shared EcoN1 restriction site to yield clone R4/25/6. R4/25/6 was joined to xSlo2 at a shared BglII restriction site to yield the clone, xSlo, that contained the entire coding region, 105 bp of 5'UTR, and 730 bp of 3'UTR. DNA sequencing confirmed that restricted fragments had been ligated to each other in frame and without introduction of base substitutions. Once the cDNAs had been assembled into a single clone, the entire open reading frame was resequenced.
Identification of xSlo splice variants
RT-PCR was used to examine the possibility of alternative splicing in the region 3' to S6. RNA was isolated and cDNA was reverse transcribed, as described in the preceding text. Forward and reverse PCR primers were designed that were 5' and 3', respectively, to potential sites of alternative splicing; in each case, an internal control for the effectiveness of the primer set was provided by amplification of a band corresponding to the product expected if no alternative insert existed at a particular site. In all, seven potential sites were examined. Four alternative inserts found for the site corresponding to mouse site 2 (Butler et al. 1993) or human site 2 (Tseng-Crank et al. 1994) were cloned and sequenced. In this study, we refer to this position as site 2.
Whole-mount in situ hybridization
The nonradioactive detection method (Ferreiro et al. 1993; Harland 1991) was followed with minor modifications as previously described (Burger and Ribera 1996). Embryos were produced by adult Xenopus breeding pairs or in vitro fertilization and staged according to Nieuwkoop and Faber (1967). cRNA probes were synthesized in the presence of digoxigenin-labeled UTP (Boehringer-Mannheim). Antisense and sense control probes corresponded to a region common to all xSlo transcripts; the antisense probe is referred to as the universal probe. For each stage examined, in situ hybridization experiments were repeated at least three times. Whole-mount embryos were either cleared in Murray's solution (2:1 benzyl benzoate:benzyl alcohol) or embedded in plastic (JB-4 embedding kit; Polysciences, Warrington, PA). Fifteen- to 30-µm sections were counterstained (e.g., methyl green, eosin) and photographed with Kodak Ektachrome 160T film. Slides were digitized using a Nikon Cool Scanner and composite figures were prepared using Adobe PhotoShop software.
Electrophysiology
The entire coding region of xSlo was subcloned into pGEMHE (generously provided by Dr. E. Liman) (Liman et al. 1991). The resultant clone was called pGHExSlo. In addition, the four alternative inserts found at site 2 were introduced separately into pGHExSlo. The resulting recombinant constructs were linearized with NheI and capped sense RNA was generated in vitro (mMessage mMachine, Ambion, Austin, TX). Oocytes were surgically removed, defolliculated, and injected with 0.5-50 ng of RNA as described previously (Burger and Ribera 1996; Ribera and Nguyen 1993) and incubated at 18° in ND-96 solution [which contained (in mM) 96 NaCl, 2 KCl, 1.8 CaCl2, 1 MgCl2, and 5 HEPES, pH7.5]. Excised macropatch recordings were carried out 2-10 days post injection. Electrodes were pulled from soft-glass to obtain resistances of 0.3-0.7 M
when filled with 100 mM potassium methanesulfonate (K-MES), 5 HEPES, pH 7.6 with KOH. Oocytes were placed in a chamber containing 100 mM K-MES, 5 HEPES, pH 7.2 with KOH, CaCl2, and calcium chelators to obtain the free calcium concentrations in the desired range (EGTA for the submicromolar range, EGTA and HEDTA for the 2- to 20-µM range, and NTA-HEDTA for the 60- to 80-µM range). The appropriate concentrations of CaCl2 and each chelator were determined using Maxchelator software, developed by Dr. C. Patton (www.stanford.edu/~cpatton/maxc.html); actual free calcium concentrations were directly measured using a calcium-selective electrode calibrated with commercially available standards (World Precision Instruments, Sarasota, FL). Dithiothreitol (10 mM) was added to the bath solution to prevent the time-dependent rundown and shift in activation curves described for other Slo channels (DiChiara and Reinhart 1997). Vitelline membranes were manually removed, inside-out macro patch-clamp configurations were established, and capacitative currents were electronically compensated. Changes of the free calcium concentration in the bath solution were achieved using a gravity-driven perfusion system. PCLAMP6 (Axon Instruments, Union City, CA) programs were used to execute voltage protocols and evaluate tail current amplitudes (see following text).
For analysis of steady-state voltage dependence of activation, we analyzed tail currents. The protocol consisted of changing the membrane potential to a series of activating potentials ranging between -90 and +160 mV in 10-mV increments and then returning to the holding potential of -90 mV. Because symmetrical potassium solutions were used (EK = 0 mV), inward tail currents were recorded when the membrane potential was returned to the holding value of -90 mV. Each membrane patch was subjected to several different intracellular [Ca2+], ranging between 0.6 µM and 1 mM, and tail currents were recorded in the presence of each of these different solutions. For data obtained from each excised membrane patch, we normalized tail current amplitudes to the maximum tail current amplitude (Imax) obtained in the presence of the maximum intracellular [Ca2+]. Thus Imax was determined in the presence of 1 mM intracellular Ca2+. Activation curves were constructed by plotting the normalized tail current amplitude (I/Imax) as a function of the activating membrane potential. Given that we measured tail currents that were obtained at the same voltage (-90 mV), Imax and I/Imax reflect Gmax and G/Gmax, respectively. The equation G/Gmax = Gmax/1 + exp([V1/2 - V]/k) was fit to the tail current data (Gmax, maximal conductance; V1/2, voltage of half-activation; k, slope factor). Calcium sensitivity was evaluated by plotting the value of V1/2 as a function of the intracellular [Ca2+].
For experiments examining properties of site 2 variants, we expressed the five identified variants in oocytes from the same batch to minimize the possibility that changes in functional properties might reflect variability between batches of oocytes rather than different intrinsic properties of each variant.
Data are presented as means ± SE. Student's t-test was used to assess statistical significance. P values 
0.05 used to indicate statistical significance.
RT-PCR analysis of variant expression in tissue and culture RNA
RNA was isolated from dissected tissues of neural tube 1 and 2-day embryos (St. 18-24) and neural plate cultures. Neural plate stage (St. 15) cultures were prepared as described previously (Ribera and Spitzer 1989) except that three to five neural plates were cultured per 60-mm culture dish. Reverse and forward primers flanking site 2 were designed (forward, 5' gccatctgccttgctgagctg 3'/1563-1579; reverse, 5' catgcagtgggctatt atcaggtgatg 3'/2706-2680). The reverse primer was used in the RT reaction as well as the first round of PCR. The forward primer was used in the first round of PCR as well as in the second nested PCR. For the nested PCR, five different reverse primers were designed and each recognized a specific site 2 variant (0Rev, 5' aggctgatggctgctcatcttcaag 3'; 15Rev, 5' caggcaaggaagggtgaggagg 3'; 56Rev, 5' gcggatggacatcttggaataaataag 3'; 59Rev, 5' gcggatggacatcttggaataaataag 3'; 99Rev, 5' gcctgtggatacttaatctatgttc 3'). Further, when any of these reverse nested primers was used with the forward primer, PCR products of similar size (ca. 400 bp) were generated. Accordingly, five separate nested PCRs followed each first round of PCR. The nested PCR products were cloned and sequenced to confirm their identity. RT-PCR analyses of xSlo variant expression in dissected tissues and neural plate cultures were repeated at least four times.
|
|
RESULTS |
|---|
|
The Slo gene encodes the subunit of BK-type calcium-activated potassium channels. We identified the Xenopus orthologue of Slo (xSlo) by performing standard cDNA library screening in combination with RT-PCR. We isolated five overlapping partial cDNAs. The five overlapping cDNAs were assembled into a single clone containing a 3,588-bp open reading frame that codes for a 1,196 amino acid protein (Fig. 1). We refer to this sequence as xSlo0.
|
|
; Butler et al. 1993). However, we found only a single in-frame ATG in the 5' region of xSlo0. This ATG was in the context of a canonical Kozak sequence (Kozak 1987), having the critical A/G and G at the -3 and +4 positions, respectively. Accordingly, we designated this ATG as the start codon. The predicted amino acid sequence of xSlo0 showed high identity with Slo subunits identified in other vertebrate species. The greatest identities were found across the regions encompassing the four hydrophobic domains known as S7-S10 (
90%) and the putative transmembranous segments (S0 -S6; 95%). The amino-terminus displayed the highest degree of divergence, being only 60% identical to the analogous region of other vertebrate Slo subunits. A region found in mSlo1, known as the "calcium bowl" (Schreiber and Salkoff 1997), strongly influences calcium sensitivity. The calcium bowl consists of two linear sequences of 6 and 21 amino acids separated by one variant amino acid and is identical in mouse, fly, worm, and human Slo. This region was also exactly conserved in xSlo0 (Fig. 1, amino acids 914-941). Another critical region for Slo channel function is the subunit association domain known as BK-T1 (Quirk and Reinhart 2001). This region was also conserved in xSlo0, suggesting that xSlo subunits can coassemble with invertebrate and other vertebrate Slo subunits. Because phosphorylation can modulate BK channel function (Weiger et al. 2002), it was also of interest to examine the xSlo sequence for potential phosphorylation sites. xSlo0 contains 14 consensus sites for A or C kinase-dependent phosphorylation. xSlo transcripts are present in excitable tissues of the embryo
Because of our interest in excitability during embryonic stages, we determined the expression pattern of the xSlo0 gene in Xenopus embryos by performing whole-mount in situ hybridization. In these studies, we used the universal probe that recognized a region common to xSlo0 and possible splice variants (see METHODS). Embryos ranging in age between 1 and 3 days (St. 18-36) were examined because of the well-known changes in excitability that occur during this time (Spitzer and Ribera 1998). We found that excitable tissues of the developing embryo expressed xSlo mRNA in a spatially and temporally dynamic pattern (Figs. 2 and 3). xSlo transcripts were detected in both the somites and neural tube of 1day
[PDB]
embryos. Within the nervous system, xSlo expression demonstrated a dorsal restriction and was thus expressed centrally in regions dedicated to processing of sensory information. Six hours later, xSlo expression appeared segmentally within the somites. At this time, xSlo expression was detected in a primary sensory organ, the trigeminal ganglion. By 2 days, other primary sensory organs (e.g., otic vesicle, eye) also began to express the xSlo gene. Within the retina, xSlo transcripts localized to an internal layer (Fig. 3E). In the developing otic vesicle, xSlo transcripts were abundant near the apical surface (Fig. 3F).
|
|
Alternative splicing of xSlo during embryonic development
In several species, alternative splicing of the Slo gene occurs and generates both molecular and functional heterogeneity of Slo peptides (Atkinson et al. 1991; Butler et al. 1993; Rosenblatt et al. 1997; Tseng-Crank et al. 1994). We were particularly interested in the possibility that splicing might occur within the region encoding the large cytoplasmic tail; splicing within this region has been shown to affect calcium sensitivity (e.g., Lagrutta et al. 1994; Saito et al. 1997). Using the positions at which alternative splicing occurs within dSlo, mSlo, rSlo, and hSlo transcripts as a vantage point, we tested for alternative splicing at seven different sites within the region coding for the large cytoplasmic tail of xSlo0 (Fig. 4A). We designed PCR primers that flanked the seven potential splice junctions and performed RT-PCR using 1- or 2-day embryo RNA as input. Despite the fact that seven potential sites were examined, we detected splice variants at only one site, known as site 2 in mSlo (Butler et al. 1993). In rSlo, alternative splicing at this same site results in the introduction of the so-called STREX exons that confer novel functional properties on Slo channels in a hormone-dependent manner (Saito et al.1997; Xie and McCobb 1998).
Our RT-PCR analyses identified four alternative exons at site 2, coding for inserts that added either 15, 56, 59, or 99 amino acids to the xSlo0 backbone. The 56 and 59 amino acid variants shared 60% amino identity with rat STREX-1 and -2 exons (Xie and McCobb 1998). The 56 and 59 amino acid variants differ by only 3 amino acids (LIY). We did not find any inserts that corresponded to these three amino acids only even though our screen did not bias against their identification.
The presence of STREX-like exons in frogs, turtles, birds, and mammals and their absence in flies and worms suggest that STREX exons are a vertebrate specialization. In contrast, neither the 15 nor 99 amino acid insert displayed sequence similarity with site 2 alternative exons found in other species and thus may be unique to frogs.
Expression of site 2 alternative exons
We performed RT-PCR analyses to determine the expression patterns of site 2 variants within excitable tissues of the developing Xenopus embryo. After the RT reaction, we carried out five PCRs in parallel. Each PCR used a common forward primer but a different reverse primer that was specific for each splice variant. Further, the reverse primers were designed so that the PCR products generated for each variant would be of similar size. DNA sequencing confirmed the specific identity of each PCR product.
To examine excitable tissues of the developing embryo, we isolated RNA from either the somites (precursors of skeletal muscle) or neural plate (presumptive spinal cord) of the trunk of Stage 18-20 embryos (20-22 h). We found that the xSlo0, xSlo15, xSlo56, and xSlo99 variants were present in RNA isolated from either somitic or neural plate tissue (Fig. 4B). In striking contrast, the xSlo59 variant was not expressed by somitic tissue. However, we detected expression of the xSlo59 variant in the neural plate, indicating that the expression of this variant was neural-specific.
Alternative splicing generates functional heterogeneity
To study the functional properties of channels coded for by the xSlo gene, we performed heterologous expression experiments using the Xenopus oocyte system. In initial two-electrode voltage-clamp studies, we found that the outward currents induced by heterologous expression of xSlo0 cRNA in oocytes were voltage dependent and sensitive to TEA and charybdotoxin, classic blockers of BK current (data not shown). To analyze quantitatively the properties of channels generated by xSlo0 and the four site 2 variants, we recorded currents from excised inside-out macropatches of oocytes injected with the different cRNAs (Fig. 5). We first analyzed calcium-dependent properties by exposing the intracellular surface of the membrane patch to different concentrations of calcium. For example, for patches excised from oocytes expressing xSlo0 cRNA, exposing the intracellular patch membrane to 2.7 µM calcium allowed depolarization to activate more current in response to depolarization than when the patch was exposed to 0.6 µM calcium (Fig. 5).
|
We next compared the voltage-dependent properties of the different variants. We found that the xSlo59 variant was most sensitive to depolarization (Fig. 5, B-D). In the presence of 72 µM "intracellular" calcium, 30 mV less depolarization was required to activate half of the xSlo59 versus xSlo0 conductance (Fig. 5C). Moreover, over a wide range of intracellular calcium concentrations (0.6-1000 µM), the voltage of half-maximal activation (V1/2), was consistently more negative for xSlo59 versus xSlo0 and the other variant channels (Fig. 5D). With respect to calcium and voltage sensitivities, xSlo15, xSlo56, and xSlo99 channels behaved more similarly to xSlo0 than to xSlo59 channels. Moreover, the xSlo56 variant, which differs from the xSlo59 variant by only four amino acids, displayed values of V1/2 that differed significantly from those of xSlo59 at "intracellular" calcium concentrations of 0.6, 16, 72, and 1,000 µM (Fig. 5D; P 0.001; values did not differ for 2.7 µM "intracellular" calcium). Taken together, these data indicate that physiological levels of calcium and membrane potential effectively activate xSlo59 channels. Thus both functional properties as well as neural-specific expression uniquely characterize the xSlo59 variant.
Development regulates expression of site 2 variants in Xenopus spinal neurons
Alternative splicing at site 2 serves as a mechanism to modify the functional properties of xSlo subunits. For example, inclusion of the xSlo59 exon confers physiologically relevant calcium- and voltage-dependent properties on xSlo channels. Moreover, the fact that this variant is neural-specific raises the possibility that expression of this gain-of-function exon is under selective regulation. To test this possibility further, we next examined how expression of xSlo0 and the site 2 variants was regulated during development. We focused on the stage of development (1-2 days in vivo; 6-24 h in vitro) during which spinal neurons undergo a well-characterized change in membrane excitability that results in dramatic shortening of the impulse duration (Spitzer and Lamborghini 1976).
We isolated RNA from neural plate cultures or whole embryos at two developmental time points. One day in vivo and 6 h in vitro correspond to stages when spinal neurons fire long-duration impulses. In contrast, at 2 days in vivo or 24 h in vitro the action potential of spinal neurons has matured to a brief 1- to 2-ms duration event. RT-PCR analysis for each variant indicated that at 24 h in vitro and 2 days in vivo, all five variants were expressed. However, at 6 h in vitro, we did not detect expression of the xSlo59 variant. Similarly, in vivo, xSlo59 expression is upregulated at 2 compared with 1 day. Thus the neural-specific xSlo59 is developmentally upregulated. The xSlo56 variant also displays developmentally up-regulated expression. However, this latter variant is not neural specific as is xSlo59 (Fig. 4).
|
|
DISCUSSION |
|---|
|
; Butler et al. 1993; Jones et al. 1998; Navaranatan et al. 1997; Rosenblatt et al. 1997; Tseng-Crank et al. 1994; Wang et al. 2001). In flies and mice, the combination of identified alternative Slo exons allows for hundreds of different proteins. Even though the functional significance of each identified Slo exon as well as their combinatorial usage has not yet been established, inclusion of specific exons in mature transcripts significantly alters physiologically relevant channel properties, such as voltage and calcium sensitivities (Lagrutta et al. 1994; Rosenblatt et al. 1997; Saito et al. 1997; Xie and McCobb 1998). Further, expression of functionally diverse Slo gene products can modify critical parameters of cellular excitability, such as activation threshold (Saito et al. 1997; Xie and McCobb 1998). Despite the enormous diversity of Slo gene products, we identified only four alternative exons that are included at a single site (A) in xSlo transcripts expressed during embryonic development of the Xenopus embryo. While it is possible that more extensive splicing of xSlo occurs during later preand postmetamorphic stages, the limited number of xSlo gene products found during embryogenesis contrasts with the diversity of neuronal excitability phenotypes noted at these stages (Spitzer and Ribera 1998).
Sites for insertion of alternative exons have been conserved during evolution (Atkinson et al. 1991; Butler et al. 1993; Jones et al. 1998; Navaranatan et al. 1997; Rosenblatt et al. 1997; Tseng-Crank et al. 1994). In contrast, the predicted amino acid sequences of alternative exons generally show little homology across species. However, a notable exception is a subset of cysteine-rich exons (STREX) found at site 2, between domains S8 and S9 of the large cytoplasmic carboxyl-terminus (Saito et al. 1997; Xie and McCobb 1998). STREX exons exist in a wide range of vertebrate species (e.g., frog, chicks, and rat), but have not yet been identified in invertebrate species such as worms or flies. Any novel function or modulation that these exons impart on the resultant protein may have evolved as vertebrate specializations. Do STREX exons add new functions to Slo channels? We found that the xSlo59 exon acts as a gain-of-function module. Inclusion of the xSlo59 exon renders the resultant channel more sensitive to intracellular calcium and membrane depolarization. These changes predict effi-cient activation of xSlo59 channels at physiologically relevant levels of intracellular calcium and membrane voltage. With respect to voltage sensitivity, the effects of xSlo59 are similar to those observed when STREX-2 is included in rSlo channels (Saito et al. 1997; Xie and McCobb 1998). Additionally, inclusion of these exons modulates the sensitivity of Slo channels to phosphorylation (Erxleben et al. 2002; Tian et al. 2001).
The sequences of the xSlo56 and xSlo59 exons differ only by the inclusion of three additional amino acids (LIY) and a codon change that substitutes serine for proline (Fig. 4). STREX-1 and -2 exons differ also by the inclusion of the amino acid sequence LIY (Xie and McCobb 1998). Despite these minimal differences, xSlo59 adds physiologically significant calcium and voltage sensitivities to xSlo channels while xSlo56 has only subtle effects. Given the minimal sequence differences between xSlo56 and xSlo59 (and STREX-1 and -2), it is surprising that they differ significantly in how they alter xSlo channel function.
An additional indication that expression of the xSlo59 exon has important functional consequences is that it displays a highly regulated expression pattern with respect to tissue, while xSlo0 and the other site 2 variants do not (Fig. 4). xSlo0 and the other site 2 variants are expressed in both muscle and neural tissue. In contrast, xSlo59 shows neural-specific expression. In addition, xlo59 and the related xSlo56 variants display a developmentally upregulated expression pattern (Fig. 6). Thus these two variants are more robustly expressed at later stages of neuronal differentiation after the period when transient calcium elevations occur spontaneously in Xenopus spinal neurons (Holliday and Spitzer 1990). An impressive regulatory mechanism for expression of STREX exons has also been observed for rSlo. In adrenal chromaffin cells, steroid hormones tightly regulate expression of the STREX exons, which in turn alter firing properties and secretion of epinephrine (Lai and McCobb 2002; Lovell and McCobb 2001; Xie and McCobb 1998).
|
Expression of critical sodium and potassium channel genes occurs during neurulation in the Xenopus embryo (Armisén et al. 2002; Burger and Ribera 1996; Ribera 1990,1996). Thus acquisition of the mature electrophysiological phenotype of Xenopus spinal neurons requires new transcription during postmitotic stages of differentiation (Ribera and Spitzer 1989). Our current results suggest that in addition to transcription, developmentally regulated alternative splicing fine tunes the electrical properties of differentiated neurons. This complexity in mechanisms may go even further to cell specific variations as demonstrated for the expression of a variety of voltage-activated potassium channels that yield an apparently homogeneous functional phenotype (Ribera 1996). The relative simplicity of xSlo transcript processing during embryonic stages may provide an entry point for in vivo analysis of splicing mechanisms.
Primary amphibian neurons initially fire long-duration, calcium-dependent action potentials, which are subsequently converted to brief, sodium-dependent spikes (Spitzer and Lamborghini 1976). Long-duration impulses allow significant elevations of intracellular cytosolic and nuclear calcium (Holliday et al. 1991). These calcium transients provide signals necessary for subsequent elaboration of key neuronal properties, including neurite initiation, formation of neuron-myocyte contacts, accumulation of GABA-like immunoreactivity, and acceleration of potassium current kinetics (Bixby and Spitzer 1984; Desarmenien and Spitzer 1991; Gu and Spitzer 1995; Henderson et al. 1984; Holliday and Spitzer 1990; Holliday et al. 1991). Previous evidence indicates that several different types of voltage-gated potassium channels (e.g., Kv1, Kv2, Kv3) play important roles in action potential repolarization as spinal neurons mature (Blaine and Ribera 2001; Ribera 1996; Vincent et al. 2000). The present work extends these findings by raising the possibility that another class of channels, calcium-activated potassium channels, also participate in developmental regulation of the duration of spinal neuron action potentials.
Our RT-PCR developmental analyses indicate that expression of the xSlo59 variant is neural-specific. Further, xSlo59 expression shows a dramatic increase after the period of initial excitability when neurons fire long-duation impulses (Fig. 6). At later stages, inclusion of the xSlo59 exon would result in channels that enhance repolarization of action potentials and generation of afterhyperpolarizations and consequently modulate the firing properties of spinal neurons. The increased sensitivity to intracellular calcium of xSlo59 channels could serve as a powerful negative feedback system and attenuate elevations of intracellular calcium during periods of neuronal activity. In addition, such channels could have dramatic effects on the firing properties of mature neurons. Indeed, Sun and Dale (1998) reported that application of the large-conductance calcium-activated potassium channel blocker, iberiotoxin, to mature neurons led to more rapid firing rates. These latter findings suggest that developmentally regulated expression of xSlo channels, especially ones with higher sensitivity to intracellular calcium, could contribute to the observed changes in firing properties of these neurons.
The xSlo56 variant is also developmentally upregulated. However, this variant is not expressed in a neural-specific manner, making it difficult to determine whether developmental upregulation occurs in all tissues or a restricted subset. The analyses presented in Fig. 6 examined expression in RNA extracted from the entire embryo or from neural plate cultures, both of which contain neurons as well as other excitable and nonexcitable cells.
Calcium signals in excitable tissues regulate stage-specific expression of several genes, including genes encoding ion channels. For example, the developmentally regulated expression of calcium-activated potassium channels in ascidian muscle depends on the activity of voltage-gated calcium channels, presumably through the increase of intracellular calcium levels (Dallman et al. 1998). Further, calcium/calmodulin-dependent protein-kinase-mediated processes regulate alternative splicing of Slo transcripts (Xie and Black 2001). These findings raise the possibility that cellular electrical activity controls the selection of alternative exons in xSlo transcripts, such as xSlo59. These findings add new temporal and mechanistic dimensions to the role of calcium-activated potassium channels as feedback elements for excitability.
|
|
DISCLOSURES |
|---|
|
|
|
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: A. B. Ribera, Dept. of Physiology and Biophysics C-240, University of Colorado Health Sciences Center, Denver, CO 80262 (E-mail: angie.ribera{at}uchsc.edu).
|
|
REFERENCES |
|---|
|
Armisén R, Fuentes R, Olguín P, Cabrejos ME, and Kukuljan M. Repressor element-1 silencing transcription/neuron-restrictive silencer factor is required for neural sodium channel expression during development of Xenopus. J Neurosci 22: 8347-8351, 2002.
Atkinson NS, Robertson GA, and Ganetzky B. A component of calcium-activated potassium channels encoded by the Drosophila slo locus. Science 253: 551-555, 1991.
Bixby JL and Spitzer NC. Early differentiation of vertebrate spinal neurons in the absence of voltage-dependent Ca2+ and Na+ influx. Dev Biol 106: 89-96, 1984.[Web of Science][Medline]
Blaine JT and Ribera AB. Kv2 channels form delayed-rectifier potassium channels in situ. J Neurosci 21: 1473-1480, 2001.
Blair LA and Dionne VE. Developmental acquisition of Ca2+-sensitivity by K+ channels in spinal neurones. Nature 315: 329-331, 1985.[Medline]
Burger C and Ribera AB. Xenopus spinal neurons express Kv2 potassium channel transcripts during embryonic development. J Neurosci 16: 1412-1421, 1996.
Butler A, Tsunoda S, McCobb DP, Wei A, and Salkoff L. mSlo, a complex mouse gene encoding the "maxi" calcium-activated potassium channels. Science 26: 221-224, 1993.
Chandy KG and Gutman GA. Nomenclature for mammalian potassium channel genes. Trends Pharmacol Sci 14: 434, 1993.[Medline]
Dallman JE, Davis AK, and Moody WJ. Spontaneous activity regulates calcium-dependent K+ current expression in developing ascidian muscle. J Physiol 511: 683-693, 1998.
Desarmenien MG and Spitzer NC. Role of calcium and protein kinase C in development of the delayed rectifier potassium current in Xenopus spinal neurons. Neuron 7: 797-805, 1991.[Web of Science][Medline]
DiChiara TJ and Reinhart PH. Redox modulation of hslo Ca2+-activated K+ channels. J Neurosci 17: 4942-4955, 1997.
Erxleben C, Everhart AL, Romeo C, Florance H, Bauer MB, Alcorta DA, Rossie S, Shipston MJ, and Armstrong DL. Interacting effects of N-terminal variation and strex exon splicing on slo potassium channel regulation by calcium, phosphorylation, and oxidation. J Biol Chem 277: 27045-2752, 2002.
Ferreiro B, Skoglund P, Bailey A, Dorsky R, and Harris WA. XASH1, a Xenopus homologue of Achaete scute: a proneural gene in anterior regions of the vertebrate central nervous system. Mech Dev 40: 25-36, 1993.[Web of Science][Medline]
Gu X and Spitzer NC. Distinct aspects of neuronal differentiation encoded by frequency of spontaneous Ca2+ transients. Nature 375: 784-787, 1995.[Medline]
Harland RM. In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol 36: 685-695, 1991.[Medline]
Henderson LP, Smith MA, and Spitzer NC. The absence of calcium blocks impulse-evoked release of acetylcholine but not de novo formation of functional neuromuscular synaptic contacts in culture. J Neurosci 4: 3140-3150, 1984.[Abstract]
Holliday J, Adams RJ, Sejnowski TJ, and Spitzer NC. Calcium-induced release of calcium regulates differentiation of cultured spinal neurons. Neuron 7: 787-796, 1991.[Web of Science][Medline]
Holliday J and Spitzer NC. Spontaneous calcium influx and its roles in differentiation of spinal neurons in culture. Dev Biol 141: 13-23, 1990.[Web of Science][Medline]
Jones EMC, Laus C, and Fettiplace R. Identification of Ca2+-activated K+ channel splice variants and their distribution in the turtle cochlea. Proc R Soc Lond B Biol Sci 265: 685-692, 1998.[Medline]
Kozak M. At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J Mol Biol 196: 947-950, 1987.[Web of Science][Medline]
Lagrutta A, Shen KZ, North RA, and Adelman JP. Functional differences among alternatively spliced variants of Slowpoke, a Drosophila calcium-activated potassium channel. J Biol Chem 269: 20347-20351, 1994.
Lai GJ and McCobb DP. Opposing actions of adrenal androgens and glucocorticoids on alternative splicing of Slo potassium channels in bovine chromaffin cells. Proc Natl Acad Sci USA 99: 7722-7727, 2002.
Latorre R, Oberhauser A, Labarca P, and Alvarez O. Varieties of calcium-activated potassium channels. Annu Rev Physiol 51: 385-399, 1989.[Web of Science][Medline]
Liman ER, Hess P, Weaver F, and Koren G. Voltage-sensing residues in the S4 region of a mammalian K+ channel. Nature 353: 752-756, 1991.[Medline]
Lovell PV and McCobb DP. Pituitary control of BK potassium channel function and intrinsic firing properties of adrenal chromaffin cells. J Neurosci 21: 3429-3442, 2001.
Navaratnam DS, Bell TJ, Tu TD, Cohen EL, and Oberholtzer JC. Differential distribution of Ca2+-activated K+ channels splice variants among hair cells along the tonotopic axis of the chick cochlea. Neuron 19: 1077-1085, 1997.[Web of Science][Medline]
Nieuwkoop PD and Faber J. Normal Table of Xenopus laevis. Amsterdam: Daudin, 1967.
O'Dowd DK, Ribera AB, and Spitzer NC. Development of voltage-dependent calcium, sodium, and potassium currents in Xenopus spinal neurons. J Neurosci 8: 792-805, 1988.[Abstract]
Quirk JC and Reinhart PH. Identification of a novel tetramerization domain in large conductance K(ca) channels. Neuron 32: 13-23, 2001.[Web of Science][Medline]
Ribera AB. A potassium channel gene is expressed at neural induction. Neuron 5: 691-701, 1990.[Web of Science][Medline]
Ribera AB. Homogeneous development of electrical excitability via heterogeneous ion channel expression. J Neurosci 16: 1123-1130, 1996.
Ribera AB and Nguyen DA. Primary sensory neurons express a Shaker-like potassium channel gene. J Neurosci 13: 4988-4996, 1993.[Abstract]
Ribera AB and Spitzer NC. A critical period of transcription required for differentiation of the action potential of spinal neurons. Neuron 2: 1055-1062, 1989.[Web of Science][Medline]
Rosenblatt KP, Sun Z-P, Heller S, and Hudspeth AJ. Distribution of Ca2+-activated K+ channels isoforms along the tonotopic gradient in the chicken cochlea. Neuron 19: 1061-1075, 1997.[Web of Science][Medline]
Saito M, Nelson C, Salkoff L, and Lingle CJ. A cysteine-rich domain defined by a novel exon in a Slo variant in rat adrenal chromaffin cells and PC12 cells. J Biol Chem 272: 11710-11717, 1997.
Schreiber M and Salkoff L. A novel calcium-sensing domain in the BK channel. Biophys J 73: 1355-1363, 1997.[Web of Science][Medline]
Spitzer NC and Lamborghini J. The development of the action potential mechanism in amphibian neurons. Proc Natl Acad Sci USA 73: 1641-1652, 1976.
Spitzer NC and Ribera AB. Development of electrical excitability in embryonic neurons: mechanisms and roles. J Neurobiol 37: 9585-9593, 1998.
Sun Q and Dale N. Developmental changes in expression of ion currents accompany maturation of locomotor pattern in frog tadpoles. J Physiol 507: 257-264, 1998.
Tian L, Duncan RR, Hammond MS, Coghill LS, Wen H, Rusinova R, Clark AG, Levitan IB, and Shipston MJ. Alternative splicing switches potassium channel sensitivity to protein phosphorylation. J Biol Chem 276: 7717-7720, 2001.
Tseng-Crank J, Foster CD, Krause JD, Mertz R, Godinot N, DiChiara TJ, and Reinhart PH. Cloning, expression, and distribution of functionally distict Ca(2+)-activated K+ channels isoforms from human brain. Neuron 13: 1315-1350, 1994.[Web of Science][Medline]
Vincent A, Lautermilch NJ, and Spitzer NC. Antisense suppression of potassium channel expression demonstrates its role in maturation of the action potential. J Neurosci 20: 6087-6094, 2000.
Wang ZW, Saifee O, Nonet ML, and Salkoff L. SLO-1 potassium channels control quantal content of neurotransmitter release at the C. elegans neuromuscular junction. Neuron 32: 867-881, 2001.[Web of Science][Medline]
Weiger TM, Hermann A, and Levitan IB. Modulation of calcium-activated potassium channels. J Comp Physiol [A] 188: 79-87, 2002.[Web of Science][Medline]
Xie J and Black DL. A CaMK IV responsive RNA element mediates depolarization-induced alternative splicing of ion channels. Nature 410: 936-939, 2001.[Medline]
Xie J and McCobb DP. Control of alternative splicing of potassium channels by stress hormones. Science 280: 443-446, 1998.
This article has been cited by other articles:
|
|
 |
|
  L. Chen, L. Tian, S. H.-F. MacDonald, H. McClafferty, M. S. L. Hammond, J.-M. Huibant, P. Ruth, H.-G. Knaus, and M. J. Shipston Functionally Diverse Complement of Large Conductance Calcium- and Voltage-activated Potassium Channel (BK) {alpha}-Subunits Generated from a Single Site of Splicing J. Biol. Chem., September 30, 2005; 280(39): 33599 - 33609. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X.-P. Sun, B. Yazejian, and A. D. Grinnell Electrophysiological properties of BK channels in Xenopus motor nerve terminals J. Physiol., May 15, 2004; 557(1): 207 - 228. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
TOP
ABSTRACT
INTRODUCTION
4 experiments for each variant and tissue examined.
) and somites (
point to 3 adjacent somites). Scale Bar: 100 µm. B: by viewing the embryo of A dorsally, neural (
