JN Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Neurophysiol 92: 3085-3096, 2004. First published June 22, 2004; doi:10.1152/jn.00349.2004
0022-3077/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
92/5/3085    most recent
00349.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heinbockel, T.
Right arrow Articles by Ennis, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heinbockel, T.
Right arrow Articles by Ennis, M.

Regulation of Main Olfactory Bulb Mitral Cell Excitability by Metabotropic Glutamate Receptor mGluR1

Thomas Heinbockel1,2, Philip Heyward3, François Conquet4 and Matthew Ennis5

1Department of Physiology and Program in Neuroscience, University of Maryland School of Medicine, Baltimore, Maryland 21201; 2Department of Anatomy, Howard University College of Medicine, Washington DC 20059; 3Department of Physiology, University of Otago, Dunedin, 9001 New Zealand; 4GlaxoSmithKline Experimental Research, Institut de Biologie Cellulaire et de Morphologic, 1228 Lausanne, Switzerland; and 5Department of Anatomy and Neurobiology, University of Tennessee Health Science Center, Memphis, Tennessee 38163

Submitted 5 April 2004; accepted in final form 21 June 2004


 ABSTRACT
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
In the rodent main olfactory bulb (MOB), mitral cells (MCs) express high levels of the group I metabotropic glutamate receptor (mGluR) subtype, mGluR1. The significance of this receptor in modulating MC excitability is unknown. We investigated the physiological role of mGluR1 in regulating MC activity in rat and mouse MOB slices. The selective group I agonist (RS)-3,5-dihydroxyphenylglycine (DHPG), but not group II or III agonists, induced potent, dose-dependent, and reversible depolarization and increased firing of MCs. These effects persisted in the presence of blockers of fast synaptic transmission, indicating that they are due to direct activation of mGluRs on MCs. Voltage-clamp recordings showed that DHPG elicited a voltage-dependent inward current consisting of multiple components sensitive to potassium and calcium channel blockade and intracellular calcium chelation. MC excitatory responses to DHPG were absent in mGluR1 knockout mice but persisted in mGluR5 knockout mice. Broad-spectrum LY341495, MCPG, as well as preferential mGluR1 LY367385 antagonists blocked the excitatory effects of DHPG and also potently modulated MC spontaneous and olfactory nerve-evoked excitability. mGluR antagonists altered spontaneous membrane potential bistability, increasing the duration of the up and down states. mGluR antagonists also substantially attenuated MC responses to sensory input, decreasing the probability and increasing the latency of olfactory nerve-evoked spikes. These findings suggest that endogenous glutamate tonically modulates MC excitability and responsiveness to olfactory nerve input, and hence the operation of the MOB circuitry, via activation of mGluR1.


 INTRODUCTION
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
Sensory transmission from olfactory nerve terminals to the principal projection neurons of the main olfactory bulb (MOB), mitral and tufted cells (MCs/TCs), is mediated by glutamate acting at AMPA and N-methyl-D-aspartate (NMDA) ionotropic glutamate receptor subtypes (Aroniadou-Anderjaska et al. 1997Go; Bardoni et al. 1996Go; Chen and Shepherd 1997Go; Ennis et al. 1996Go, 2001Go; Keller et al. 1998Go). MCs/TCs are also glutamatergic. Glutamate released from MCs/TCs, acting at both ionotropic receptor subtypes, mediates dendrodendritic transmission at synapses with juxtaglomerular and granule cell interneurons (Aroniadou-Anderjaska et al. 1999aGo; Bardoni et al. 1996Go; Isaacson and Strowbridge 1998Go; Schoppa et al. 1998Go). Recent electrophysiological studies suggest that ionotropic glutamate receptors mediate recurrent excitatory interactions among apical and lateral dendrites of MCs/TCs (Aroniadou-Anderjaska et al. 1999bGo; Carlson et al. 2000Go; Isaacson 1999Go; Salin et al. 2001Go; Schoppa and Westbrook 2001Go).

Neuroanatomical studies demonstrate that MCs/TCs and other neuronal subtypes in the MOB express high levels of metabotropic glutamate receptors (mGluRs), suggesting that they play an important role(s) in olfactory processing. The eight mGluRs identified to date are subdivided into three groups based on sequence homology, signal transduction mechanisms, and pharmacology (Conn and Pin 1997Go): group I mGluRs (mGluR1, mGluR5), group II mGluRs (mGluR2, mGluR3), and group III mGluRs (mGluR4, mGluR6-8). MCs/TCs express high levels of mGluR1 (Martin et al. 1992Go; Masu et al. 1991Go; Sahara et al. 2001Go; Shigemoto et al. 1992Go; van den Pol 1995Go). Electron microscopy studies demonstrated that mGluR1 is present on the somata and apical and lateral dendrites of MCs/TCs (van den Pol 1995Go). This expression pattern suggests that mGluR1 could mediate MC/TC responses to glutamatergic inputs from olfactory nerve terminals and/or could function as auto- or heteroreceptors for glutamate released from apical or lateral dendrites of MCs/TCs. MCs/TCs also express mRNA for mGluR7 and mGluR8 (Kinzie et al. 1995Go; Saugstad et al. 1997Go), although immunocytochemical studies indicate that these receptors are present on their axon terminals in the granule cell layer and in piriform cortex (Kinoshita et al. 1998Go; Wada et al. 1998Go).

There is limited information about the physiological actions and function of group I mGluRs on either MCs or TCs. Studies in dissociated cultured rat and frog MOB neuronal preparations reported that activation of group I mGluRs increased Ca2+ release from internal stores in MCs and bulb interneurons (Carlson et al. 1997Go; Geiling and Schild 1996Go) or depolarized MCs and increased the frequency of miniature excitatory postsynaptic currents (Schoppa and Westbrook 1997Go). The function(s) of group I mGluRs on MCs in the MOB network has not been investigated. The goal of the present study therefore was to investigate the actions of group I mGluRs on MC excitability and responsiveness to sensory input from olfactory nerve terminals. To address these issues, we studied the functional consequences of activation or blockade of mGluRs on MCs using whole cell patch-clamp recording in MOB slices from rats, wild-type mice, and mice with targeted gene deletions of group I mGluRs. Parts of this study have been published in abstract form (Heinbockel and Ennis 2002Go; Heinbockel et al. 2001a, bGo).


 METHODS
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
Animals and genotyping

Animal experimentation and usage was in accordance with guidelines of the University of Maryland Institutional Animal Care and Use Committee and the National Institutes of Health. Experimental animals were commercially available male and female rats (Sprague-Dawley; Zivic Laboratories, Zelienople, PA) and mice (C57Bl/6J, Jackson Laboratory, Bar Harbor, ME) and mGluR1 and mGluR5 mutant mice from our colony. Breeder stock of the mGluR1 and mGluR5 mutant mice (C57Bl/6J background) were provided by F. Conquet; the generation of mGluR1 and mGluR5 receptor knockout mice has been reported previously (Chiamulera et al. 2001Go; Conquet et al. 1994Go). mGluR5 mice were provided as a homozygous mutant line. mGluR1 mice, generated as a lacZ knock-in, were maintained by heterozygous mating and were genotyped by polymerase chain reaction (PCR) of DNA from tail tip digests. Homozygous mGluR1 mutant mice were also identified phenotypically by their characteristic progressive mobility deficit at several weeks of age (Conquet et al. 1994Go). For PCR genotyping, tail tips were digested at 56°C in 20 µl proteinase K (1 µg/µl) in 48 mM Tris-HCl pH 8.0, 11 mM NaCl, 0.5 mM NaEDTA, and 0.5% sodium dodecylsulfate until tips were completely dissolved (1–2 h). Sterile water (780 µl) was added to each digest, and the samples were heated at 95°C for 20 min to inactivate the proteinase K. Each PCR sample (25 µl) contained 1 µl DNA digest in 1x PCR buffer, 1.5 mM MgCl2, 0.2 mM each dTTP, dCTP, dATP, and dGTP, and 0.625 U Taq polymerase. The oligonucleotide primers were 20 pmol/25 µl. The thermocycler program was initiated by a 1-min denaturation step at 94°C followed by 39 amplification cycles: 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 10 min. The reaction products were separated by electrophoresis on 1.6% agarose gels, and the amplicons were visualized with ethidium bromide under UV illumination. The oligonucleotides for the neomycin resistance gene were 5' GTGAATGAACTGCAGGACGA and 5' ATACTTTCTCGGCAGGAGCA and generated a 170-bp amplicon. The oligonucleotides for lacZ were 5' CATCTACACCAACGTAACCTATCC and 5' GATAACTGCCGTCACTCCAACGCAG and generated a 296-bp amplicon.

{beta}-galactosidase immunohistochemistry

Conventional immunohistochemical techniques were used to map the distribution of neurons expressing {beta}-galactosidase ({beta}-gal) in tissue sections harvested from mGluR1 transgenic animals (see preceding text). Mice were deeply anesthetized (pentobarbital sodium, 50 mg/kg ip) and transcardially perfused with 5–10 ml 0.9% saline followed by 100 ml 4% paraformaldehyde in 0.1 M phosphate buffer (7.4 pH). Brains were removed and postfixed for 1–2 h at 4°C and then immersed in 20% sucrose phosphate buffer overnight. Forty-micrometer-thick sections were cut on a freezing microtome and placed in 0.1 M phosphate-buffered saline (PBS). Sections from wild-type (+/+) and homozygous (–/–) mice were processed simultaneously in the same solutions to reduce variability in immunohistochemical processing. Immunohistochemistry was performed in free-floating sections, as follows 1) immersion in 1% hydrogen peroxide for 10 min, followed by 4 x 5-min rinses in PBS; 2) 30-min incubation in PBS containing 0.1% bovine serum albumin and 0.5% Triton X-100 (PBS+); 3) overnight (10–16 h) incubation in anti-{beta}-gal polyclonal primary antibody (1:5,000; rabbit; 5'-3' Inc/Eppendorf 5 Prime, a subsidiary of Eppendorf, Boulder, CO) in PBS+, followed by 3 x 5-min rinses in PBS+; 4) 1-h incubation in biotinylated donkey anti-rabbit secondary antibody (1:400; Jackson ImmunoResearch Laboratories, West Grove, PA) in PBS+, followed by 3 x 5-min rinses in PBS+; 5) 1 h incubation in avidin-biotin-peroxidase complex solution (ABC-elite, 1:1,500; Vector) in PBS+, followed by 3 x 5-min rinses in PBS+; and 6) 10-min incubation in 0.02% 3,3'-diaminobenzidine (DAB) in 0.05 M phosphate buffer and 0.03% hydrogen peroxide, followed by 3 x 5-min rinses in PBS. Sections were mounted on coated slides, air-dried for 16 h, dehydrated in alcohol and xylenes, and coverslipped with DPX.

Sections were examined under brightfield optics using a Leica DMRX photomicroscope (Leica, Deerfield, IL). Digital microscopy images were captured using a Phase I digital camera (PhaseOne, Northport, NY), sized, and balanced for brightness and contrast using Adobe Photoshop 5.0 (Adobe Systems, San Jose, CA). Photomicrographs were printed on a Fuji Pictography 3000 printer (Fuji PhotoFilm, Tokyo).

Slice preparation and electrophysiology

Juvenile (21- to 31-day old) rats or mice were decapitated, the MOBs dissected out and immersed in artificial cerebrospinal fluid (ACSF, see following text) at 4°C as previously described (Heyward et al. 2001Go). Horizontal slices (400-µm-thick) of the MOB were cut parallel to its long axis using a vibratome (Vibratome Series 1000, Ted Pella, Redding, CA). After a period of recovery (30 min) at 30°C, the slices were incubated in a holding bath at room temperature (22°C) until used. For recording, a single brain slice was placed in a perfusion-bath recording chamber mounted on a microscope stage and maintained at 30 ± 0.5°C. Slices were submerged in ACSF (see following text for details on composition) flowing at 2.5–3 ml/min.

Visually guided recordings from neurons in the MC layer were made with near-infra red differential interference contrast (NIR DIC) optics, water-immersion objectives, and a BX50WI microscope (Olympus Optical, Tokyo) (Stuart et al. 1993Go). NIR transillumination was at 900 nm (filter transmission, 850–950 nm) concentric with the objective and optimized for DIC. A 0.25-in CCD camera (CCD 100, Dage, Stamford, CT), fitted with a 3-to-1 zooming coupler (Optem, Fairport, NY) was used. Contrast was enhanced in real-time using an image processor (Model 794, Hughes Aircraft Company, Carlsbad, CA) and the image was displayed on a monochrome monitor (Dage HR120, Dage-MTI, Michigan City, IN).

Recordings were made using conventional whole cell patch-clamp methods. Recording pipettes were pulled on a Flaming-Brown P-97 puller (Sutter Instrument, Novato, CA) from standard-wall filamented 1.5-mm-diam borosilicate glass; tip diameter was 2–3 µm, tip resistance was 5–8 M{Omega}. Seal resistance was routinely >1G{Omega}. Liquid junction potential was 9–10 mV; reported voltage measurements were not corrected for this potential. Data were obtained using an Axopatch 200B amplifier (Axon Instruments, Foster City, CA). Analog signals were recorded, low-pass Bessel filtered at 2 kHz, and digitized on videotape (AR Vetter, Rebersburg, PA) and computer disk (Axoscope/Clampex, Axon Instruments). Data were also collected through a Digidata-1200A Interface (Axon Instruments) and digitized at 10 kHz. Holding currents were generated under manual control by the recording amplifier.

Membrane depolarizations were calculated from the down-state membrane potential associated with mitral cell (MC) bistability. In some cases during agonist application, the down-state stability was eliminated (see Fig. 7A). In this case, the membrane potential was calculated from the potential immediately after an action potential. Current versus voltage (I-V) plots were obtained from steady-state currents (see Fig. 6B, inset) over potentials from –120 to +20 mV using a voltage step (10-mV step intervals, 600 ms/step, Vhold = –60 mV) protocol in the presence of synaptic blockers and TTX. Membrane resistance was calculated from the amount of steady-state current required to hyperpolarize the resting potential of the cells by 10 mV, from –60 to –70 mV. Distributions of membrane potential (see Fig. 7D) were constructed by all-points analysis of digitized records (pClamp, Axon Instruments), with voltage data points (excluding action potential peaks) in digitized records (sampled at 2 kHz) binned by amplitude. For each time point of the digitized recording, the membrane potential was determined, counted, and subsequently plotted in binned format. As previously described (Heyward et al. 2001Go), this analysis reveals the range of membrane potentials encompassing MC bistability as well as the duration of time the cell spends at each potential. Curve fitting was performed using pClamp analysis software (Axon Instruments). Mean spike rates were calculated over a 30-s period prior to, during, and after drug application. In current-clamp recordings, membrane input resistance was calculated from voltage changes in response to hyperpolarizing current pulses (1 s, –40 to –80 pA, 0.05 Hz). In voltage-clamp recordings, membrane resistance was calculated from current changes in response to voltage pulses (1 s, –10 to –20 mV, 0.05 Hz). Numerical data are expressed as the means ± SE. Unless otherwise described, tests for statistical significance (P < 0.05) were performed using Student's t-test.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 7. Activation and blockade of mGluRs modulates MC spontaneous activity and membrane bistability. A: the response of a rat MC (same cell as in Fig. 1B) is shown at an expanded time scale to illustrate the effects of ACPD on MC bistability (see RESULTS for details). Note that down-state potential stability is absent in the presence of ACPD. B, top: current-clamp recording showing membrane bistability in another rat MC. Middle: bath application of MCPG (500 µM) reduced the firing frequency of the MC and prolonged the up and down states. Bottom: the effects of MCPG were reversible on washout. C: bar graph showing that the duration of both the up and down states significantly increased (*P = 1.51E-7, up state; P = 8.33E-5, down state) in the presence of MCPG compared with control conditions. D: plot showing an all-points-analysis of membrane potential distribution before(· · ·) and during application of MCPG (—). The 2 major peaks reflect the 2 interspike membrane potentials maintained by bistable MCs during spontaneous activity, the up and down states. Note that MCPG shifts the proportion of time points in the up state toward the down state and produces an ~4-mV hyperpolarizing (i.e., leftward) shift in the peak corresponding to the up state. All experiments performed in the presence of CNQX (10 µM), APV (50 µM), and gabazine (5 µM).

 


View larger version (33K):
[in this window]
[in a new window]
 
FIG. 6. DHPG evokes a voltage-dependent inward current consisting of multiple conductances. A: plot of current-voltage (I-V) curves generated under control conditions ({circ}) and during bath application of DHPG (50 µM, {bullet}); plots represent group data from 9 MCs. All experiments presented in this figure were performed in the presence of blockers of fast synaptic transmission [CNQX (10 µM), APV (50 µM), gabazine (5 µM)] and TTX (1 µM) in the bath. B: the "DHPG current," obtained by subtracting I-V curves in A, increased with depolarizing membrane potentials and peaked around –20 mV; values that are significantly different between the 2 curves in A are indicated (*, paired Student's t-test, P < 0.05); * are used similarly in the subtraction plots below (D, F, and H). Inset: examples of voltage steps and corresponding currents in the DHPG condition in A; {downarrow}, steady-state currents used to plot I-V curves. C: I-V curves generated with 20 mM TEA and 120 mM Cs+ in the recording pipette before ({circ}) and during ({bullet}) DHPG application; plots show group data from 6 MCs. D: the DHPG current with TEA and Cs+ was eliminated at membrane potentials positive to –40 mV. E: I-V curves generated in the presence of bis-(o-aminophenoxy)-N,N,N',N'-tetraacetic acid (BAPTA)-AM (20 µM) and TEA and Cs+ in the recording pipette before ({circ}) and during ({bullet}) DHPG application; group data from 8 MCs. F: note that the DHPG current is only present at membrane voltages from –60 to –40 mV in the presence of BAPTA, TEA, and Cs+. G: I-V curves generated in the presence of BAPTA-AM (20 µM), Cd2+ (100 µM), and Ni2+ (100 µM) in the bath and TEA and Cs+ in the recording pipette before ({circ}) and during ({bullet}) DHPG application; data from 7 MCs. H: no significant DHPG current is present at any membrane voltage tested in the conditions shown in G.

 
Biocytin (0.05% to 0.1%, Molecular Probes) was added to the pipette solution in some experiments to allow histological confirmation of recorded cells. The presence of biocytin had no evident effect on MC electrophysiology. After recording, slices were fixed overnight in phosphate-buffered 4% paraformaldehyde at 4°C. Slices were incubated with Cy3-conjugated Streptavidin (Jackson ImmunoResearch Laboratories) and processed for later visualization and cell identification with laser-scanning confocal microscopy (FluoView confocal microscope, Olympus Instruments, Long Beach, CA) as described previously (Puche and Shipley 2001Go).

Olfactory nerve stimulation

The olfactory nerve layer was focally stimulated with a bipolar electrode constructed from a pair of twisted stainless-steel wires (70 µm), insulated except for bluntly cut tips. The tips of the wires were placed tangentially along the peripheral surface of the olfactory nerve layer, slightly rostral to the estimated location of the recorded MC. Stimuli were isolated monophasic square wave pulses (10–200 µA in amplitude, 0.1 ms in duration) delivered by a Grass S8800 stimulator (Astro-Med, West Warwick, RI) and an isolated constant current source (Grass PSIU6, Astro-Med).

Drugs and solutions

The standard ACSF consisted of (in mM) 120 NaCl, 3 KCl, 1.3 CaCl2, 1.3 MgSO4, 10 glucose, 25 NaHCO3, and 5 N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid (BES), 95% O2-5% CO2-saturated, pH 7.27, 300 mOsm (Heyward et al. 2001Go). The standard pipette solution consisted of (mM) 125 K gluconate, 2 MgCl2, 10 HEPES, 2 Mg2ATP, 0.2 Na3GTP, 1 NaCl, and 0.2 EGTA. In a subset of experiments, K gluconate in the pipette solution was substituted with tetraethylammonium chloride (TEA; 20 mM) and cesium methanesulfonate (Cs+; 120 mM) to block potassium channels. In other experiments, slices were incubated in bis-(o-aminophenoxy)-N,N,N',N'-tetraacetic acid (BAPTA)-AM (20 µM) prior to and during recordings to chelate intracellular calcium. Recording medium and pipette solution components were from Sigma-Aldrich (St. Louis, MO). The following drugs were bath applied: (±)-1-aminocyclopentane-trans-1,3-dicarboxylic acid (ACPD), 4-aminopyridine (4-AP), barium chloride (Ba2+), cadmium chloride (Cd2+), cesium chloride (CsCl), (RS)-2-chloro-5-hydroxyphenylglycine (CHPG), 6-cyano-7-nitroquinoxaline-2-3-dione (CNQX), D-2-amino-5-phosphonopentanoic acid (AP5), (RS)-3,5-dihydroxyphenylglycine (DHPG), 2-(3-carboxypropyl)-3-amino-6-(4 methoxyphenyl)-pyridazinium bromide (gabazine, SR-95531), L(+)-2-amino-4-phosphonobutyric acid (AP4), (2S,3S,4S)-CCG/(2S,1'S,2'S)-2-(carboxycyclopropyl)glycine (L-CCG-I), ({alpha}S)-{alpha}-amino-{alpha}-[(1S,2S)-2-carboxycyclopropyl]-9H-xanthine-9-propanoic acid (LY341495), (S)-(+)- {alpha}-amino-4-carboxy-2-methylbenzeneacetic acid (LY367385), (RS)-{alpha}-methyl-4-carboxyphenylglycine (MCPG), nickel chloride (Ni2+), TEA, and tetrodotoxin (TTX). All drugs were supplied by Tocris (Ellisville, MO), except for 4-AP, barium chloride, cadmium chloride, cesium chloride, gabazine, nickel chloride, TEA chloride, and TTX (Sigma-Aldrich, St. Louis, MO). A salt-agar bridge was used as the reference electrode during experiments in which MCPG was bath applied to avoid changes in junction potential at the silver/silver chloride reference electrode otherwise seen with this drug.


 RESULTS
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
MCs were identified visually with NIR-DIC microscopy by their large cell bodies located in the distinct narrow band of the MC layer and by intrinsic properties such as membrane potential bistability (Heyward et al. 2001Go; see Fig. 7A) and input resistance (rat, 207 ± 10.4 M{Omega}, n = 42; mouse, 177 ± 14.4 M{Omega}, n = 86). Location and bistability distinguish MCs from TCs in the adjacent external plexiform layer and from the small, high resistance (typically >1G{Omega}) granule cells (GCs) present in the MC layer (Heyward et al. 2001Go; Schoppa et al. 1998Go). In some experiments, MC identification was verified by subsequent histological examination (n = 6). Data are reported for recordings from 97 rat and 174 mouse MCs.

Group I/II mGluR agonists depolarize and increase MC firing rate

We first investigated the actions of the selective group I/II mGluR agonist, ACPD, on MC membrane potential and spontaneous spike generation in current-clamp recording mode. As shown in Fig. 1A, bath application of ACPD (50 µM) strongly depolarized all MCs tested. The depolarizing effect of ACPD on MCs was substantially larger in rats than in wild-type mice [peak membrane depolarization ({Delta} mV) in rats = 14.1 ± 1.4 mV, n = 23; {Delta} mV in mice = 6.1 ± 0.7 mV, n = 12; P = 2.97E-4]. ACPD-evoked depolarization was accompanied by an increased action potential firing rate. With prolonged application (>2 min) of ACPD, the initial excitation was invariably followed by spike broadening, decreased spike amplitude, and gradual reduction in firing of MCs (i.e., depolarization block). All of these effects were reversible during washout and were repeatable without apparent desensitization (Fig. 1B).



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 1. The group I/II metabotropic glutamate receptor (mGluR) agonist (±)-1-aminocyclopentane-trans-1,3-dicarboxylic acid (ACPD) and the group I mGluR agonist (RS)-3,5-dihydroxyphenylglycine (DHPG) depolarize and increase the firing of mitral cells (MCs). A: bath application of 50 µM ACPD resulted in membrane potential depolarization and increased action potential firing in this rat MC. The initial excitation was followed by gradual spike broadening, decreased spike amplitude and reduction in firing indicative of depolarization block. B: a similar response to ACPD (50 µM) was obtained in the presence of blockers of fast synaptic transmission [6-cyano-7-nitroquinoxalene-2,3-dione (CNQX), 2-amino-5-phosphonovaleric acid (APV), and 2-(3-carboxypropyl)-3-amino-6-(4 methoxyphenyl)-pyridazinium bromide (gabazine)] in another rat MC. There was no apparent desensitization with repeated application of ACPD. C: the group I/II mGluR antagonist (RS)-{alpha}-methyl-4-carboxyphenylglycine (MCPG, 100 µM) blocks the response of another MC to ACPD. After washout (>5 min), re-application of ACPD depolarized and increased spontaneous discharge of the same cell. DG: MCs were activated by group I, but not group II or III, mGluR agonists. Bath application of the group III mGluR agonist L(+)-2-amino-4-phosphonobutyric acid (AP4; 100 µM, D) or the group II mGluR agonist (2S,3S,4S)-CCG/(2S,1'S,2'S)-2-(carboxycyclopropyl)glycine (L-CCG-I; 20 µM, E) did not alter the membrane potential or firing rate of this mouse MC in current-clamp recordings. F: the same cell was activated by the selective group I agonist DHPG. G: the selective mGluR1 antagonist ({alpha}S)-{alpha}-amino-{alpha}-[(1S,2S)-2-carboxycyclopropyl]-9H-xanthine-9-propanoic acid (LY367385, 100 µM) blocked the actions of the group I mGluR agonist DHPG (50 µM) in another mouse MC. After washout (>15 min), re-application of DHPG robustly depolarized and increased MC spontaneous discharge. All experiments (except in A) were performed in the presence of blockers of fast synaptic transmission: CNQX (10 µM), APV (50 µM), and gabazine (5 µM).

 
To determine if these effects were mediated by direct activation of mGluRs on MCs, ACPD was applied in the presence of blockers of ionotropic glutamate and GABAA receptors (Figs. 1B and 2): CNQX (10 µM), APV (50 µM), and gabazine (5 µM). Under these conditions, the depolarizing action of ACPD persisted ({Delta} mV in rat MCs = 14.3 ± 2.0 mV, n = 6) and was virtually identical to that observed in control ACSF (14.1 ± 1.4 mV, n = 23; P = 0.94). Taken together, the results suggest that depolarization and increased firing elicited by ACPD are mediated directly by activation of group I/II mGluRs on MCs.



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 2. Bar graph summarizing the effects of mGluR agonists and antagonists on MC membrane potential. Responses are expressed as the change in membrane potential elicited by application of mGluR agonists, alone or in combination with mGluR antagonists. All data shown, except that for ACPD in the first bar, were collected in the presence of synaptic blockers (CNQX, 10 µM; APV, 50 µM; gabazine, 5 µM). *, statistically significant difference from control (P < 0.05).

 
Bath application of MCPG (100–500 µM), a nonselective group I/II mGluR antagonist, blocked the effects of ACPD (50 µM) in rat MCs (Figs. 1C and 2); {Delta} mV in the presence of ACPD and ACPD + MCPG was 14.1 ± 1.4 mV (n = 23) and 2.9 ± 0.6 mV (n = 13), respectively. Application of LY341495 (10–100 µM), a blocker of all mGluR subtypes at micromolar concentrations (Kingston et al. 1998Go), prevented or reversed both the ACPD-evoked membrane depolarization and increased firing ({Delta} mV in presence of LY341495 + ACPD = –1.2 ± 0.1 mV, P = 0.14, n = 8). After washout of LY341495, re-application of ACPD depolarized and increased the firing rate of MCs.

Selective group I mGluR agonists activate MCs

To investigate the specific class of mGluRs mediating the effect of ACPD, we next explored the actions of preferential agonists for the three mGluR groups. In current-clamp recordings from mouse MCs, neither the group II agonist L-CCG-I (20 µM) nor the group III agonist AP4 (100 µM) depolarized MCs or increased their firing rate (Fig. 1, D and E, 2; P = 0.24 and P = 0.27, respectively, n = 5). Similarly, neither L-CCG-I (n = 7, P = 0.21) nor AP4 (n = 9, P = 0.32,) elicited significant shifts of the holding current in voltage-clamp recordings (Vhold = –60 mV). By contrast, the preferential group I agonist DHPG (50 µM) depolarized mouse and rat MCs and increased their firing rate (Figs. 1F and 2). DHPG (50 µM) elicited a peak membrane depolarization of 14.7 ± 1.9 mV in mice (P = 1.37E-6, n = 16). In voltage clamp (Vhold = –60 mV), DHPG (50 µM) evoked a robust inward current of –110.0 ± 10.9 pA (P = 4.45E-10, n = 25) in the presence of synaptic blockers [CNQX (10 µM), APV (50 µM), and gabazine (5 µM)].

Group I mGluRs include the mGluR1 and mGluR5 subtypes. MCs express high levels of mGluR1, but mGluR5 appears to be absent or expressed at very low levels in MCs. This suggests that the effects of DHPG are mediated via activation of mGluR1s on MCs. To test this hypothesis, we first investigated the effects of the preferential mGluR5 agonists as selective mGluR1 agonists are not available. The mGluR5 agonist CHPG (50 µM) was without excitatory effect on MCs (P = 0.18, n = 8), suggesting that the effects of ACPD and DHPG are mediated through the mGluR1 receptor subtype.

We next assessed the specificity of DHPG with a preferential mGluR1 antagonist, LY367385 that has negligible actions on group II and III mGluRs and antagonizes mGluR5 only at concentrations in excess of 100 µM (Clark et al. 1997Go; Salt et al. 1999Go). In the presence of LY367385 (100 µM), DHPG did not change the membrane potential of MCs (Figs. 1G, left and 2); {Delta} mV in DHPG = 14.7 ± 1.9 mV (n = 16) versus DHPG + LY367385 = 0.4 ± 0.01 mV (n = 7). After washout, re-application of DHPG depolarized and increased MC firing rate (Fig. 1G, right).

DHPG-evoked excitation of MCs is present in mGluR5 knockout mice but absent in mGluR1 knockout mice

The preceding pharmacological results suggest that the effect of DHPG on MCs is mediated by activation of mGluR1. However, because the specificity of mGluR agonists and antagonists is limited and varies with concentration, we took advantage of mice with targeted deletion of the mGluR1 receptor gene to further investigate the function of this receptor subtype on MCs (Conquet et al. 1994Go). In this transgenic strain, the mGluR1 gene sequence has been replaced with that for {beta}-galactosidase ({beta}-gal) by homologous recombination; therefore in "knockout" (KO) mice {beta}-gal is present only in cells that would normally express mGluR1. We first examined the location of {beta}-gal-positive ({beta}-gal+) neurons in mGluR1 KO and wild-type littermate (WT) mice using immunohistochemistry (see METHODS). As shown in Fig. 3, the distribution of {beta}-gal+ neurons in the MOB and other brain structures is consistent with previous reports on the distribution of mGluR1 (Martin et al. 1992Go; Petralia et al. 1997Go; Sahara et al. 2001Go; Shigemoto et al. 1992Go; van den Pol 1995Go). In the MOB (Fig. 3B), strong and uniform staining is present in MCs. Tufted-like cells in the external plexiform layer and juxtaglomerular cells in the glomerular layer proper and at the glomerular layer-external plexiform layer border were also robustly stained. By contrast, no staining was observed in the internal plexiform or GC layers. {beta}-gal staining was absent in mGluR1 WT littermates (Fig. 3C).



View larger version (91K):
[in this window]
[in a new window]
 
FIG. 3. mGluR1s are robustly and uniformly expressed in MCs. A–C: sagittal sections showing the distribution of neurons expressing mGlu1 receptors in mGluR1 knockout and wild-type mice as revealed by {beta}-gal immunohistochemistry (see METHODS for details). A: in sections of mGluR1 mutant (–/–) mice, {beta}-gal staining is prominent in the cerebellum (Cb), hippocampus (Hc), thalamus (Th), lateral septum (LS), superior colliculus (SC), inferior olive (IO), main olfactory bulb (MOB), and throughout the cortex (Cx). B: higher magnification illustrates the staining pattern in the MOB. {beta}-gal staining is present in neurons in the MC (MCL) and glomerular layers (GL) and also in scattered cells in the external plexiform layer (EPL). No staining was present in the internal plexiform (IPL) or granule cell layers (GCL). C: {beta}-gal staining was absent in sections harvested from mGluR1 wild-type (+/+) mice.

 
We next compared the effects of DHPG on MCs in slices harvested from WT and KO mice. These experiments were performed in the presence of synaptic blockers (50 µM APV, 10 µM CNQX, 5 µM gabazine). In MOB slices harvested from mGluR1 WT mice, the DHPG (50 µM)-evoked depolarization and increased firing in MCs were comparable to that observed in the preceding text (Fig. 4A). However, in slices from mGluR1 KO mice (Fig. 4B), the same concentration of DHPG had no discernible effects on MCs ({Delta} mV = 0.02 ± 0.03 mV, P = 0.92, n = 9). Likewise, in slices from mGluR1 KO mice (Fig. 4C), the group I/II mGluR agonist ACPD did not depolarize MCs ({Delta} mV = –0.5 ± 0.5 mV, P = 0.38, n = 8); in some of these slices, ACPD produced a small reduction of MC firing rate, although this trend did not reach statistical significance (P = 0.15). MC input resistance and resting membrane potential were similar in wild-type [177 ± 14.4 M{Omega} (n = 86), –52.2 ± 0.8 mV (n = 28)] and mGluR1 KO mice [152.4 ± 42.9 M{Omega} (n = 12), –54.2 ± 2.4 mV (n = 8)]. In slices from mGluR5 KO mice, DHPG activated MCs in a similar manner to that seen in WT mice (Fig. 4D; {Delta} mV = 14.7 ± 1.3 mV, P = 2.69E-8, n = 8). As seen in WT mice, the response of MCs in mGluR5 KO mice to DHPG was much stronger than the response to ACPD ({Delta} mV = 6.0 ± 1.2 mV, P = 3.54E-4, n = 8). Taken together, the preceding results indicate that the excitatory effect of DHPG is mediated entirely by direct activation of mGluR1 on MCs.



View larger version (60K):
[in this window]
[in a new window]
 
FIG. 4. Excitatory actions of ACPD and DHPG on MCs are absent in mGluR1 null mutant mice. A: MC cells recorded in slices harvested from wild-type mice are uniformly activated by DHPG (50 µM). B: DHPG (50 µM) was without effect in MCs recorded in slices from mGluR1 null mutant (KO) mice. C: in contrast to its excitatory effect in wild-type mice, ACPD (50 µM) elicited a modest reduction in the firing rate of MCs recorded in slices from mGluR1 mutant (KO) mice. D: the excitatory effect of DHPG (50 µM) on MCs recorded in slices from mGluR5 null mutant (KO) mice were similar to those observed in wild-type mice. All experiments performed in the presence synaptic blockers: CNQX (10 µM), APV (50 µM) and gabazine (5 µM).

 
DHPG elicits an inward current in MCs

We next investigated the properties of the DHPG-evoked current in MCs in voltage-clamp recording mode (Vhold = –60 mV) in the presence of synaptic blockers and TTX (1 µM) to prevent indirect effects of DHPG. The amplitude of the DHPG-evoked current in synaptic blockers (–110.0 ± 10.9 pA, P = 4.45E-10, n = 25) was similar to that in blockers and TTX (–101.2 ± 32.9 pA, n = 6), indicating that fast sodium channels are not substantially involved in the inward current. DHPG evoked an inward shift of the holding current in a dose-dependent manner (Fig. 5A). The dose-response relationship revealed an EC50 of 27.4 µM (Fig. 5B). The preferential mGluR5 agonist CHPG (50–100 µM) had no effect on the holding current, consistent with its lack of effect in current-clamp recordings.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 5. The mGluR1 agonist DHPG evokes a dose-dependent inward current in MCs. A: voltage-clamp record from a mouse MC showing inward currents elicited by increasing concentrations of DHPG (1, 5, 10, 50, and 100 µM, added cumulatively, ca. 3 min for each concentration); holding potential, –60 mV. Experiments were performed with synaptic blockers in the bath: CNQX (10 µM), APV (50 µM), and gabazine (5 µM). B: a sigmoidal curve was fitted to the DHPG concentration-response data. The estimated EC50 of DHPG was 27.4 µM. Each point represents the mean ± SE for responses gathered from 6 to 12 MCs.

 
The I-V relationship of the DHPG-evoked current is shown in Fig. 6. DHPG (50 µM) induced an inward shift in holding current at all membrane potentials examined (Fig. 6A). The DHPG current obtained by subtracting the control (normal ACSF) and DHPG I-V curves (difference current) exhibited voltage dependency with currents of larger amplitude at more depolarized membrane potentials (Fig. 6B). For example, the amplitude of the DHPG current at –30 mV (–129.7 ± 13.3 pA) was significantly larger (P = 0.0001, n = 9) than that at –90 mV (–61.4 ± 8.3 pA); the peak current occurred at –20 mV (–148.3 ± 10.9 pA). There was no significant change in membrane input impedance associated with the DHPG-induced inward current (121.2 ± 22.4 vs. 123.2 ± 25.2 M{Omega}, P = 0.53, n = 11). This suggests that either the DHPG-induced current is mediated without change in input impedance or that several ionic conductances are activated in response to DHPG, and the resulting current reflects increased activation of inward currents and inhibition of outward currents.

mGluR1-induced depolarizations and inward currents in CNS neurons, including MCs in culture, have been ascribed to the inhibition of K+ currents (Anwyl 1999Go; Charpak et al. 1990Go; Guérineau et al. 1994Go; Schoppa et al. 1997Go). To investigate the potential involvement of K+ ions, we studied the effects of K+ channel blockers, 120 mM Cs+ and 20 mM TEA (included in the pipette solution, see METHODS), on the DHPG-evoked current (Fig. 6, C and D). This reduced the inward current at relatively depolarized membrane potentials, i.e., positive to –40 mV, suggesting that at least part of the current is mediated by closure of K+ channels. The inward current increased at more hyperpolarized potentials and persisted in the presence of the K+ channel blockers, suggesting that DHPG current consists of multiple components. Because activation of mGluR1 is also known to induce currents that are triggered by a rise in intracellular Ca2+ levels, we next investigated the effects of the K+ blockers combined with bath-applied BAPTA-AM (20 µM) to chelate intracellular Ca2+ (Tsien 1980Go). Under these conditions (Fig. 6, E and F), the DHPG current was eliminated except in a narrow voltage range between –60 and –40 mV. This residual current was completely blocked by further addition of the voltage-dependent Ca2+ channel blockers Cd2+ (100 µM) and Ni2+ (100 µM; Fig. 6, G and H). Taken together, these results indicate that the DHPG current consists of multiple components.

Tonic modulation of MC membrane excitability by mGluR activation

Previous studies indicate that MCs exhibit membrane bistability, a property that significantly influences their excitability and sensory responses (Heyward et al. 2001Go). Although bistability is generated by MC intrinsic membrane properties (Heyward et al. 2001Go), it may be modulated by extrinsic input. Therefore we investigated the effects of activation and inactivation of mGluRs on bistability. As reported previously (Heyward et al. 2001Go) and shown in Fig. 7A, MCs exhibit intrinsic membrane potential bistability, spontaneously alternating between two discrete membrane potentials differing by ~10 mV: a more depolarized "up state," perithreshold for spike generation, and a more hyperpolarized "down state" devoid of spiking. Bistability is present in both rat and mice MCs, but the up state is more pronounced and prolonged in rat than mouse (Heinbockel and Heyward, unpublished observations). In the presence of synaptic blockers, ACPD (50 µM) or DHPG (50 µM) increased MC firing and modulated MC bistability. During ACPD-evoked depolarizations, down-state stability was eliminated, such that MCs spiked repetitively, returning immediately to the up state after a spike (Fig. 7A, middle).

Application of mGluR antagonists also dramatically altered bistability in rat MCs. MCPG (100 to 500 µM) significantly prolonged the duration of the up and down states (Fig. 7, B and C; down state, P = 8.33E-5, n = 36; up state, P = 1.51E-7, n = 36). These effects were accompanied by a significant reduction in spontaneous firing rate (4.3 ± 0.6 vs. 3.2 ± 0.51 Hz, n = 32; P = 3.53E-6). MCPG also reduced spontaneous spiking in mouse MCs, although this was not quantified. All-points analysis of the membrane potential (Heyward et al. 2001Go) revealed a shift toward more time spent in the down state and a hyperpolarizing shift of the up-state membrane potential (Fig. 7D). Similar effects on membrane bistability were observed with the broad-spectrum mGluR antagonist LY341495 (100 µM, n = 4) and the mGluR1-selective antagonist LY367385 (100 µM, n = 6). All of these effects occurred in the presence of fast synaptic blockers (i.e., CNQX, APV, gabazine), which had no effect on bistability (n = 33) as previously reported (Heyward et al. 2001Go). Application of synaptic blockers did, however, eliminate MC responses to ON stimulation (n = 9), indicating that ionotropic glutamate receptor-mediated synaptic inputs to these cells were completely blocked. These results suggest that bistability and MC excitability are tonically modulated, at least in part, by endogenously released glutamate acting at mGluR1.

Blockade of mGluRs reduces MC responses to olfactory nerve input

Because mGluR antagonists potently modulated bistability, a property that regulates the responsiveness of MCs to olfactory nerve input (Heyward et al. 2001Go), we investigated the effect of mGluR antagonists on rat MCs to single-pulse (0.1 Hz) stimulation of the olfactory nerve. The intensity of olfactory nerve stimuli was adjusted to elicit a short-latency spike on ~60–80% of the stimulus trials. The selective mGluR1 antagonist LY367385 (10–100 µM) reversibly reduced the response probability to olfactory nerve stimulation, i.e., the occurrence of a short-latency spike (Fig. 8, A and B) from 73.2 ± 4.9 to 50.4 ± 7.5% (n = 10, P = 0.0011). LY367385 also significantly increased the latency of olfactory nerve-evoked short-latency spikes (Fig. 8, A and C) from 10.6 ± 1.1 to 13.0 ± 1.3 ms (n = 10, P = 1.41E-4). These effects on olfactory nerve-evoked responses were not accompanied by change in overall membrane potential. Similar effects were observed in wild-type mouse MCs where the mGluR antagonists LY341495 or LY367385 (100 µM) reduced the probability of olfactory nerve-evoked responses from 89.2 ± 4.4 to 41.5 ± 8.7% (n = 9, P = 5.07E-4). Thus selective inactivation of mGluR1 reduces sensory-evoked spiking in MCs.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 8. Blockade of mGluRs attenuates sensory-evoked excitation of rat MCs. A: current-clamp recordings show that single olfactory nerve stimuli (stimulus artifact marked by {uparrow} in 3rd trace) evoked short-latency spikes in a MC. In the presence of the mGluR antagonist LY367385 (middle), the probability of olfactory nerve-evoked short-latency spikes was reduced while the latency to the 1st spike was increased. These effects were reversible after washout of the antagonist (bottom). Twenty-four trials are overlaid in each trace, and spikes are truncated. B and C: bar graphs of group data show the reduction in the percentage of olfactory nerve-evoked spikes (B, *P = 0.0011) and the increase in spike latency (C, *P = 1.41E-4) before (control) and during application of LY367385. D: voltage-clamp recordings showing olfactory nerve-evoked excitatory postsynaptic currents (EPSCs) before (top), during (middle), and after (bottom) application of the specific mGluR1 antagonist LY367385. LY367385 did not alter the onset latency, amplitude, or time course of the EPSCs. Traces represent averages from 6 slices.

 
To investigate if the preceding effects were due to presynaptic modulation of olfactory nerve terminals versus postsynaptic modulation of MC excitability, we recorded olfactory nerve-evoked excitatory postsynaptic currents (EPSCs) before and during bath application of LY367385. The amplitude, latency, and time course of olfactory nerve-evoked EPSCs were not altered by LY367385 (Fig. 8D, n = 6; amplitude: 106 ± 29.7 vs. 108.5 ± 26.5 pA, P > 0.05; latency: 2.1 ± 0.5 vs. 1.8 ± 0.4 ms, P > 0.05; 10–90% rise time: 1.6 ± 0.4 vs. 1.8 ± 0.4 ms, P > 0.05; half-width: 4.4 ± 2.1 vs. 5.3 ± 1.9 ms, P > 0.05). These findings indicate that LY367385 does not presynaptically alter the excitability of olfactory nerve terminals.


 DISCUSSION
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
The present results demonstrate an important role of mGluR1 in modulating the excitability of MCs. Broad-spectrum (i.e., ACPD) and selective group I (i.e., DHPG) mGluR agonists potently and dose dependently depolarized and increased the firing rate of MCs. These effects were due to direct activation of mGluR1 on MCs as they persisted undiminished in the presence of synaptic blockers and/or TTX and were absent in transgenic animals with targeted deletion of the mGluR1 gene. Blockade of group I receptors or mGluR1 significantly reduced MC spontaneous firing and olfactory nerve-evoked discharge of MCs, suggesting that endogenously released glutamate acting at mGluR1 tonically modulates the basal and sensory-evoked discharge of MCs.

Activation of mGluR1 directly depolarizes MCs

Application of either the mixed group I/II agonist ACPD or the preferential group I agonist DHPG resulted in a uniform and reversible membrane potential depolarization and increased rate of action potential generation in both rat and mouse MCs. DHPG was typically more potent in depolarizing MCs than ACPD at similar concentrations, consistent with the higher potency of DHPG at group I receptors (Conn and Pin 1997Go; Schoepp et al. 1999Go). Overall, mGluR agonists had more robust effects in rats than in mice, possibly linked to different levels of receptor expression or differences in intracellular messenger machinery. The excitatory effects of ACPD or DHPG were not mediated by activation of ionotropic glutamate receptors as a result of increased glutamate release from MCs or other MOB neurons nor due to decreased activation of GABAA receptors on MC (i.e., disinhibition). This was ascertained by the lack of significant effects of synaptic blockers (CNQX, AP5, gabazine) on ACPD- or DHPG-evoked depolarizations. In voltage clamp, the inward current elicited by ACPD or DHPG persisted undiminished in synaptic blockers and/or TTX, suggesting that such currents are not mediated by changes in action-potential transmitter release from neuronal elements presynaptic to MCs.

ACPD and DHPG can activate both group I receptor subtypes, mGluR1 and mGluR5. Several results indicate that the actions of these agonists on MCs are mediated exclusively via activation of mGluR1: 1) the excitatory effects of ACPD and DHPG were completely absent in mice with targeted deletion of the mGlu1 but not the mGlu5 receptors; 2) the effects of DHPG were blocked by the highly selective mGluR1 antagonist LY367385 (IC50 = 8.8 µM) (Clark et al. 1997Go; Marino et al. 2001Go; Rivadulla et al. 2002Go) at concentrations that do not affect responses mediated by ionotropic glutamate receptors or other mGluR subtypes (Clark et al. 1997Go; Salt et al. 1999Go); and 3) the preferential mGluR5 agonist CHPG was without effect. Additionally, neither group II nor group III receptors contribute discernibly to ACPD- or DHPG-evoked depolarizations or inward currents in MCs as preferential agonists for these mGluR classes, CCG and AP4, respectively, were without effect. We cannot exclude the possibility, however, that group II or III receptors modulate other currents, e.g., high-threshold Ca2+ currents (Trombley and Westbrook 1992Go) that would have been inactive at the holding potentials used in these experiments (–50 to –60 mV).

Activation of mGluR1 induces an inward current in MCs

Both ACPD and DHPG elicited an inward current in voltage-clamp recordings of rat and mouse MCs. The EC50 of the DHPG-evoked current, 27.4 µM, is comparable to that reported elsewhere (Schoepp et al. 1999Go). This inward current, similar to DHPG currents in neurons in several brain areas (see Anwyl 1999Go for review) has multiple components. One component of the inward current was mediated by a K+ conductance as it was abolished by TEA and Cs2+. This result agrees in part with previous observations by Schoppa and Westbrook (1997)Go that intracellular Cs2+ reduces inward currents evoked by DHPG in cultured MCs. A second component requires a rise in intracellular Ca2+ as it was abolished by BAPTA-AM. The identity of this BAPTA-sensitive current remains to be determined but may involve Ca2+-dependent nonselective cation conductances (Congar et al. 1997Go; Crepel et al. 1994Go; Guerineau et al. 1995Go; Raggenbass et al. 1997Go) or electrogenic Na+/Ca2+ exchangers (Keele et al. 1997Go; Lee and Boden 1997Go; Staub et al. 1992Go). A third component, present at membrane potentials from –60 to –40 mV in the presence of BAPTA, TEA and Cs2+, appears to involve voltage-gated Ca2+ channels as it was eliminated by Cd2+ and Ni2+. Additional experiments are necessary to delineate the I-V characteristics and other properties of the individual conductances elicited in MCs by DHPG.

Endogenous glutamate tonically modulates MC excitability via activation of mGluR1

An important finding of the present study is that blockade of mGluRs reduces MC spontaneous and sensory-evoked excitability via modulation of membrane bistability, an intrinsic property of MCs. mGluR antagonists (LY367385, LY341495, MCPG), in the presence of fast synaptic blockers, lengthened the periodicity of bistability by significantly prolonging the duration of both the up and down states. Because the prolongation of the subthreshold down state was proportionately greater than that of the up state, mGluR1 inactivation causes MCs to spend more time at this hyperpolarized level in which they do not spontaneously spike (Heyward et al. 2001Go). Additionally, mGluR inactivation produced a hyperpolarizing shift of the range of normally perithreshold up-state membrane potentials, further biasing MCs away from spike threshold. Together, these actions reduce MC excitability, consistent with the observed reduction in spontaneous firing rate. These actions of mGluR antagonists contrast with the lack of effect of last synaptic blockers on MC bistability (Heyward et al. 2001Go).

Bistability is an important determinant of MC responses to olfactory nerve input. In the perithreshold up state, MCs readily launch short-latency spikes in response to olfactory nerve input (Hayar et al. 2001Go; Heyward et al. 2001Go). By contrast, in the hyperpolarized down state, olfactory nerve input often fails to elicit spikes in MCs or spikes are evoked at long latency. The increase in latency corresponds to the time to depolarize from the down state to ramp or up-state potentials close to spike threshold (Heyward et al. 2001Go). Thus events that prolong the down state and/or produce a hyperpolarizing shift of the up-state membrane potentials should render MCs less likely to launch spikes and/or increase the latency of spikes in response to olfactory nerve input. Both of these effects were observed during inactivation of mGluR1: olfactory nerve-evoked spiking in MCs was significantly reduced and the latency of evoked spikes increased. As mGluR1 antagonism did not modify olfactory nerve-evoked EPSCs in MCs, the effects on olfactory nerve-evoked spiking appear to be mediated by modulation of bistability. These results, consistent with in vitro findings in rat sensorimotor cortex (Bandrowski et al. 2003Go), indicate that ambient glutamate levels tonically modulate MC excitability via activation of mGluR1.

Functional considerations

Localization of mGluR1 to MC apical dendrites suggests a role of these receptors at glutamatergic synapses from olfactory nerve terminals (van den Pol 1995Go) and/or glutamate-mediated recurrent excitation (i.e., spillover) among MC apical dendrites (Aroniadou-Anderjaska et al. 1999bGo; Carlson et al. 2000Go; Friedman and Strowbridge 2000Go; Isaacson 1999Go; Salin et al. 2001Go; Schoppa and Westbrook 2001Go). Another possible source of ambient glutamate is glial cells, which have intimate relationships with MC dendrites in the glomerular layer (Chao et al. 1997Go; Kasowski et al. 1999Go). Tonic activation of mGluR1 by baseline glutamate levels may serve to facilitate or amplify sensory responses of MCs. mGluR1-mediated excitation is typically slow in time course and preferentially engaged by high-frequency activity (Anwyl 1999Go). Thus mGluR1 responses in MCs would tend to be preferentially activated over successive sniff cycles during odor inhalation. MC responses to odors are characterized by specific temporal firing patterns, including oscillations and synchronous activity (Friedrich and Laurent 2001Go; Kauer 1998Go; Kay and Laurent 1999Go; Luo and Katz 2001Go; Spors and Grinvald 2002Go). In this regard, it is noteworthy that mGluR antagonism (i.e., with MCPG) was found to significantly reduce olfactory nerve-evoked rhythmic oscillations in MCs (Schoppa and Westbrook 2001Go). It is reasonable to speculate therefore that activation of mGluR1s on MC/TC apical dendrites plays an important role in odor-evoked oscillations and coding of olfactory stimuli.

mGluR1s are also present on portions of MC lateral dendrites presynaptic to GC dendrites (van den Pol 1995Go). This suggests that mGluR1 may function, in part, to increase the degree or duration of depolarization of the lateral dendrite after glutamate release from neighboring MCs/TCs. Spillover-mediated activation of mGluRs among MCs strongly activated by a particular odorant may presynaptically enhance glutamate release onto GCs, increasing lateral inhibition and thus contrast between strongly and weakly activated MCs (Kinzie et al. 1998Go; van den Pol 1995Go).


 GRANTS
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
This work was supported in part by National Institute on Deafness and Other Communication Disorders Grants DC-03195 and DC-00347 and by the University of Maryland School of Medicine.


 ACKNOWLEDGMENTS
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
We thank Dr. F. L. Margolis and F. Scipio for genotyping mGluR knockout mice.


 FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Address for reprint requests and other correspondence: T. Heinbockel, Dept. of Physiology, Univ. of Maryland School of Medicine, 655 W. Baltimore St., Baltimore, MD 21201 (E-mail: thein001{at}umaryland.edu).


 REFERENCES
 
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
Anwyl R. Metabotropic glutamate receptors: electrophysiological properties and role in plasticity. Brain Res Rev 29: 83–120, 1999.[CrossRef][Medline]

Aroniadou-Anderjaska VA, Ennis M, and Shipley MT. Glomerular synaptic responses to olfactory nerve input in rat olfactory bulb slices. Neuroscience 79: 425–434, 1997.[CrossRef][Web of Science][Medline]

Aroniadou-Anderjaska V, Ennis M, and Shipley MT. Current-source density analysis in the rat olfactory bulb: laminar distribution of kainate/AMPA and NMDA receptor-mediated currents. J Neurophysiol 81: 15–28, 1999a.[Abstract/Free Full Text]

Aroniadou-Anderjaska V, Ennis M, and Shipley MT. Dendrodendritic recurrent excitation in mitral cells of the rat olfactory bulb. J Neurophysiol 82: 489–494, 1999b.[Abstract/Free Full Text]

Bandrowski AE, Huguenard JR, and Prince DA. Baseline glutamate levels affect group I and II mGluRs in layer V pyramidal neurons of rat sensorimotor cortex. J Neurophysiol 89: 1308–1316, 2003.[Abstract/Free Full Text]

Bardoni R, Puopolo M, Magherini PC, and Belluzzi O. Potassium currents in periglomerular cells of frog olfactory bulb in vitro. Neurosci Lett 210: 95–98, 1996.[CrossRef][Web of Science][Medline]

Carlson GC, Shipley MT, and Keller A. Long-lasting depolarizations in mitral cells of the rat olfactory bulb. J Neurosci 20: 2011–2021, 2000.[Abstract/Free Full Text]

Carlson GC, Slawecki ML, Lancaster E, and Keller A. Distribution and activation of intracellular Ca2+ stores in cultured olfactory bulb neurons. J Neurophysiol 78: 2176–2185, 1997.[Abstract/Free Full Text]

Chao TI, Kasa P, and Wolff JR. Distribution of astroglia in glomeruli of the rat main olfactory bulb: exclusion from the sensory compartment of neuropil. J Comp Neurol 388: 191–210, 1997.[CrossRef][Web of Science][Medline]

Charpak S, Gähwiler BH, Do KQ, and Knöpfel T. Potassium conductances in hippocampal neurons blocked by excitatory amino-acid transmitters. Nature 347: 765–767, 1990.[CrossRef][Medline]

Chavis P, Fagni L, Bockaert J, and Lansman JB. Modulation of calcium channels by metabotropic glutamate receptors in cerebellar granule cells. Neuropharmacology 34: 929–937, 1995.[CrossRef][Web of Science][Medline]

Chen WR and Shepherd GM. Membrane and synaptic properties of mitral cells in slices of rat olfactory bulb. Brain Res 745: 189–196, 1997.[CrossRef][Web of Science][Medline]

Chiamulera C, Epping-Jordan MP, Zocchi A, Marcon C, Cottiny C, Tacconi S, Corsi M, Orzi F, and Conquet F. Reinforcing and locomotor stimulant effects of cocaine are absent in mGluR5 null mutant mice. Nat Neurosci 4: 873–874, 2001.[CrossRef][Web of Science][Medline]

Clark BP, Baker SR, Goldsworthy J, Harris JR, and Kingston AE. 2-Methyl-4-carboxyphenylglycine (LY367385) selectively antagonizes metabotropic glutamate mGluR1 receptors. Bioorg Med Chem Lett 7: 2777–2870, 1997.[CrossRef]

Congar P, Leinekugel X, Ben-Ari Y, and Crepel V. A long-lasting calcium-activated nonselective cationic current is generated by synaptic stimulation or exogenous activation of group I metabotropic glutamate receptors in CA1 pyramidal neurons. J Neurosci 17: 5366–5379, 1997.[Abstract/Free Full Text]

Conn PJ and Pin JP. Pharmacology and functions of metabotropic glutamate receptors. Annu Rev Pharmacol Toxicol 37: 205–237, 1997.[CrossRef][Web of Science][Medline]

Conquet F, Bashir ZI, Davies CH, Daniel H, Ferraguti F, Bordi F, Franz-Bacon K, Reggiani A, Matarese V, Condé F, Collingridge GL, and Crépel F. Motor deficit and impairment of synaptic plasticity in mice lacking mGluR1. Nature 372: 237–243, 1994.[CrossRef][Medline]

Crépel V, Aniksztejn L, Ben-Ari Y, and Hammond C. Glutamate metabotropic receptors increase a Ca2+-activated nonspecific cationic current in CA1 hippocampal neurons. J Neurophysiol 72: 1561–1569, 1994.[Abstract/Free Full Text]

Ennis M, Zhou FM, Ciombor KJ, Aroniadou-Anderjaska V, Hayar A, Borrelli E, Zimmer LA, Margolis F, and Shipley MT. Dopamine D2 receptor-mediated presynaptic inhibition of olfactory nerve terminals. J Neurophysiol 86: 2986–2997, 2001.[Abstract/Free Full Text]

Ennis M, Zimmer LA, and Shipley MT. Olfactory nerve stimulation activates rat mitral cells via NMDA and non-NMDA receptors in vitro. Neuroreport 7: 989–992, 1996.[Web of Science][Medline]

Friedman D and Strowbridge BW. Functional role of NMDA autoreceptors in olfactory mitral cells. J Neurophysiol 84: 39–50, 2000.[Abstract/Free Full Text]

Friedrich R and Laurent G. Dynamic optimization of odor representations by slow temporal patterning of mitra cell activity. Science 291: 889–894, 2001.[Abstract/Free Full Text]

Geiling H and Schild D. Glutamate-mediated release of Ca2+ in mitral cells of the olfactory bulb. J Neurophysiol 76: 563–570, 1996.[Abstract/Free Full Text]

Guérineau NC, Bossu JL, Gähwiler BH, and Gerber U. Activation of a nonselective cationic conductance by metabotropic glutamatergic and muscarinic agonist in CA3 pyramidal neurons of the rat hippocampus. J Neurosci 15: 4395–4407, 1995.[Abstract]

Guérineau NC, Gähwiler BH, and Gerber U. Reduction of resting K+ current by metabotropic glutamate and muscarinic receptors in rat CA3 cells: mediation by G-proteins. J Physiol 474: 27–33, 1994.[Abstract/Free Full Text]

Hayar A, Karnup S, Shipley MT, and Ennis M. Synchronous activity among juxtaglomerular neurons of the rat main olfactory bulb (MOB) in vitro. Soc Neurosci Abstr 27: 459.4, 2001.

Heinbockel T and Ennis M. Metabotropic glutamate receptor mGluR1 directly and potently activates mitral cells in main olfactory bulb slices (Abstract). Chem Senses 27: A109, 2002.

Heinbockel T, Hayar A, Heyward PM, Shipley MT, and Ennis M. Neural activity is modulated by metabotropic glutamate receptors in rat olfactory bulb slices (Abstract). Chem Senses 26:1065, 2001a.

Heinbockel T, Hayar A, Laaris N, Shipley MT, and Ennis M. Metabotropic glutamate receptors shape neuronal excitability and synaptic responsiveness in mouse olfactory bulb slices. Soc Neurosci Abstr 27: 623.5, 2001b.

Heyward P, Ennis M, Keller A, and Shipley MT. Membrane bistability in olfactory bulb mitral cells. J Neurosci 21: 5311–5320, 2001.[Abstract/Free Full Text]

Isaacson JS. Glutamate spillover mediates excitatory transmission in the rat olfactory bulb. Neuron 23: 377–384, 1999.[CrossRef][Web of Science][Medline]

Isaacson JS and Strowbridge BW. Olfactory reciprocal synapses: dendritic signaling in the CNS. Neuron 20: 749–761, 1998.[CrossRef][Web of Science][Medline]

Kasowski HJ, Kim H, and Greer CA. Compartmental organization of the olfactory bulb glomerulus. J Comp Neurol 407: 261–274, 1999.[CrossRef][Web of Science][Medline]

Kauer JS. Olfactory processing: a time and place for everything. Curr Biol 8: R282–283, 1998.[CrossRef][Web of Science][Medline]

Kay LM and Laurent G. Odor- and context-dependent modulation of mitral cell activity in behaving rats. Nat Neurosci 2: 1003–1009, 1999.[CrossRef][Web of Science][Medline]

Keele NB, Arvanov VL, and Shinnick-Gallagher P. Quisqualate-preferring metabotropic glutamate receptor activates Na+-Ca2+ exchange in rat basolateral amygdala neurones. J Physiol 499: 87–104, 1997.[Abstract/Free Full Text]

Keller A, Yagodin S, Aroniadou-Anderjaska A, Zimmer LA, Ennis M, Sheppard NF, and Shipley MT. Functional organization of rat olfactory bulb glomeruli revealed by optical imaging. J Neurosci 18: 2602–2612, 1998.[Abstract/Free Full Text]

Kingston AE, Ornstein PL, Wright RA, Johnson BG, Mayne NG, Burnett JP, Belagaje R, Wu S, and Schoepp DD. LY341495 is a nanomolar potent and selective antagonist of group II metabotropic glutamate receptors. Neuropharmacology 37: 1–12, 1998.[CrossRef][Web of Science][Medline]

Kinoshita A, Shigemoto R, Ohishi H, van der Putten H, and Mizuno N. Immunohistochemical localization of metabotropic glutamate receptors, mGluR7a and mGluR7b, in the central nervous system of the adult rat and mouse: a light and electron microscopic study. J Comp Neurol 393: 332–352, 1998.[CrossRef][Web of Science][Medline]

Kinzie JM, Saugstad JA, Westbrook GL, and Segerson TP. Distribution of metabotropic glutamate receptor 7 messenger RNA in the developing and adult rat brain. Neuroscience 69: 167–176, 1995.[CrossRef][Web of Science][Medline]

Kinzie JM, Westbrook GL, and Segerson TP. Metabotropic glutamate receptors in the olfactory bulb. In: Metabotropic Glutamate Receptors and Brain Function, edited by Moroni F, Nicoletti F, and Pellegrini-Giampietro DE. London: Portland, 59–69, 1998.

Lee K and Boden PR. Characterization of the inward current induced by metabotropic glutamate receptor stimulation in rat ventromedial hypothalamic neurones. J Physiol 504.3: 649–663, 1997.

Luo M and Katz LC. Response correlation maps of neurons in the mammalian olfactory bulb. Neuron 32: 1165–1179, 2001.[CrossRef][Web of Science][Medline]

Marino MJ, Wittmann M, Bradley SR, Hubert GW, Smith Y, and Conn PJ. Activation of group I metabotropic glutamate receptors produces a direct excitation and disinhibition of GABAergic projection neurons in the substantia nigra pars reticulata. J Neurosci 21: 7001–7012, 2001.[Abstract/Free Full Text]

Martin LJ, Blackstone CD, Huganir RL, and Price DL. Cellular localization of a metabotropic glutamate receptor in rat brain. Neuron 9: 259–270, 1992.[CrossRef][Web of Science][Medline]

Masu M, Tanabe Y, Tsuchida K, Shigemoto R, and Nakanishi S. Sequence and expression of a metabotropic glutamate receptor. Nature 349: 760–765, 1991.[CrossRef][Medline]

Petralia RS, Wang YX, Singh S, Wu C, Shi L, Wei J, and Wenthold RJ. A monoclonal antibody shows discrete cellular and subcellular localizations of mGluR1 alpha metabotropic glutamate receptors. J Chem Neuroanat 13: 77–93, 1997.[CrossRef][Web of Science][Medline]

Puche AC and Shipley MT. Radial glia development in the mouse olfactory bulb. J Comp Neurol 434: 1–12, 2001.[CrossRef][Web of Science][Medline]

Raggenbass M, Pierson P, Metzger D, and Alberi S. Action of a metabotropic glutamate receptor agonist in rat lateral septum: induction of a sodium-dependent inward aftercurrent. Brain Res 776: 75–87, 1997.[CrossRef][Web of Science][Medline]

Rivadulla C, Martinez LM, Varela C, and Cudeiro J. Completing the corticofugal loop: a visual role for the corticogeniculate type 1 metabotropic glutamate receptor. J Neurosci 22: 2956–2962, 2002.[Abstract/Free Full Text]

Sahara Y, Kubota T, and Ichikawa M. Cellular localization of metabotropic glutamate receptors mGluR1, 2/3, 5 and 7 in the main and accessory olfactory bulb of the rat. Neurosci Lett 312: 59–62, 2001.[CrossRef][Web of Science][Medline]

Salin PA, Lledo PM, Vincent JD, and Charpak S. Dendritic glutamate autoreceptors modulate signal processing in rat mitral cells. J Neurophysiol 85: 1275–1282, 2001.[Abstract/Free Full Text]

Salt TE, Turner JP, and Kingston AE. Evaluation of agonists and antagonists acting at group I metabotropic glutamate receptors in the thalamus in vivo. Neuropharmacology 38: 1505–1510, 1999.[CrossRef][Web of Science][Medline]

Saugstad JA, Kinzie JM, Shinohara MM, Segerson TP, and Westbrook GL. Cloning and expression of rat metabotropic glutamate receptor 8 reveals a distinct pharmacological profile. Mol Pharmacol 51: 119–125, 1997.[Abstract/Free Full Text]

Schoepp DD, Jane DE, and Monn JA. Pharmacological agents acting at subtypes of metabotropic glutamate receptors. Neuropharmacology 38: 1431–1476, 1999.[CrossRef][Web of Science][Medline]

Schoppa NE and Westbrook GL. Modulation of mEPSCs in olfactory bulb mitral cells by metabotropic glutamate receptors. J Neurophysiol 78: 1468–1475, 1997.[Abstract/Free Full Text]

Schoppa NE and Westbrook GL. Glomerulus-specific synchronization of mitral cells in the olfactory bulb. Neuron 31: 639–651, 2001.[CrossRef][Web of Science][Medline]

Schoppa NE, Kinzie JM, Sahara Y, Segerson TP, and Westbrook GL. Dendrodendritic inhibition in the olfactory bulb is driven by NMDA receptors. J Neurosci 18: 6790–6802, 1998.[Abstract/Free Full Text]

Shigemoto R, Nakanishi S, and Mizuno N. Distribution of the mRNA for a metabotropic glutamate receptor (mGluR1) in the central nervous system: an in situ hybridization study in adult and developing rat. J Comp Neurol 322: 121–135, 1992.[CrossRef][Web of Science][Medline]

Spors H and Grinvald A. Spatio-temporal dynamics of odor representations in the mammalian olfactory bulb. Neuron 34: 301–315, 2002.[CrossRef][Web of Science][Medline]

Staub C, Vranesic I, and Knöpfel T. Responses to metabotropic glutamate receptor activation in cerebellar purkinje cells: induction of an inward current. Eur J Neurosci 4: 832–839, 1992.[CrossRef][Web of Science][Medline]

Stuart GJ, Dodt HU, and Sakmann B. Patch-clamp recordings from the soma and dendrites of neurons in brain slices using infrared video microscopy. Pfluegers 423: 511–518, 1993.

Tsien RY. New calcium indicators and buffers with high selectivity against magnesium and protons: design, synthesis, and properties of prototype structures. Biochemistry 19: 2396–2404, 1980.[CrossRef][Medline]

Trombley PQ and Westbrook GL. L-AP4 inhibits calcium currents and synaptic transmission via a G-protein-coupled glutamate receptor. J Neurosci 12: 2043–2050, 1992.[Abstract]

van den Pol A. Presynaptic metabotropic glutamate receptors in adult and developing neurons: autoexcitation in the olfactory bulb. J Comp Neurol 253–271, 1995.

Wada E, Shigemoto R, Kinoshita A, Ohishi H, and Mizuno N. Metabotropic glutamate receptor subtypes in axon terminals of projection fibers from the main and accessory olfactory bulbs: a light and electron microscopic immunohistochemical study in the rat. J Comp Neurol 393: 493–504, 1998.[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
J. Neurosci.Home page
H.-W. Dong, A. Hayar, J. Callaway, X.-H. Yang, Q. Nai, and M. Ennis
Group I mGluR Activation Enhances Ca2+-Dependent Nonselective Cation Currents and Rhythmic Bursting in Main Olfactory Bulb External Tufted Cells
J. Neurosci., September 23, 2009; 29(38): 11943 - 11953.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
M. L. Fletcher, A. V. Masurkar, J. Xing, F. Imamura, W. Xiong, S. Nagayama, H. Mutoh, C. A. Greer, T. Knopfel, and W. R. Chen
Optical Imaging of Postsynaptic Odor Representation in the Glomerular Layer of the Mouse Olfactory Bulb
J Neurophysiol, August 1, 2009; 102(2): 817 - 830.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
F. Ferraguti, L. Crepaldi, and F. Nicoletti
Metabotropic Glutamate 1 Receptor: Current Concepts and Perspectives
Pharmacol. Rev., December 1, 2008; 60(4): 536 - 581.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
E. Chaigneau, P. Tiret, J. Lecoq, M. Ducros, T. Knopfel, and S. Charpak
The Relationship between Blood Flow and Neuronal Activity in the Rodent Olfactory Bulb
J. Neurosci., June 13, 2007; 27(24): 6452 - 6460.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
H.-W. Dong, A. Hayar, and M. Ennis
Activation of Group I Metabotropic Glutamate Receptors on Main Olfactory Bulb Granule Cells and Periglomerular Cells Enhances Synaptic Inhibition of Mitral Cells
J. Neurosci., May 23, 2007; 27(21): 5654 - 5663.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. B. Castro, K. R. Hovis, and N. N. Urban
Recurrent Dendrodendritic Inhibition of Accessory Olfactory Bulb Mitral Cells Requires Activation of Group I Metabotropic Glutamate Receptors
J. Neurosci., May 23, 2007; 27(21): 5664 - 5671.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
T. Heinbockel, K. A. Hamilton, and M. Ennis
Group I Metabotropic Glutamate Receptors Are Differentially Expressed by Two Populations of Olfactory Bulb Granule Cells
J Neurophysiol, April 1, 2007; 97(4): 3136 - 3141.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
D. De Saint Jan and G. L. Westbrook
Disynaptic Amplification of Metabotropic Glutamate Receptor 1 Responses in the Olfactory Bulb
J. Neurosci., January 3, 2007; 27(1): 132 - 140.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
N. Laaris, A. Puche, and M. Ennis
Complementary Postsynaptic Activity Patterns Elicited in Olfactory Bulb by Stimulation of Mitral/Tufted and Centrifugal Fiber Inputs to Granule Cells
J Neurophysiol, January 1, 2007; 97(1): 296 - 306.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
T. Heinbockel, N. Laaris, and M. Ennis
Metabotropic Glutamate Receptors in the Main Olfactory Bulb Drive Granule Cell-Mediated Inhibition
J Neurophysiol, January 1, 2007; 97(1): 858 - 870.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
D. B. Rubin and T. A. Cleland
Dynamical Mechanisms of Odor Processing in Olfactory Bulb Mitral Cells
J Neurophysiol, August 1, 2006; 96(2): 555 - 568.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
Q. Yuan and T. Knopfel
Olfactory Nerve Stimulation-Evoked mGluR1 Slow Potentials, Oscillations, and Calcium Signaling in Mouse Olfactory Bulb Mitral Cells
J Neurophysiol, May 1, 2006; 95(5): 3097 - 3104.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
Q. Yuan and T. Knopfel
Olfactory Nerve Stimulation-Induced Calcium Signaling in the Mitral Cell Distal Dendritic Tuft
J Neurophysiol, April 1, 2006; 95(4): 2417 - 2426.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
M. Ennis, M. Zhu, T. Heinbockel, and A. Hayar
Olfactory Nerve-Evoked, Metabotropic Glutamate Receptor-Mediated Synaptic Responses in Rat Olfactory Bulb Mitral Cells
J Neurophysiol, April 1, 2006; 95(4): 2233 - 2241.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
H. Mutoh, Q. Yuan, and T. Knopfel
Long-Term Depression at Olfactory Nerve Synapses
J. Neurosci., April 27, 2005; 25(17): 4252 - 4259.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
D. De Saint Jan and G. L. Westbrook
Detecting Activity in Olfactory Bulb Glomeruli with Astrocyte Recording
J. Neurosci., March 16, 2005; 25(11): 2917 - 2924.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
92/5/3085    most recent
00349.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heinbockel, T.
Right arrow Articles by Ennis, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heinbockel, T.
Right arrow Articles by Ennis, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the The American Physiological Society.