JN AJP: Cell Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Neurophysiol 90: 3950-3957, 2003. First published August 20, 2003; doi:10.1152/jn.00647.2003
0022-3077/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/6/3950    most recent
00647.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fu, Z.
Right arrow Articles by Vicini, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fu, Z.
Right arrow Articles by Vicini, S.

Functional Excitatory Synapses in HEK293 Cells Expressing Neuroligin and Glutamate Receptors

Zhanyan Fu1, Philip Washbourne2, Pavel Ortinski1 and Stefano Vicini1

1 Department of Physiology and Biophysics, Georgetown University School of Medicine, Washington, DC 20007; 2 Center for Neuroscience, University of California, Davis, California 95616

Submitted 7 July 2003; accepted in final form 13 August 2003


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 ACKNOWLEDGMENTS
 REFERENCES
 
The discovery that neuroligin is a key protein involved in synapse formation offers the unprecedented opportunity to induce functional synapses between neurons and heterologous cells. We took this opportunity recording for the first-time synaptic currents in human embryonic kidney 293 (HEK293) cells transfected with neuroligin and the N-methyl-D-aspartate or AMPA receptor subunits in a co-culture with rat cerebellar granule cells. These currents were similar to synaptic currents recorded in neurons, and their decay kinetics was determined by the postsynaptic subunit combination. Although neuroligin expression was sufficient to detect functional synapses, cotransfection of HEK293 cells with Postsynaptic density-95/synapse-associated protein-90 (PSD-95) significantly increased current frequency. Our results support the central role of neuroligin in the formation of CNS synapses, validate the proposal that PSD-95 allows synaptic maturation, and provide a unique experimental model to study how molecular components determine functional properties of excitatory synapses.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 ACKNOWLEDGMENTS
 REFERENCES
 
Neuroligins 1–3 constitute a family of brain-specific cell-adhesion membrane proteins (Ichtchenko et al. 1990Go, 1996Go). It has been demonstrated that these molecules are localized postsynaptically at excitatory synapses and interact with {beta}-neurexins, resulting in the formation of synaptic junctions (Dean et al. 2003Go; Nguyen and Sudhof 1997Go; Song et al. 1999Go). Using an in vitro system, Scheiffele et al. (2000Go) demonstrated that neuroligins can trigger morphological presynaptic differentiation in contacting axons. In this study, functional synapse formation was inferred by showing that neuroligin expressed in nonneuronal cells leads to clustering of synaptic vesicles within axons. These clusters displayed functional exocytosis as seen by increased staining with antibodies against the luminal domain of synaptotagmin after incubation in a depolarizing solution (Scheiffele et al. 2000Go). While this evidence strongly suggested functionality in newly formed synapses, it was nevertheless indirect. In our study, we tested for the presence of functional synapses directly by co-transfecting human embryonic kidney 293 (HEK293) cells with a GFP-tagged form of neuroligin and subunits of the N-methyl-D-aspartate (NMDA) or {alpha}-amino-3-hydroxy-5-methyl-4-isoxazoleproprionic acid (AMPA) receptors and verifying synaptic transmission electrophysiologically.

Under culture conditions favoring synaptic transmission, cerebellar granule cells (CGCs) can form a large excitatory network (Chen et al. 2000Go; Mellor et al. 1998Go; Virginio et al. 1995Go) that exhibits paroxysmal activity when Mg2+ is removed from the extracellular solution (ECS) (Chen et al. 2000Go; Losi et al. 2002Go). Application of TTX allows low-frequency NMDA- and AMPA-mediated miniature excitatory postsynaptic currents (mEPSCs) to be recorded and studied (Losi et al. 2002Go). Over-expression of NR2A and NR2B NMDA receptor subunits in these cells determines the decay kinetics of NMDA EPSCs (Prybylowski et al. 2002Go). This matches, to some extent, data from rapid agonist applications to HEK293 cells transfected with NMDA receptor (NMDAR) subunits (Cull-Candy et al. 2001Go), indicating that the expression of the NR2A subunit is critical to produce fast decay kinetics of the response. Our experimental model of functional synapse formation between CGCs and HEK293 cells transfected with NMDA receptor subunits allows further investigation of this hypothesis by providing a unique opportunity to study how subunit composition of postsynaptic receptors sets the properties of excitatory synapses.

Postsynaptic density-95/synapse-associated protein-90 (PSD-95) is a member of the membrane-associated guanylate kinases (MAGUKs) superfamily (Garner et al. 2000Go; Kornau et al. 1997Go). In postsynaptic densities, the cytosolic C-terminal tails of NMDA receptor subunits associate with distinct PSD-95/discs large/zona occludens-1 (PDZ) domains (Garner et al. 2000Go; Kennedy 1998Go; Kornau et al. 1997Go). The first two PDZ domains of PSD-95 bind to the NMDA receptor subunits NR2A and NR2B, whereas the third PDZ domain interacts with the C terminus of neuroligins (Hunt et al. 1996Go; Irie et al. 1997Go). In addition, redistribution of PSD-95 from the cytosol to the plasma membrane can be induced by transfection of neuroligin 1 or NR2A subunits in HEK293 cells (Irie et al. 1997Go). Developmental expression of PSD-95 parallels that of NR2A subunit (Sans et al. 2000Go). At the same time, PSD-95 expression parallels that of neuroligin and of NR1 subunit during development in brain homogenates (Song et al. 1999Go). In hippocampal and cortical neurons, PSD-95 over-expression increases the AMPA mEPSCs and AMPA receptor expression at the synapse but does not affect NMDARs (Beique and Andrade 2003Go; El-Husseini et al. 2000Go; Schnell et al. 2002Go). However, functional consequences of a specific interaction between PSD-95 and NR2A subunits have been reported in visual cortical neurons as well as in CGCs (Losi et al. 2003Go; Towsend et al. 2003). In all these studies, PSD-95 effects were abolished by mutation of N-terminus cysteines into serines (PSD-95gfpC3,5S), preventing the palmitoylation of the protein (Craven et al. 1999Go).

Taken together, these data suggest a specific interaction between neuroligin, PSD-95 and NMDAR. Indeed, neuroligins have been proposed to organize the postsynaptic assembly of protein complexes involved in signal transduction (Scheiffele et al. 2000Go; Song et al. 1999Go). We therefore investigated the effect of PSD-95 over-expression on NMDA-mEPSCs resulting from the functional synapse formation between CGCs and NMDAR expressing HEK293 cells cotransfected with neuroligin and PSD-95.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 ACKNOWLEDGMENTS
 REFERENCES
 
DNA constructs

Neuroligin was amplified from cDNA obtained from occipital rat cortex RNA using the primers neuroligin1f (ctcaagcttatggcacttcccagatgcatgtggc) and neuroligin1rev (ggtctcgagctataccctggttgttgaatgtzgaatggggg). Subsequently, a single base change (silent mutation) was incorporated into the sixth codon after the signal sequence splice site (gta>gtc) by megaprimer PCR using Nlg1-MP (gtaaccaatgggtcgacatcatccaac) and the above-mentioned primers. A SalI restriction site was thus introduced. GFP was amplified from the EGFP vector (Clontech, Palo Alto, CA) by using GFPf (ctcgtcgacatggtgagcaagggcgaggagc) and GFPr (ggtgtcgaccttgtacagctcgtccatgccg) to incorporate SalI restriction sites at the 5' and 3' termini, and GFP was then inserted into the mutated neuroligin. PSD-95gfp and PSD-95gfpC3,5S were generous gifts of Dr. David Bredt (University of California, San Francisco, CA) and are described in Craven et al. (1999Go). The NR1–1a, NR2A, and NR2B constructs were described in Vicini et al. (1998Go). The GluRDflip construct subcloned in the PRK7 expression vector was a gift from Dr. Peter H. Seeburg (University of Heidelberg Germany). In some experiments, we used the rat NR2B-flag and the human NR2A-flag (NR2B or NR2A subunit tagged at the N-terminus with Flag epitope), the respective gifts of Dr. Anne Stephenson (School of Pharmacy University College, London, UK) and Dr. Paul Whiting (Merck Sharp and Dohme) that have been previously described (Hawkins et al. 1999Go; McIlhinney et al. 1998Go; Prybylowski et al. 2002Go). The human NMDAR subunits are highly conserved with >95% homology to the NMDAR subunits in the rat. No significant differences were seen when flag-tagged subunits were used. Rat {alpha}1, {beta}3, and {gamma}2 GABAA receptor subunit cDNAs singly subcloned into the expression vector pCDM8 (Invitrogen) were provided by Dr. Peter H. Seeburg.

CGC and HEK293 cell culture and transfection

Primary cultures of rat cerebellar granule neurons were prepared from postnatal day 7 (P7) Sprague-Dawley rats. Rat pups were killed by decapitation in agreement with the guidelines of the Georgetown University Animal Care and Use Committee. The cerebella were dissociated as described in Gallo et al. (1987Go). Cells were dispersed with trypsin (0.25 mg/ml, Sigma, St. Louis, MO) and plated at a density of 1.1 x 106 cells/ml on glass coverslips (Fisher Scientific, Pittsburgh, PA) coated with poly-L-lysine (10 µg/ml; Sigma) in 35-mm Nunc dishes. The cells were cultured in basal Eagle's medium supplemented with 10% bovine calf serum, 2 mM glutamine, and 100 µg/ml gentamycin (all from Invitrogen, Carlsbad, CA) and maintained at 37°C in 5% CO2. The final concentration of KCl in the culture medium was adjusted to 25 mM (high K+). To achieve functional synapse formation, at DIV5 the medium was replaced with the low (5 mM) potassium medium (MEM supplemented with 5 mg/ml glucose, 0.1 mg/ml transferrin, 0.025 mg/ml insulin, 2 mM glutamine, 20 µg/ml gentamicin, Invitrogen and cytosine arabinofuranoside 10 µM, Sigma) as previously described (Chen et al. 2000Go; Prybylowski et al. 2002Go). Human embryonic kidney 293 cells (American Type Culture Collection, Rockville MD, ATCC No. CRL1573) were grown in Minimal Essential Medium (Gibco BRL, Gaithersburg, MD), supplemented with 10% fetal bovine serum, 100 units /ml penicillin (Gibco BRL), and 100 units/ml streptomycin (Gibco BRL) in a 5% CO2 incubator. Exponentially growing cells were dispersed with trypsin, seeded at 2 x 105 cells/35-mm dish in 1.5 ml of culture medium. HEK293 cells after transfection were dispersed with trypsin and plated on CGCs cultures at a density of 1 x104 cells/12-mm coverslip. HEK293 cells were transfected as described in Vicini et al. (1998Go). Briefly, mixed plasmids (3 µg total) were added to the dish containing 1.5 ml MEM culture medium for 12–16 h at 37°C under 5% CO2. >80% of cells expressed all the plasmids transfected as assessed independently with Clontech pEGFP, pDsRED2, and pECFP plasmids (not shown).

Immunocytochemistry

All incubations for staining experiments were done at room temperature. Mixed CGCs-HEK293s cultures were fixed in 4% paraformaldehyde, 4% sucrose in PBS for 5 min, and then incubated in 0.3% Triton X-100 for 10 min. Cells were preincubated in 10% BSA (Sigma) for 1 h and then incubated with primary antibodies in phosphate-buffered saline (PBS) containing 3% BSA for 1 h. Rabbit anti-synapsin1 antibody (Chemicon, Temecula, CA) was used at 1:4,000. After washing with PBS for several times, cells were incubated for 1 h with indocarbocyanine (Cy3)-conjugated goat anti-rabbit IgG secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA) used at 1:2,000. Coverslips were mounted on slides using AntiFade component A (Molecular Probe, Eugene, OR) as mounting medium. The cultures were imaged on a Nikon EN600 microscope equipped with a x60, 1.0 numerical aperture objective. Spectral characteristics of the excitation-emission filters used were 490/530 nm for GFP and 545/610 nm for Cy3. The camera used was a Hamamatsu Orca-100, 12-bit cooled CCD digital camera, 1,392 x 1,040 pixel array. Images were captured and pseudocolored for presentation with MetaMorph imaging software (Universal Imaging, Downingtown, PA) and Adobe Photoshop 6.0 (Adobe Systems, San Jose, CA). GFP puncta and antibody-positive clusters were defined as clusters of fluorescence that were at least twice the background fluorescence of the image. Co-localization of GFP and synapsin-positive puncta was defined as having overlapping pixels. All immunocytochemical analysis was done blinded.

Electrophysiology

The recording chamber was continuously perfused at 5 ml/min with ECS composed of (in mM) 145 NaCl, 5 KCl, 1 MgCl2, 1 CaCl2, 5 HEPES, 5 glucose, 25 sucrose, 0.25 mg/l phenol red, and D-serine (5 µM) (all from Sigma) at pH adjusted to 7.4 with NaOH. All experiments were performed at room temperature (24 –26°C). The recording solution contained (in mM): 145 potassium gluconate, 10 HEPES, 5 ATP.Mg, 0.2 GTP.Na, and 10 BAPTA, adjusted to pH 7.2 with KOH. For recordings of GABA-elicited currents, we used a recording solution with KCl replacing potassium gluconate. Electrodes were pulled in two stages on a vertical pipette puller from borosilicate glass capillaries (Wiretrol II, Drummond, Broomall, PA). Pipette resistance ranged from 3 to 5 M{Omega}. NMDAR-mediated responses were pharmacologically isolated by BMI (50 µM, Sigma) and NBQX (5 µM, Tocris). NMDA mEPSCs and AMPA spontaneous EPSCs (sEPSCs) were recorded at –60 mV in Mg2+-free solution in the presence or absence of 1 µM TTX, respectively. Solutions and drugs were superfused through parallel inputs to the perfusion chamber or locally perfused by means of a Y tube (Murase et al. 1989Go). DIV7–8 cells were used (1–2 days after HEK293 cells were plated on CGCs). Whole cell recordings were performed with a patch-clamp amplifier (Axopatch 200, Axon Instrument, Foster City, CA). CGCs and HEK293 cells were voltage clamped at –60 mV, and access resistance was monitored throughout the recordings. Capacitance was assessed from the transient current in response to a 10 mV hyperpolarizing pulse. Currents were filtered at 1 kHz with an 8-pole low-pass Bessel filter (Frequency Devices, Haverhill, MA), digitized at 5–10 kHz using an IBM-compatible microcomputer equipped with Digidata 1200 data-acquisition board and pCLAMP9 software (both from Axon Instruments). Off-line data analysis, curve fitting, and figure preparation were performed with Clampfit 9 (Axon Instruments) software. Miniature synaptic currents were identified using a semi-automated mini detection software (Minianalysis, Synaptosoft, Decatur GA) with threshold criteria of 7.5 pA, three times greater than the RMS noise level and approximately equivalent to two overlapping channel openings. NMDA mEPSC averages were based on >=20 events in each cell studied. Fitting of the decay phase of currents recorded from HEK293 cells was performed using a simplex algorithm for least-squares exponential fitting routines. The decay times of averaged currents were derived from fitting to double exponential equations of the form I(t) = If x exp(–t/{tau}f) + Is x exp(–t/{tau}s), where If and Is are the amplitudes of the fast and slow decay components, and {tau}f and {tau}s are their respective decay time constants. To compare decay times between different subunit combinations we used a weighted mean decay time constant {tau}w = [If/(If + Is)] * {tau}f + [Is/(If + Is)] * {tau}s. All data values are expressed as means ± SE unless otherwise indicated. P values represent the ANOVA for multiple comparisons, with P < 0.05 as significance threshold.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 ACKNOWLEDGMENTS
 REFERENCES
 
To investigate functional synapse formation between neurons and HEK293 cells, we co-cultured CGCs with HEK293 cells transfected with NR1–1a/NR2A and neuroligin-GFP cDNAs. CGCs cultured in low-potassium medium form functional inhibitory and excitatory synapses (Chen et al. 2000Go; Losi et al. 2002Go) beginning at DIV6. We therefore selected this time point to plate the transfected HEK293 cells and tested for presence of synaptic current in these cells the day after. As illustrated in Fig. 1 both CGCs and the transfected HEK293 cells displayed paroxysmal currents in a Mg2+-free ECS. These currents were completely abolished by the NMDA antagonist CPP (10 µM, Fig. 1A). This indicates that these currents were due to CGC network excitation caused by waves of poorly synchronized synaptic input triggered by Mg2+ removal. After perfusion with TTX (0.5 µM), the paroxysmal currents in both HEK293 cells and CGCs were replaced by infrequent NMDA mEPSCs as shown in Fig. 1 (quantified in Fig. 3D). However, in HEK293 cells, the frequency of these currents was very low, being <20 events per 5 min. As a control, we tested for the occurrence of paroxysmal currents as well as the occurrence of NMDA-mEPSCs in co-cultured HEK293 cells lacking neuroligin and expressing only NR1–1a/NR2A and GFP. As illustrated in Fig. 1C, removal of Mg2+ led to the increase of the background noise sometime with a waving pattern. Paroxysmal currents were observed in only 1 of 29 neuroligin-lacking cells tested in three different sets of experiments (Fig. 1E). This number was dramatically increased in neuroligin-GFP transfected cells (15 of 32 cells in 4 experiments, Fig. 1E). As an additional control, we transfected HEK293 cells with the {alpha}1, {beta}3, and {gamma}2 subunits of GABAA receptor together with neuroligin-GFP. After plating these cells on CGCs we were able to record spontaneous inhibitory synaptic currents from CGCs, but not from HEK293 cells (n = 15). In transfected HEK293 cells, GABA (100 µM) applications elicited currents (Fig. 1D) indicating a successful expression of GABAA receptors.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 1. Neuroligin-GFP allows synapse formation in NR1–1a/NR2A transfected human embryonic kidney 293 HEK293 cells. A: representative recording from a HEK293 cell transfected with NR1–1a /NR2A and neuroligin(NLG)-GFP. On removal of Mg2+ (top). N-methyl-D-aspartate (NMDA) receptor-mediated paroxysmal currents produced by a large number of synaptic inputs from many cerebellar granule cells (CGCs) were recorded. In the presence of TTX (0.5 µM, bottom), miniature excitatory postsynaptic currents (mEPSCs) mediated by NMDA receptors (NMDA-mEPSCs) were recorded. B: paroxysmal currents recorded from cocultured CGCs on perfusion with Mg2+-free extracellular solution (ECS; top). NMDA-mEPSCs were then recorded in Mg2+-free ECS containing TTX (0.5 µM), BMI (20 µM), and 2,3-ihydro-6-nitro-7-sulfamoyl-benzo(F)quinoxaline (NBQX; 0.5 µM, bottom). Perfusion with CPP (10 µM) abolished all synaptic activity. C: a representative trace showing whole cell current produced when Mg2+ was removed locally in a control HEK293 cell transfected with NR1–1a /NR2A and GFP. D: example current elicited by GABA (100 µM) in a HEK293 cell transfected with the {alpha}1, {beta}3, and {gamma}2 subunits of GABAA receptor together with neuroligin-GFP. No spontaneous inhibitory synaptic currents were recorded in this cell. E: summary of percent HEK293 cells with detectable NMDA-mEPSCs transfected with NR1–1a/NR2A and neuroligin-GFP vs. NR1–1a /NR2A and GFP (n > 29 cells in 3 different experiments; * P < 0.05, ANOVA).

 


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 3. PSD-95gfp increases NMDA-mEPSCs frequency in HEK293 cells cotransfected with NR1–1a/NR2A and neuroligin-GFP. A: representative currents recorded from HEK293 cells transfected with NR1–1a /NR2A and neuroligin (NLG)-GFP and PSD-95gfp with ECS in the absence of Mg2+. B: frequent NMDA-mEPSCs were recorded in Mg2+-free ECS containing TTX. C: summary of percent HEK293 cells with detectable NMDA-mEPSCs for the different transfections (n > 19 cells in 3 different experiments), * P < 0.05, ANOVA with respect to PSD-95gfp transfection, ** P < 0.05, ANOVA with respect to neuroligin-GFP (NLG) transfection. D: summary of weighted decay time constant (Tw), peak amplitude (Peak) and frequency of occurrence in 5 min (freq/5 min) of NMDA-mEPSCs recorded from HEK293 cells transfected with neuroligin-GFP (NLG) as compared with HEK293 cells transfected with neuroligin-GFP and PSD-95gfp (NLG+PSD95). The frequency of NMDA-mEPSCs increased significantly in cells cotransfected with PSD-95gfp compared with those only transfected with NLG-gfp (means ± SE, n > 44 cells in 5 different experiments; * P < 0.05, ANOVA).

 

To study the reported interactions between neuroligin and PSD-95, we expressed GFP-tagged versions of these proteins in CGC/HEK293 co-cultures. In Fig. 2, we illustrate examples of these co-cultures with differential interference Nomarski contrast (DIC) and with fluorescence microscopy. Neuroligin-GFP tends to outline the apparent edge of the cell, suggesting a plasma membrane localization, sometimes with elongated thickening of fluorescence intensity but not well-defined small circular clusters (Fig. 2A). Consistent with previous reports, neuroligin caused morphological changes in HEK293 cells such as membrane ruffling and filopodial sprouting (Scheiffele et al. 2000Go). Co-transfection of neuroligin wild-type with PSD-95gfp led to appearance of distinct puncta of fluorescence in HEK293 cells (Fig. 2B). In three sets of experiments, 89 ± 9% of HEK293 cells displayed the fluorescent puncta (n = 40 cells) in contrast to 8 ± 7% of HEK293 cells transfected with PSD-95gfp alone (n = 34 cells). Transfection with wild-type PSD-95 and neuroligin-GFP did not lead to well defined cluster formation (n = 36 cells in 3 experiments). Co-transfection of neuroligin wild-type and a construct with mutation of Nterminus cysteines into serines in PSD-95 that prevents the palmitoylation of the protein (PSD-95gfpC3,5S) (Craven et al. 1999Go) also did not result in the formation of fluorescence puncta (Fig. 2C, n = 28 cells in 4 experiments). These data taken together suggest that the fluorescent puncta observed are due to neuroligin-induced PSD-95gfp clustering, although the two proteins do not display the same expression pattern.



View larger version (168K):
[in this window]
[in a new window]
 
FIG. 2. Neuroligin induces clusters of postsynaptic density-95/synapse-associated protein-90 (PSD-95) in transfected HEK293 cells co-cultured with CGCs. DIC microphotographs illustrating examples of CGCs/HEK293 cells co-cultures (left). In the right, GFP fluorescence from cells shown on the left transfected with neuroligin-GFP (NLG-gfp, A), with neuroligin wild-type and PSD95-gfp (PSD-95gfp, B) and neuroligin wild-type and PSD-95gfpC3,5S (PSD-95gfpC3,5S, C). Cotransfection of neuroligin-GFP and PSD95-wild-type was not different from transfection of neuroligin-GFP alone. Boxed regions in (right) are shown magnified in insets. Calibration bars: 20 µm and 6 µm for the insets.

 

Figure 3, A and B, illustrates examples of currents recorded from one of the HEK293 cells co-transfected with neuroligin-GFP/PSD-95gfp and NR1–1a/NR2A cDNAs. The percent of cells displaying paroxysmal currents and NMDA-mEPSCs in Mg2+-free ECS was higher compared with cells lacking PSD-95gfp (Fig. 3C). The frequency of NMDA-mEPSCs increased by 220% with PSD-95gfp expression (Fig. 3D). The amplitude of NMDA-mEPSCs, however, was not significantly different between cells transfected with neuroligin-GFP and neuroligin-GFP/PSD-95gfp (Fig. 3D). Co-transfection of NR1–1a/NR2A, neuroligin-GFP and PSD-95gfpC3,5S did not significantly increase the percent of cells displaying NMDA currents (Fig. 3C).

Currents recorded from one of the HEK293 cells cotransfected with neuroligin-GFP/PSD-95gfp and NR1–1a/NR2B cDNAs are illustrated in Fig. 4, A and B. The percent of cells displaying paroxysmal currents and NMDA-mEPSCs on removal of Mg2+ was not significantly different from NR1–1a/NR2A transfected cells. In Fig. 4C, averages of 20 NMDA-mEPSCs are compared between cells transfected with neuroligin-GFP/PSD-95gfp and NR1–1a/NR2A or NR1–1a/NR2B. The weighted decay time constant was remarkably slower for cells expressing the NR1–1a/NR2B subunit as reported with rapid agonist applications (Vicini et al. 1998Go). The averages of both the amplitude and the decay time constant were significantly different between the two groups (Fig. 4D).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4. NMDA-mEPSCs decay is slower in HEK293 cells expressing NR2B than NR2A subunit. A. Currents recorded in the absence of Mg2+ from HEK293 cells transfected with NR1–1a /NR2B, PSD-95gfp, and NLG-gfp. B: NMDA-mEPSCs were recorded in the same cell after perfusion with ECS containing TTX in the absence of Mg2+. C: comparison of NMDA-mEPSCs averages with superimposed double exponential fitting and indication of resulting weighted time constant (Tw) of decay for NR1–1a/NR2A (left) and NR1–1a/NR2B (right) transfected HEK293 cells. D: summary of Tw (ms) from HEK293 cells transfected with NR1–1a/NR2A (n = 26) vs. NR1–1a/NR2B (n = 15; * P < 0.05, ANOVA). All cells were co-transfected with PSD-95gfp and NLGgfp.

 

NMDA-mEPSCs recorded in transfected HEK293 cells suggested synapse formation. However, given the high sensitivity of NMDARs to glutamate it is possible that presynaptic terminal and postsynaptic receptors in such synapses are not precisely aligned and synaptic currents may be generated by spillover from synapses on neighboring CGCs. AMPA receptors are less sensitive to glutamate and thus require a close apposition of the release site (Gasparini et al. 2000Go). To assess the alignment of pre- and postsynaptic sites, we transfected HEK293 cells with the GluRDflip subunit of AMPA receptors together with neuroligin-GFP and PSD-95gfp (Fig. 5). Recombinant AMPA receptors containing this subunit have very fast desensitization, and neurons expressing GluRDflip have been reported to produce very fast decaying synaptic events (Dingledine et al. 1999Go). In 25 of 39 cells in four separate experiments, we detected the occurrence of sEPSCs mediated by recombinant AMPA receptor (Fig. 5), suggesting a good alignment between pre- and postsynaptic sites. In 3 of 12 cells cotransfected with GluRDflip and PSD-95gfp and in 1 of 11 cells transfected with GFP we could only record AMPA-sEPSCs in the presence of cyclothiazide (50 µM), a compound that enhances glutamate release and removes AMPA receptor desensitization (Diamond and Jahr 1995Go; Ishikawa and Takahashi 2001Go; Yamada and Tang 1993Go;). This indicates that poor alignment of synapses or glutamate spillover from neighbor synapses does occur in a minority of cells in the absence of neuroligin. We also investigated the amplitude distribution of mEPSCs in one transfected HEK293 cell. As seen in Fig. 5D, this distribution was skewed to the left, similarly to what is observed in neurons (Frerking et al. 1997Go). This suggests that postsynaptic receptor clustering is regulated similarly in neurons and transfected HEK293 cells with a larger abundance of clusters with small number of receptors giving rise to smaller synaptic currents.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 5. Synapse formation in HEK293 cells expressing GluRDflip with NLG-gfp and PSD-95gfp. A: currents recorded in the absence of Mg2+ from HEK293 cells transfected with GluRDflip, PSD-95gfp, and NLG-gfp. B: high-frequency sEPSCs were recorded in the same cell after some time with perfusion with ECS in the absence of Mg2+. C: sEPSCs average (15 events) with superimposed single exponential fitting and indication of resulting decay time constant (T). D: histogram distribution of amplitude of sEPSCs recorded from the cell illustrated in A–C (n = 356 events). E: summary of decay time constant (T), peak amplitude (Peak), and frequency of occurrence (Freq) of sEPSCs recorded from HEK293 cells transfected with GluRDflip, NLG-gfp, andPSD-95gfp (n > 25 cells in 4 different experiments).

 

To further investigate the alignment between pre- and postsynaptic sites in CGC-HEK293 cell cultures, we performed immunocytochemical staining with antibodies against the presynaptic marker synapsin 1 (Fig. 6). Synapsin1 has been shown to accumulate at newly formed contact sites in similar experiments (Scheiffele et al. 2000Go). The percentage of PSD-95gfp puncta colocalized with synapsin significantly increased from 17 ± 3% (n = 10 cells) to 56 ± 6% (n = 13 cells, P < 0.05 ANOVA) when cells were cotransfected with neuroligin supporting the alignment between pre- and postsynaptic sites.



View larger version (70K):
[in this window]
[in a new window]
 
FIG. 6. Neuroligin increases co-localization of PSD-95gfp with synapsin. Immunostaining with antisynapsin 1 antibodies (Cy3 secondary Ab) of CGCs and HEK293 cells co-cultures. HEK293 cells were transfected with PSD95-gfp with (B) or without (A) neuroligin. Lower panels show overlays. Calibration bar: 4 µm.

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 ACKNOWLEDGMENTS
 REFERENCES
 
We demonstrated with voltage-clamp recordings the formation of functional excitatory synapses between CGCs and HEK293 cells expressing glutamate receptors. Electrophysiological studies of recombinant ligand-gated ion channels mediating synaptic transmission expressed in heterologous systems have greatly contributed in the last 20 years to the understanding of the molecular determinants of postsynaptic receptors. Our results on the reconstitution of functional synapses on HEK293 cells are a step forward that will allow insights into the molecular mechanisms underlying synaptic function in the CNS.

Expression of neuroligin greatly facilitated the formation of functional excitatory synapses between neurons and heterologous cells as previously reported (Dean et al. 2003Go; Schieffele et al. 2000). Spontaneous paroxysmal currents and NMDA-mEPSCs recorded from neuroligin-transfected HEK293 cells were likely due to the vesicular release from contacting axons of the CGCs. Arguing against neuroligin-mediated synaptic connection between CGCs and HEK293 cells, however, one can hypothesize random contact of the presynaptic axons/growth cones with HEK293 cells, which could have allowed us to record synaptic events. In addition, large axonal plexuses reported in CGC cultures (Leao and Randall 2000) may cause spillover onto the neighboring HEK293 cells likewise eliciting synaptic currents. Waves of NMDAR activation were indeed observed in control cells transfected only with GFP and the NMDAR subunits indicating the occurrence of spillover. However, in only a few of these cells did we observe better defined synaptic events, as opposed to the presence of such events in half the cells expressing neuroligin. These results imply that neuroligin is at least greatly facilitating the molecular recognition between growing excitatory axons and their postsynaptic target. Independent support of our results comes from studies showing that neuroligin-1 is concentrated at the postsynaptic side of glutamatergic but not GABAergic synapses (Song et al. 1999Go). Indeed, after co-transfection of GABAA receptor subunits with neuroligin, we failed to detect formation of GABAergic synapses in HEK293/CGC co-culture. We speculate that our model will be useful for testing putative proteins involved in the formation of inhibitory synapses and determining their roles.

It has been suggested that the neurexin–neuroligin interaction may also mediate postsynaptic differentiation (Rao et al. 2000Go). Indeed, neuroligin C-terminus binds two major scaffolding molecules, PSD-95 and S-SCAM, that link neuroligins to NMDA receptors and downstream signal-transducing proteins (Hirao et al. 1998Go, 2000Go; Irie et a1. 1997Go). Neuroligin also induces morphological changes in HEK293 cells (Scheiffele et al. 2000Go) suggestive of an action on the actin cytoskeleton possibly mediated by Rho GTPase (Cantallops and Cline 2000Go; Van Aelst and D'Souza-Schorey 1997Go). Similarly, morphological differentiation of presynaptic components and neurexin clustering by neuroligin has been recently demonstrated in both CGCs and hippocampal neurons (Dean et al. 2003Go; Missler et al. 2003Go). In addition, Irie et a1. (1997Go) demonstrated that membrane redistribution of PSD-95 can be induced by neuroligin 1 or the NR2A subunit in transfected cells. Our results indicate that clusters of PSD-95gfp can be observed in the transfected CGCs/HEK293 co-cultures. These clusters are likely morphological correlates of functional synapse formation as PSD-95 (but not PSD-95C3,5S) increases the number of cells displaying synaptic events and increases the frequency of NMDA-mEPSCs. This supports the reported evidence that the major role of PSD-95 is to allow the maturation of the synapse (El Husseini et al. 2000Go). We speculate that the interaction of PSD-95 with neuroligin is sufficient and perhaps necessary to allow for the formation of synapses that are electrophysiologically indistinguishable from mature neuronal synapses.

Immunocytochemical staining with synapsin specific antibodies demonstrated that neuroligin facilitates the juxtaposition of the postsynaptic PSD-95 clusters on HEK293 cells and the presynaptic axon terminals of the contacting CGCs. Similarly to currents recorded in neurons, the occurrence of fast synaptic currents in HEK293 cells transfected with an AMPA receptor subunit supports the morphological evidence of pre- and postsynaptic juxtaposition. Taken together these data support the suggestion of the neurexin–neuroligin link as a signaling device triggered by initial contact that leads to functional synapses (Rao et al. 2000Go).

Because the contribution of glutamate receptor subtypes to shape the postsynaptic current characteristics is a fundamental question (Cull-Candy et al. 2001Go; Dingledine et al. 1999Go), verifying the role of subunit heterogeneity by using defined subunit compositions is of the utmost importance. Ultra-rapid application to patches excised from HEK293 cells expressing NMDA receptors (Lester and Jahr 1992Go; Vicini et al. 1998Go) has demonstrated unique deactivation kinetics of distinct subtypes of NMDA receptors. The data presented here on the distinct decay kinetics between cells transfected with NR1–1a/NR2A and NR1–1a/NR2B are in line with these findings. A similar approach will allow the study of synaptic activation of several distinct AMPA and NMDA receptor subtypes. The results we obtained with sEPSCs in GluRDflip-transfected cells indicate that very fast decaying synaptic events can be recorded when this subunit of AMPA receptor is expressed at postsynaptic sites as seen in single cell PCR studies of neurons expressing this subunit (Dingledine et al. 1999Go for review).

Our work extends previous studies that had shown only morphological evidence for synapses between neuronal and nonneuronal cells expressing neuroligin and provides a unique model for studying the molecular elements required for synapse formation and function.


    DISCLOSURES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 ACKNOWLEDGMENTS
 REFERENCES
 
This work was supported by National Institutes of Health Grants NS-47700 and MH-01680 to S. Vicini. P. Washbourne is a M.I.N.D. Institute Scholar.


    ACKNOWLEDGMENTS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 ACKNOWLEDGMENTS
 REFERENCES
 
We are grateful to Drs. David Bredt, Paul Whiting, Peter Seeburg, and Anne Stephenson for the gifts of the PSD-95gfp, GABAA receptor subunits, GluRD flip, NR2A-flag and NR2B-flag constructs, respectively.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Address for reprint requests and other correspondence: S. Vicini, Dept. of Physiology and Biophysics, Georgetown University School of Medicine, 3900 Reservoir Rd., Washington, DC 20007 (E-mail: svicin01{at}georgetown.edu).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 ACKNOWLEDGMENTS
 REFERENCES
 
Beique JC and Andrade R. PSD-95 regulates synaptic transmission and plasticity in rat cerebral cortex. J Physiol 546: 859–867, 2003.[Abstract/Free Full Text]

Cantallops I and Cline HT. Synapse formation: if it looks like a duck and quacks like a duck. Curr Biol 10: 620–623, 2000.

Chavis P and Westbrook G. Integrins mediate functional pre-and postsynaptic maturation at a hippocampal synapse. Nature 411: 317–321, 2001.[Medline]

Chen L, Chetkovich DM, Petralia RS, Sweeney NT, Kawasaki Y, Wenthold RJ, Bredt DS, and Nicoll RA. Stargazing regulates synaptic targeting of AMPA receptors by two distinct mechanisms. Nature 408: 936–493, 2000.[Medline]

Choi S, Klingauf J, and Tsien RW. Postfusional regulation of cleft glutamate concentration during LTP at "silent synapses." Nat Neurosci 3: 330–336, 2000.[Web of Science][Medline]

Craven SE, El-Husseini AE, and Bredt DS. Synaptic targeting of the postsynaptic density protein PSD-95 mediated by lipid and protein motifs. Neuron 22: 497–509, 1999.[Web of Science][Medline]

Cull-Candy S, Brickley S, and Farrant M. NMDA receptor subunits: diversity, development, and disease. Curr Opin Neurobiol 1: 327–335, 2001.

Dean C, Scholl FG, Choih J, DeMaria S, Berger J, Isacoff E, and Scheiffele P. Neurexin mediates the assembly of presynaptic terminals. Nat Neurosci 6: 708–716, 2003.[Web of Science][Medline]

Diamond JS and Jahr CE. Asynchronous release of synaptic vesicles determines the time course of the AMPA receptor-mediated EPSC. Neuron 15: 1097–1107, 1995.[Web of Science][Medline]

Dingledine R, Borges K, Bowie D, and Traynelis SF. The glutamate receptor ion channels. Pharmacol Rev 51: 7–61, 1999.[Abstract/Free Full Text]

El-Husseini AE, Schnell E, Chetkovich DM, Nicoll RA, and Bredt DS. PSD-95 involvement in maturation of excitatory synapses. Science 290: 1364–1368, 2000.[Abstract/Free Full Text]

Frerking M, Borges S, and Wilson M. Are some minis multiquantal? J Neurophysiol 78: 1293–12304, 1997.[Abstract/Free Full Text]

Fukaya M and Watanabe M. Improved immunohistochemical detection of postsynaptically located PSD-95/SAP90 protein family by protease section pretreatment: a study in the adult mouse brain. J Comp Neurol 426: 572–586, 2000.[Web of Science][Medline]

Fukaya M, Ueda H, Yamauchi K, Inoue Y, and Watanabe M. Distinct spatiotemporal expression of mRNAs for the PSD-95/SAP90 protein family in the mouse brain. Neurosci Res 33: 111–118, 1999.[Web of Science][Medline]

Gallo V, Kingsbury A, Balazs R, and Jorgensen OS. The role of depolarization in the survival and differentiation of cerebellar granule cells in culture. J Neurosci 7: 2203–2213, 1987.[Abstract]

Garner CC, Nash J, and Huganir RL. PDZ domains in synapse assembly and signaling. Trends Cell Biol 10: 274–280, 2000.[Web of Science][Medline]

Gasparini S, Saviane C, Voronin LL, and Cherubini E. Silent synapses in the developing hippocampus: lack of functional AMPA receptors or low probability of glutamate release? Proc Natl Acad Sci USA 97: 9741–9746, 2000.[Abstract/Free Full Text]

Hawkins LM, Chazot PL, and Stephenson FA. Biochemical evidence for the co-association of three N-methyl-D-aspartate (NMDA) R2 subunits in recombinant NMDA receptors. J Biol Chem 274: 27211–27218, 1999.[Abstract/Free Full Text]

Hirao K, Hata Y, Ide N, Takeuchi M, Irie M, Yao I, Deguchi M, Toyoda A, Südhof TC, and Takai Y. A novel multiple PDZ domain-containing molecule interacting with N-methyl-D-aspartate receptors and neuronal cell adhesion proteins. J Biol Chem 73: 21105–21110, 1998.

Hirao K, Hata Y, Yao I, Deguchi M, Kawabe H, Mizoguchi A, and Takai Y. Three isoforms of synaptic scaffolding molecule and their characterization. Multimerization between the isoforms and their interaction with N-methyl-D-aspartate receptors and SAP90/PSD-95-associated protein. J Biol Chem 275: 2966–2972, 2000.[Abstract/Free Full Text]

Hunt CA, Schenker LJ, and Kennedy MB. PSD-95 is associated with the postsynaptic density and not with the presynaptic membrane at forebrain synapses. J Neurosci 16: 1380–1388, 1996.[Abstract/Free Full Text]

Ichtchenko K, Hata Y, Nguyen T, Ullrich B, Moomaw C, and Sudhof TC. Neuroligin 1: a splice site-specific ligand for beta-neurexins. Cell 81: 435–443, 1990.

Ichtchenko K, Nguyen T, and Südhof TC. Structures, alternative splicing, and neurexin binding of multiple neuroligins. J Biol Chem 271: 2676–2682, 1996.[Abstract/Free Full Text]

Irie M, Hata Y, Takeuchi M, Ichtchenko K, Toyoda A, Hirao K, Takai Y, Rosahl TW, and Südhof TC. Binding of neuroligins to PSD-95. Science 277: 1511–1515, 1997.[Abstract/Free Full Text]

Ishikawa T and Takahashi T. Mechanisms underlying presynaptic facilitatory effect of cyclothiazide at the calyx of Held of juvenile rats. J Physiol 533: 423–31, 2001.[Abstract/Free Full Text]

Kennedy MB. Signal transduction molecules at the glutamatergic postsynaptic membrane. Brain Res Rev 26: 243–257, 1998.[Medline]

Kornau HC, Seeburg PH, and Kennedy MB. Interaction of ion channels and receptors with PDZ domain proteins. Curr Opin Neurobiol 7: 368–373, 1997.[Web of Science][Medline]

Leao RM, Mellor JR, and Randall AD. Tonic benzodiazepine-sensitive GABAergic inhibition in cultured rodent cerebellar granule cells. Neuropharmacology 39: 990–1003, 2000.[Web of Science][Medline]

Lester RA and Jahr CE. NMDA channel behavior depends on agonist affinity. J Neurosci 12: 635–643, 1992.[Abstract]

Losi G, Prybylowski K, Fu Z, Luo JH, and Vicini S. Evidence of silent synapses in cerebellar granule cells. J Neurophysiol 87: 1263–1270, 2002.[Abstract/Free Full Text]

Losi G, Prybylowski K, Fu Z, Luo J, Wenthold RJ, and Vicini S. PSD-95 regulates NMDA receptors in developing cerebellar granule neurons of the rat. J Physiol 548: 21–29, 2003.[Abstract/Free Full Text]

McIlhinney RA, Le Bourdelles B, Molnar E, Tricaud N, Streit P, and Whiting PJ. Assembly, intracellular targeting, and cell surface expression of the human N-methyl-D-aspartate receptor subunits NR1a and NR2A in transfected cells. Neuropharmacology 37: 1355–1367, 1998.[Web of Science][Medline]

Mellor JR, Merlo D, Jones A, Wisden W, and Randall AD. Mouse cerebellar granule cell differentiation: electrical activity regulates the GABAA receptor {alpha}6 subunit gene. J Neurosci 18: 2822–2833, 1998.[Abstract/Free Full Text]

Missler M, Zhang W, Rohlmann A, Kattenstroth G, Hammer RE, Gottmann K, and Sudhof TC. {alpha}-Neurexins couple Ca2+ channels to synaptic vesicle exocytosis. Nature 423: 939–948, 2003.[Medline]

Monyer H, Burnashev H, Laurie DJ, Sakmann B, and Seeburg PH. Developmental and regional expression in the rat brain and functional properties of the four NMDA receptors. Neuron 12: 529–540, 1994.[Web of Science][Medline]

Murase K, Ryu PD, and Randic M. Excitatory and inhibitory amino acids and peptide-induced responses in acutely isolated rat spinal dorsal horn neurons. Neurosci Lett 103: 56–63, 1989.[Web of Science][Medline]

Nguyen T and Sudhof TC. Binding properties of neuroligin 1 and neurexin 1 beta reveal function as heterophilic cell adhesion molecules. J Biol Chem 272: 6032–26039, 1997.

Prybylowski K, Fu Z, Losi G, Hawkins LM, Luo J, Chang K, Wenthold RJ, and Vicini S. Relationship between availability of NMDA receptor subunits and their expression at the synapse. J Neurosci 22: 8902–8910, 2002.[Abstract/Free Full Text]

Rao A, Harms KJ, and Craig AM. Neuroligation: building synapses around the neurexin-neuroligin link. Nat Neurosci 3: 747–749, 2000.[Web of Science][Medline]

Renger JJ, Egles C, and Liu G. A developmental switch in neurotransmitter flux enhances synaptic efficacy by affecting AMPA receptor activation. Neuron 29: 469–484, 2001.[Web of Science][Medline]

Sans N, Petralia RS, Wang YX, Blahos J 2nd, Hell JW, and Wenthold RJ. A developmental change in NMDA receptor-associated proteins at hippocampal synapses. J Neurosci 20: 1260–1271, 2000.[Abstract/Free Full Text]

Scheiffele P, Fan J, Choih J, Fetter R, and Serafini T. Neuroligin expressed in nonneuronal cells triggers presynaptic development in contacting axons. Cell 101: 657–669, 2000.[Web of Science][Medline]

Schnell E, Sizemore M, Karimzadegan S, Chen L, Bredt DS, and Nicoll RA. Direct interactions between PSD-95 and stargazin control synaptic AMPA receptor number. Proc Natl Acad Sci USA 99: 13902–13907, 2002.[Abstract/Free Full Text]

Song JY, Ichtchenko K, Südhof TC, and Brose N. Neuroligin 1 is a postsynaptic cell-adhesion molecule of excitatory synapses. Proc Natl Acad Sci USA 96: 1100–1105, 1999.[Abstract/Free Full Text]

Townsend M, Yoshii A, Mishina M, and Constantine-Paton M. Developmental loss of miniature N-methyl-D-aspartate receptor currents in NR2A knockout mice. Proc Natl Acad Sci USA 100: 1340–1345, 2003.[Abstract/Free Full Text]

Ushkaryov YA, Petrenko AG, Geppert M, and Sudhof TC. Neurexins: synaptic cell surface proteins related to the alpha-latrotoxin receptor and laminin. Science 257: 50–56, 1992.[Abstract/Free Full Text]

Ullrich B, Ushkaryov YA, and Südhof TC. Cartography of neurexins: more than 1000 isoforms generated by alternative splicing and expressed in distinct subsets of neurons. Neuron 14: 497–507, 1995.[Web of Science][Medline]

Van Aelst L and D'Souza-Schorey C. Rho GTPases and signaling networks. Genes Dev 11: 2295–2322, 1997.[Free Full Text]

Vicini S, Wang JF, Li JH, Zhu WJ, Wang YH, Luo JH, Wolfe BB, and Grayson DR. Functional and pharmacological differences between recombinant N-methyl-D-aspartate receptors. J Neurophysiol 79: 555–566, 1998.[Abstract/Free Full Text]

Virginio C, Martina M, and Cherubini E. Spontaneous GABA-mediated synaptic currents in cerebellar granule cells in culture. Neuroreport 6: 1285–1289, 1995.[Web of Science][Medline]

Yamada KA and Tang CM. Benzothiadiazides inhibit rapid glutamate receptor desensitization and enhance glutamatergic synaptic currents. J Neurosci 13: 3904–3915, 1993.[Abstract]

Ziff EB. Enlightening the postsynaptic density. Neuron 19: 1163–1174, 1997.[Web of Science][Medline]




This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Kuroyanagi, M. Yokoyama, and T. Hirano
Postsynaptic glutamate receptor {delta} family contributes to presynaptic terminal differentiation and establishment of synaptic transmission
PNAS, March 24, 2009; 106(12): 4912 - 4916.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Heine, O. Thoumine, M. Mondin, B. Tessier, G. Giannone, and D. Choquet
Activity-independent and subunit-specific recruitment of functional AMPA receptors at neurexin/neuroligin contacts
PNAS, December 30, 2008; 105(52): 20947 - 20952.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Kang, X. Zhang, F. Dobie, H. Wu, and A. M. Craig
Induction of GABAergic Postsynaptic Differentiation by {alpha}-Neurexins
J. Biol. Chem., January 25, 2008; 283(4): 2323 - 2334.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
K. Gerrow and A. El-Husseini
Receptors Look Outward: Revealing Signals That Bring Excitation to Synapses
Sci. Signal., October 16, 2007; 2007(408): pe56 - pe56.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. A. Chubykin, X. Liu, D. Comoletti, I. Tsigelny, P. Taylor, and T. C. Sudhof
Dissection of Synapse Induction by Neuroligins: EFFECT OF A NEUROLIGIN MUTATION ASSOCIATED WITH AUTISM
J. Biol. Chem., June 10, 2005; 280(23): 22365 - 22374.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
B. Chih, H. Engelman, and P. Scheiffele
Control of Excitatory and Inhibitory Synapse Formation by Neuroligins
Science, February 25, 2005; 307(5713): 1324 - 1328.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Y. Sara, T. Biederer, D. Atasoy, A. Chubykin, M. G. Mozhayeva, T. C. Sudhof, and E. T. Kavalali
Selective Capability of SynCAM and Neuroligin for Functional Synapse Assembly
J. Neurosci., January 5, 2005; 25(1): 260 - 270.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
P. Washbourne, A. Dityatev, P. Scheiffele, T. Biederer, J. A. Weiner, K. S. Christopherson, and A. El-Husseini
Cell Adhesion Molecules in Synapse Formation
J. Neurosci., October 20, 2004; 24(42): 9244 - 9249.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
P. Washbourne, X.-B. Liu, E. G. Jones, and A. K. McAllister
Cycling of NMDA Receptors during Trafficking in Neurons before Synapse Formation
J. Neurosci., September 22, 2004; 24(38): 8253 - 8264.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
O. Prange, T. P. Wong, K. Gerrow, Y. T. Wang, and A. El-Husseini
A balance between excitatory and inhibitory synapses is controlled by PSD-95 and neuroligin
PNAS, September 21, 2004; 101(38): 13915 - 13920.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
D. Comoletti, A. De Jaco, L. L. Jennings, R. E. Flynn, G. Gaietta, I. Tsigelny, M. H. Ellisman, and P. Taylor
The Arg451Cys-Neuroligin-3 Mutation Associated with Autism Reveals a Defect in Protein Processing
J. Neurosci., May 19, 2004; 24(20): 4889 - 4893.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/6/3950    most recent
00647.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fu, Z.
Right arrow Articles by Vicini, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fu, Z.
Right arrow Articles by Vicini, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the The American Physiological Society.