|
|
||||||||
INNOVATIVE METHODOLOGY
1Solution Oriented Research for Science and Technology (SORST) Program, Japan Science and Technology Corporation, 2Division of Neurophysiology, Osaka University Graduate School of Medicine, Suita 5650871 Japan
Submitted 27 February 2004; accepted in final form 21 July 2004
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
As an alternative method of inhibiting target gene expression, RNA interference (RNAi) is a phenomenon in which 2123 nucleotides (nt) of RNA, termed siRNA, inhibit the target gene expression (Fire et al. 1998
). In respect to the specificity for a target gene and the efficacy of RNAi maintenance, the method using siRNA has great advantages over that using conventional antisense oligonucleotides in knocking down the target because siRNAs have more effective knockdown at its targets at lower concentration than antisense oligonucleotides (Brantl 2002
).
For introducing exogenous molecules such as proteins, RNA, and DNA into cells, electroporation is a convenient and efficient method (Neumann et al. 1999
). The mechanisms underlying its efficacy was suggested to comprise two steps; first electrical shocks applied to the membrane produce pores the lifetime of which is tens of seconds and then negatively charged external molecules enter into the cytosol by electrophoresis. In most cases, the targets of in vivo electroporation have been whole organs such as the liver and brain limited to chick and mouse embryonic stages (Agarwala et al. 2001
; Fukuchi-Shimogori and Grove 2003
; Inoue and Krumlauf 2001
; Sukharev et al. 1992
). Electroporation at embryonic stages possibly affects the fate of proteins other than the target protein as mentioned in the preceding text.
To overcome the above-mentioned problems in systemic knockout manipulation, we have developed a novel method by which siRNA is introduced into a restricted target brain region by electroporation using two needle electrodes. This method is termed RNAi-induced gene silencing by local electroporation, RISLE.
| METHODS |
|---|
|
|
|---|
Sprague Dawley (SD) rats, ranging in age from postnatal days 15 to 20 (P15P20), were used. The animals were raised with water and food ad libitum and kept on 12-h light/dark cycle. The experimental procedures were in accordance with the regulations of the Animal Care Committee of Osaka University Graduate School of Medicine. The rats were anesthetized with an intraperitoneal injection of pentobarbital sodium (Nembutal, Abbot Laboratories, North Chicago, IL) at 2030 mg/kg and placed in a stereotaxic frame. Anesthesia was maintained throughout experiments by injecting a supplemental dose of pentobarbital sodium (Nembutal, 0.51 mg/h) if necessary to keep the level of anesthesia. Rectal temperature was maintained at 37 ± 0.5°C with a servo-heating pad. An appropriate dose of atropine sulfate (0.5 mg/kg) was injected subcutaneously to reduce respiratory secretions, and heart rate was monitored continuously to ensure preparation stability.
Preparation of siRNA
To design the target siRNA sequences of iRGluR2 and iRCox-1 and ascertain the uniqueness of these sequences, the NCBI library and NCBI nucleotide BLAST were referred to. Four sites were selected for each target, and the following oligonucleotide templates were used iRGluR2a (sense): AAGGGGCGCTGATCAAGAATACCTGTCTC; iRGluR2a (antisense): AATATTCTTGATCAGCGCCCCCCTGTCTC; iRGluR2b (sense): AACAGTTTCGCAGTCACCAATCCTGTCTC; iRGluR2b (antisense): AAATTGGTGACTGCGAAACTGCCTGTCTC; iRGluR2c (sense): AAGGAGCACTCCTTAGCTTG ACCTGTCTC; iRGluR2c (antisense): AATCAAGCTAAGGAGTGCTCCCCTGTCTC; iRGluR2d (sense): AAGCTGTTCTGGATTCTGCTGCCTGTCTC; iRGluR2d (antisense): AACAGCAGAATCCAGAACAGCCCTGTCTC; iRCox-1a (sense): AACCCAGGGTGTCTGTGTCCGCCCTGTCTC; iRCox-1a (antisense): AAGCGGACACAGACACCCTGGCCTGTCTC; iRCox-1b (sense): AACTGTACTATCCCTGAGATC CCTGTCTC; iRCox-1b (antisense): AAGATCTCAGGGATAGTACAGCCTGTCTC; iRCox-1c (sense): AAGTACTCATGGGCTGGGTACCCTGTCTC; iRCox-1c (antisense): AAGTACCCAGCCCATGAGTACCCTGTCTC; iRCox-1d (sense): AACCTACAACACAGCACATGACCTGTCTC; iRCox-1d (antisense): AATCATGTGCTGTGTTGTAGGCCTGTCTC.
The oligonucleotide templates were annealed and then filled in with Klenow DNA polymerase according to the manufacturers instructions (Silencer siRNA construction kit, Ambion). The double-stranded oligonucleotide templates were transcribed with T7 RNA polymerase and hybridized. After RNase digestion, a cocktail of four types of iRGluR2 or iRCox-1 was used for the experiments.
Injection of siRNA and electroporation
P15P20 SD rats were used in the experiments. After the rats were anesthetized, three adjacent perforations of 2-mm diam were made on the skull using a dental drill (Fig. 1A); the middle hole was for the injection of siRNA and the others for the insertion of electrodes for electroporation. The stereotaxic coordinates for injections were as follows: for the visual cortex, 4.85.2 mm posterior to the bregma, 1.52.0 mm lateral to the midline, and 0.50.6 mm in depth; and for the hippocampus (CA1 region), 3.84.0 mm posterior to the bregma, 1.52.0 mm lateral to the midline, and 2.52.8 mm in depth. Solutions containing siRNAs were applied to the target region through the middle pore of the skull with RNase-free polyethylene tubes connected to a Hamilton syringe by a microinfusion pump. To prepare stimulation electrodes for electroporation, a pair of parallel stimulating electrodes (CUY567, Nepa Gene) excluding the tips were coated with EPICO (NOF), which acts as an isolator and produces a film of
5 µm width of film with a noncoated 2-mm tip (Fig. 1B). This coating minimized damage to the tissue and was adjustable depending on the volume or shape of the target region. These electrodes at 5-mm intervals were inserted. Electric pulses were produced with an electric stimulator (Nihon Koden) through an isolator (SS-201J, Nihon Koden), followed by visualization through an oscilloscope (VC-11, Nihon Koden).
|
Western blot analysis
Under a microscope, the tissue including the siRNA injection site and the contralateral control tissue were cut into 2-mm cubes in cold PBS containing heparin on ice. The tissues were homogenized with 15 strokes in 300 µl of lysis buffer containing 25 mM HEPES, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, adequate concentration of complete protein inhibitor (Roche), and 0.7 µg/ml pepstatin in a 2-ml glass syringe on ice and then incubated with shaking for 30 min at 4°C, followed by centrifugation at 15,600 g for 10 min at 4°C. The supernatant was then used for Western blot analysis, and one portion of the supernatant was used for protein level determination using the Bio-Rad protein assay (Bio-Rad). After boiling for 3 min, the supernatants in 62.5 mM Tris-HCl (PH6.8), 19% glycerol, 2.3% SDS, 0.01% bromphenol blue, and 0.5%
-mercaptoethanol were loaded to SDS-PAGE for separation, followed by the transfer of separated products to a nitrocellulose membrane. After incubation in PBS with 5% skimmed milk and 0.1% Tween 20 (T-PBS), the membrane was incubated with the primary antibody in T-PBS with shaking for 2 h. The dilutions of the primary antibodies used were as follows: anti-GluR1 antibody (Chemicon), 1:500; anti-GluR2 antibody (Chemicon), 1:500; anti-NR1 antibody (BD Biosciences), 1:500; anti-Cox-1 antibody (Cayman), 1:500; anti-Cox-2 antibody (Cayman), 1:500; anti-GRIP1 antibody (C-20)(Santa Cruz), 1: 200; anti-GRIP2 antibody (K-17) (Santa Cruz), 1:200; and anti-
-tubulin antibody (Sigma), 1:15,000. After washing three times with T-PBS, the membrane was exposed to the anti-mouse (Amersham Biosciences, Piscataway, NJ), anti-rabbit (Amersham Biosciences), or anti-goat (Santa Cruz) peroxidase-conjugated IgG secondary antibody (0.7 µg/ml) or 1 h. After washing four times with T-PBS, the membrane was developed using ECL Western blotting detector reagents (Amersham Biosciences).
For Western blot and quantitative real-time PCR analyses, the expressions were normalized to the contralateral side of the RISLE-subjected tissue (electroporation-subjected side without siRNA) except for the experiment in Fig. 3E. The analyses were performed 57 days after electroporation unless otherwise mentioned.
|
The tissues around the RISLE and contralateral sites were removed and stored in RNAlater stabilization reagent (Quiagen) at 80°C. The tissues were cut into pieces with scalpels; the pieces were put in a cold lysis buffer, and then passed through a 20-gauge needle. Using an RNeasy minikit (Quiagen), total RNA was prepared using these lysates according to the manufacturers instructions.
To construct cDNA, the template RNA was incubated with 4 u/reaction Omniscriot reverse transcriptase (Quiagen), dNTP mix (5 mM, for each dNTP), 1 µM oligo-dT primer (Roche), and 10 u/reaction RNase inhibitor for 1 h at 37°C. Then to inactivate reverse transcriptase, the reaction mixture was incubated at 93°C for 5 min, followed by rapid cooling on ice.
For quantitative real-time PCR, the primers and TaqMan probes for GluR2 and Cox-1 were designed and synthesized according to Assay-by-Design (Applied Biosystems, ABI). The sequences used were as follows: TaqMan probe for Cox-1: CCGCATCGCCATGGAATTCAACC; 5' primer for Cox-1: CGAGCCCAGTTCCAGTATCG; 3' primer for Cox-1: TGAACGGATGCCAGTGATAGAG; TaqMan probe for GluR2: TGCATTCAGCCAGTCCTCGGGAC; 5' primer for GluR2: ATGGGAGGGTGCTGATATTCC; 3' primer for GluR2: AGTTGTAGCTGGTGGCTGTTGA.
The TaqMan probes have FAM as the reporter at the 5' end and TAMRA as the quencher at the 3' end. For endogenous control, TaqMan rodent GAPDH control reagents (ABI) were used. The template cDNA in the TaqMan Universal PCR Master Mix (ABI) was amplified using an ABI PRISM 7900HT sequence detection system. The conditions for the PCR run were as follows: 50°C for 2 min and 95°C for 10 min; 95°C for 15 s followed by 60°C for 1 min for 40 cycles; and storage at 25°C. The data were normalized to the data from GAPDH cDNA by comparative CT analysis.
Immunohistochemistry
After anesthetizing, the rats were transcardially perfused with 4% paraformaldehyde in PBS, followed by incubation with 10% sucrose in PBS. The tissues were sectioned with a freezing microtome (JUNG SM200R, Leica) at 6080 µm thickness, followed by permeabilization in PBS with 0.2% Triton X-100 for 5 min. After blocking with 5% skimmed milk in PBS, the sections were incubated with the anti-GluR2 (1: 200; Chemicon) or Cox-1 (1: 100; Cayman) antibody at 4°C for 2448 h. The immunohistochemical reaction was developed using the Vectastain ABC kit (Vector Laboratory, Burlingame, CA).
Estimation of cell death
The injection sites of glutamate and actinomycin D (AcD) were stereotaxically determined in the visual cortex. The electroporation stimulation electrodes were inserted on the contralateral side, and focal electroporation was performed with iRGluR1 or iRCox-1. After 5 days, for apoptosis detection, fixation, sectioning, permeabilization, and visualization were performed as described in the immunohistochemistry section. Using an in situ cell-death-detection kit, POD (Roche), sections on a cover glass were incubated with fluorescein-12-dUTP at 37°C for 1 h. After washing, the sections were incubated with the anti-fluorescein antibody conjugated with HRP. For propium iodide (PI) uptake determination, the visual cortex including the injection site was removed and placed in artificial cerebrospinal fluid (ACSF) saturated with 95% O2-5% CO2. The composition of ACSF was as follows (in mM): 124 NaCl, 5 KCl, 1.2 KH2PO4, 1.3 MgSO4, 2.4 CaCl2, and 10 glucose. The tissues were sectioned into coronal slices of 400 µm thickness with a rotor slicer (DTY7000, Dosaka), and the sections were incubated with ACSF including 5 µg/ml PI for 30 min. After washing, images of the sections were taken through a confocal microscope.
Analysis for OAS1 expression
RISLE was performed for the visual cortex with iRGluR2 or iRCox-1. The preparation for cDNA and the subsequent quantitative real-time PCR for OAS1 were carried out with Assay on demand kit (Applied Bioscience) as described in the preceding text.
Preparation of synaptoneurosomes and measurement of glutamate release
The visual cortex on the RISLE and contralateral sides were gently homogenized on ice in a glass homogenizer containing a solution with (in mM) 125 NaCl, 5 KCl, 1 MgCl2, 1.2 Na2HPO4, 10 glucose, and 20 HEPES/NaOH, pH 7.4. These lysate solutions were filtered sequentially through two layers of 100-µm pore-size nylon mesh and a 5-µm filter followed by centrifugation at 1,000 g at 4°C for 10 min.
Glutamate release from synaptoneurosomes was measured using an enzyme-coupled fluorometric assay with some modifications (Sihra et al. 1992
). The suspension of synaptoneurosomes was stirred at 37°C, followed by the addition of a solution (final concentration) of NADP (1 mM), glutamate dehydrogenase (50 units/ml), and CaCl2 (1 mM). After 3 min, KCl (30 mM) or brain-derived neurotrophic factor (BDNF; 200 ng/ml) was added to the solution. Fluorescence was monitored using a spectrofluorimeter at 340 nm (excitation) and 460 nm (emission).
Electrophysiology in vivo
For stimulating the lateral geniculate nucleus (LGN), a bipolar stimulation electrode was inserted at the stereotaxic coordinates of 4.0 mm posterior to the bregma and 3.54.0 mm lateral to the midline. The tip of the electrode was adjusted to its most suitable depth at which maximal field responses to flashes of light presented to the eye contralateral to the LGN are observed. For the monopolar recording of cortical field potentials near the RISLE area in visual cortex, a single-barrel borosilicate glass micropipette filled with 3 M NaCl was placed 5.86.0 mm posterior to bregma, 4.04.2 mm lateral to the midline and in layer II/III of the cortex by lowering it vertically 0.5 mm below the pial surface.
Field potentials were evoked by single-shock stimuli of 0.2-ms duration at an intensity of 0.20.9 mA as described previously (Jiang et al. 2001
, 2003
). The evoked potentials were amplified and filtered at 0.13 kHz, digitized at 20 kHz, and stored using PowerLab software (AD Instruments). To determine the intensity of stimulation in the experiments, a full input-output curve was plotted. The intensity yielding amplitude of potentials at 5060% of the maximal potentials was used in the experiments.
Electrophysiology in vitro
The experiments were carried out as previously described (Akaneya et al. 1996
, 1997
). After anesthetizing the rats, the region of the visual cortex between two electroporation scars was quickly removed and placed in chilled ACFC saturated with 95% O2-5% CO2. The tissues were sectioned into coronal slices of 400 µm thickness with a rotor slicer, followed by incubation for >1 h at room temperature. For recording field potentials, a glass micropipette filled with 0.5 M sodium acetate and 2% pontamine sky blue (<4 M
) was inserted into the layer II/III, whereas a bipolar stimulation electrode was placed in the layer IV. The evoked potentials to stimuli of 0.2-ms duration at an intensity of 15300 µA were amplified and filtered at 0.13 kHz and digitized at 20 kHz. For theta-burst (TB) stimulation and low-frequency stimulation (LFS) in vivo and in vitro, the following paradigms were used: five sets of stimulation at 0.1 Hz of 10 times, stimulation at 5 Hz of 4 times, pulse of 10-ms duration at 100 Hz, and one set of stimulation of 0.2-ms duration at 1 Hz for 15 min, respectively.
| RESULTS |
|---|
|
|
|---|
For RISLE, we used two electrical pulses, the preceding poring pulse and the following driving pulse (Fig. 1C) and determined the most effective values of parameters of electrical pulses for the knockdown of GluR2, that is, the voltage and duration of the poring pulse (Vp and Dp, respectively, in Fig. 1C) and those of the driving pulse (Vd and Dd, respectively, in Fig. 1C). In preliminary experiments, we assumed that the most effective values are as follows; Vp > 100 V/cm, Dp
1 ms, Vd > 2 V/cm, and Dd
2 s. First, we altered the voltage of the poring pulse (Vp) at fixed values of the other parameters (Dp = 1 ms, Vd = 2 V/cm, Dd = 2 s). The results showed that 100 and 200 V/cm can reduce GluR2 expression level most effectively (the value decreased to 31.2% of control; Fig. 2A), while 10 V/cm was slightly effective (the value decreased to 72.4% of control; Fig. 2A). Regarding the investigation at fixed values of parameters (Vp = 100 V/cm, Vd = 2 V/cm, Dd = 2 s), the effects of poring pulse duration (Dp) seemed not so much different in the duration examined, but 2 ms appears to be the most effective (the value decreased to 22.5% of control; Fig. 2B). Next, the voltage (Vd) and duration (Dd) of the driving pulse were changed at a fixed poring pulse (Vp = 100 V/cm, Dp = 2 ms). For Vd, values of >2 V/cm are the most effective (27.4 ± 17.4 at 2 V/cm, n = 4, P < 0.005 in comparison with the control by ANOVA; Fig. 2C) at a fixed Dd of 2 s. For Dd at a fixed Vd of 2 V/cm, values of >2 s are the most effective (the value decreased to 32.7% of control; Fig. 2D), but the effect of 0.5-s duration is not significant (the value decreased to 87.5% of control; Fig. 2D). Thereafter Vp = 100 V/cm, Dp = 1 ms, Vd = 2 V/cm, and Dd = 2 s were used throughout the experiments.
|
Time course of effect of RISLE on mRNA expression
To test the effect of RISLE on the level of mRNA with time, we performed quantitative real-time PCR analysis to determine the level of cDNA, which was reverse-transcribed from the mRNA obtained from a portion of tissues distributed between two electrodes. For the siRNA of iRGluR2 or iRCox-1, its effects were manifested by the inhibition of half of the expression level even one day after electroporation (the values decreased to 63.2 and 51.9% of control for GluR2 and Cox-1, n = 4 and 3, respectively; Fig. 2F). Three to 6 day after surgery, the levels of cDNAs encoding Cox-1 and GluR2 decreased markedly, (the values decreased to 23.2 and 17.2% of control at 6 day after electroporation for GluR2 and Cox-1, n = 5 and 5, respectively; Fig. 2F). However, this effect of RISLE became weaker after 6 day (the values decreased to 73.2 and 64.1% of control at 2 wk after electroporation for GluR2 and Cox-1, n = 3 and 4; Fig. 2E) and returned to nearly the same level as that before electroporation (the value decreased to 87.5 and 92.4% of control for GluR2 and Cox-1, n = 3 and 3, respectively; Fig. 2F). These indicate that the effect of RNAi is rapid and strong on mRNA expression level, in spite of the comparatively long life spans of ubiquitous proteins such as Cox-1 and of limbic membrane-associated proteins such as GluR2. Thus the delayed effect of RNAi on mRNA expression level may be due to residual proteins the naturally occurring degeneration of which is relatively slow. However, it was found that the effect of RISLE is transient. Therefore we used the samples 57 day after electroporation throughout the experiments except for the time course experiments.
Specificity of siRNA
To confirm that the scrambled siRNAs used were necessary, we checked the comparison of the efficacy of mRNA depletion from individual different siRNA duplexes for the RISLE targeting visual cortex. Consequently, each siRNAs duplexes had an effect on the knockdown of the target mRNA of GluR2 or Cox-1 at
50% (n = 34; Fig. 3). However, it has been elucidated that the cocktails of all the four siRNA duplexes have the strongest effect on the knockdown of the target mRNAs. These results confirm the specificity for the scrambled siRNAs used.
RISLE has no effects on expression of proteins other than the target
To determine whether the effect of RISLE is specific for the target protein, we examined the levels of proteins other than the target protein, including homologous proteins in the visual cortex after RISLE. We analyzed Cox-2, the expression of which is enhanced by long-term potentiation (LTP) in an activity-dependent manner; Cox-2 is also ubiquitously found in small amounts in the brain (Yamagata et al. 1993
). Moreover, we analyzed GluR1 and NR1, both of which play important roles in LTP and long-term depression (LTD); glutamate receptor interacting protein 1 (GRIP1) and glutamate receptor interacting protein 2 (GRIP2), both of which can associate with GluR2 (Barry and Ziff 2002
); and
-tubulin as a control. Consequently, we found that the expression levels of Cox-2, GluR1, NR1, GRIP1, GRIP2, or
-tubulin protein are not significantly affected by RISLE, whereas the levels of target proteins markedly decrease when RISLE is carried out using the target siRNA (Fig. 4). This suggests that the effect of RISLE is target-specific and that the decrease in the expression level of a target protein by RISLE is not accompanied by a change in the expression levels of nontarget proteins.
|
To investigate the range of effect of RISLE, immunohistochemistries were performed 6 day after electroporation using siRNA of iRGluR2 or iRCox-1. The effects of RISLE were exclusively observed in the region to which RISLE was applied. The area where expression was attenuated was
12 mm wide (Fig. 5, A, C, and D) and fully distributed between the two electrodes, the width of which was 5 mm (Fig. 5B), with a strong effect of RNAi around the siRNA injection site. In particular, the expression level of GluR2 or Cox-1 in pyramidal cells in the CA1 region of the hippocampus was exclusively reduced when RISLE was applied stereotaxically to the CA1 region of the hippocampus (Fig. 5, C and D).
|
Because too-strong electrical pulses of electroporation induce pathological changes, we examined whether cell death occurs in the tissues subjected to RISLE. Apoptotic cells show the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive change in the nucleus. When AcD, known to induce apoptosis (Hatayama et al. 2001
), was injected into the visual cortex, apoptosis occurred around the injection site, although no significant apoptotic change was observed on the contralateral side of RISLE with iRGluR2 (Fig. 6A).
|
Some studies have shown that some siRNA may induce interferon-stimulated genes in vitro (Bridge et al. 2003
; Sletz et al. 2003
). Therefore we measured the expression of OAS1, a classic interferon target gene. The expression levels of OAS1 in the tissue of the visual cortex subjected to RISLE with iRGluR1 or iRCox-1 were less than twofold that of OAS1 in the tissue of the visual cortex subjected only to RISLE without siRNAs (Fig. 6C). It has been reported that OAS1 is induced by >50-fold on activation of an interferon response (Bridge et al. 2003
). Therefore it has been found that the siRNAs used in the current study have no significant effect on inducing interferon-stimulated gene.
Analysis for glutamate release
The subcellular location of GluR2 is limited to postsynaptic sites (Petralia and Wenthold 1992
). To determine whether synapses in GluR2-knockdown rats subjected to RISLE have intact functions such as glutamate release, glutamate release from synaptoneurosomes induced by KCl or the BDNF was measured (Fig. 7A). Synaptoneurosomes on the control side showed the effects of KCl or BDNF on the release of glutamate consistent with previous papers (Jovanovic et al. 2000
; Sihra et al. 1992
); those from the RISLE-subjected region of GluR2-knockdown rats showed similar effects. This suggests that presynaptic functions such as glutamate release from synaptic terminals are intact even when the expression level of GluR2 is reduced.
|
We investigated whether electrophysiological phenomena can be induced in GluR2-knockdown rats by RISLE. Our previous studies have shown that in the visual cortex, LTP in vivo increases to
120% of the baseline, and LTD in vivo is absent without the blockade of endogenous BDNF (Jiang et al. 2001
, 2003
). Similarly, the effects of electroporation without siRNA on LTP in the visual cortex was almost the same as those observed in the control, and LTD was not induced in the electroporation-subjected visual cortex without siRNA (Fig. 7B). Previous genetic manipulation studies showed that LTP in GluR2-knockout mice is greater than that of the wild-type and that the basic transmission of evoked field potential is greatly decreased, although LTD is not affected (Jia et al. 1996
; Meng et al. 2003
). In the present study, in vivo LTP in GluR2-knockdown rat increased to
150% and the basic transmission of evoked field potential was significantly reduced (the value decreased to 58.3% of control, n = 11; Fig. 7B), whereas in vivo LTD was not affected (Fig. 7B).
To examine the effect of RISLE on electrophysiological responses in vitro, LTP and LTD were investigated using acute slices of the visual cortex transfected with or without iRGluR2 by RISLE. Previous works including ours have shown that LTP and LTD in the visual cortex in vitro increase to
115120% and decrease to 7080% of the baseline, respectively (Akaneya et al. 1996
, 1997
). Similar to these studies in vivo, LTP in the visual cortex transfected with iRGluR2 by RISLE increased to
150%, and the basic transmission of evoked field potential was significantly reduced (the value decreased to 43.9% of control, n = 12; Fig. 7B). Moreover, the effects of RISLE with iRGluR2 on LTD were almost the same as those of electroporation without siRNA (Fig. 7B). Also unlike the finding from GluR2-knockdown rats, the basic transmission of evoked field potential in Cox-1-knockdown rats was normal (data not shown), suggesting that the reduction in the basic transmission of evoked field potential in GluR2-knockdown rats is due to the RNAi of iRGluR2 and not to RISLE on its own. These results suggest that RISLE per se is applicable to electrophysiological experiments as confirmed by the consistency of the results between conventional KO studies and the present study.
| DISCUSSION |
|---|
|
|
|---|
RNAi is a powerful tool for gene knockdown. However, double-stranded RNA (dsRNA) >30 nucleotides activates a dsRNA-dependent protein kinase, which leads to the activation of the type-1 interferon-response, global shutdown of translation, and final marked alteration in cellular metabolism (Gil and Esteban 2000
). Recent works showed that some siRNAs induce interferon-stimulated genes in mammalian cells in vitro (Bridge et al. 2003
; Sletz et al. 2003
). However, it remains unknown whether siRNA induces interferon response genes in vivo. The introduction of siRNAs into the rat brain in vivo did not lead to the significant activation of interferon-response genes such as OAS1. Therefore it can be said that siRNAs such as iRGluR2 and iRCox-1 can be safely introduced into the brain in vivo. To ascertain the safe introduction of other siRNA in vivo, further investigation is necessary.
The major disadvantage of electroporation is the need to increase voltage to enhance the efficiency of transfection, which may increase the possibility of inducing cell death (Itasaki et al. 1999
). Strong electrical shocks increase the effectiveness of transfection by increasing the size and number of pores in the membrane but spontaneously enhance cell death. This is due to the increased toxicity following the influx of external media, generation of free radicals (Bonnafous et al. 1999
) and vascular effects (Gehl et al. 2002
). When the lifetime of pores is prolonged by electric pulses of long duration, intracellular contents may leak out of the membrane (Gehl et al. 1999
). The voltage used in previous studies is extremely higher than that in the present study (Itasaki et al. 1999
). A similar technique using electroporation and siRNAs has been reported recently, although the prolonged duration of high-voltage electrical shocks used in that study may have induced pathological changes not only in the target but also in the nontarget regions between which tweezers-type electrodes were placed (Matsuda and Cepko 2004
). The main reason for the avoidance of pathological changes following RISLE in spite of the success of this method in a wide range of knockdown may be the use of very weak electric pulses, unlike those used in conventional methods of electroporation. In other in vivo electroporation studies, the parameters of the electrical pulse with 10- to 90-V intensity and >50-ms duration are generally used (Itasaki et al. 1999
). In this study, we used a combination of the preceding electrical pulse of high intensity and short duration (poring pulse) and the following electrical pulse of low intensity and long duration (driving pulse). The two electrical pulses have their own respective task. It is presumed that the poring pulse opens the pore in the membrane, and the driving pulse leads extracellular siRNAs to enter the cytosol. The intensity of the poring pulse is remarkably higher than that of the single electrical pulse used in other studies, whereas the duration of the poring pulse is extremely shorter than that of the single electrical pulse used in other studies. The short duration of the poring pulse and the low intensity of the driving pulse decrease the strength of the electrical pulse, in spite of the high intensity and long duration of these pulses, respectively. These are effective for decreasing the damage of tissue subjected to electroporation. On the other hand, the high intensity of the poring pulse and the long duration of the driving pulse are important for the distinct roles of these pulses.
Another advantage of RISLE is that there is a limited region for the knockdown. In other in vivo and in ovo electroporation studies, electroporation is subjected systemically or to all organs such as the brain, liver, kidneys, or muscles. This may induce damage to a wide range of body organs and lead to the difficulty in limiting the target region for knockdown. The RISLE also may have some difficulty to limit existing region of siRNAs by introducing the siRNAs to the target region. However, RISLE can control the knockdown region by altering the width of each electrode in a pair. Thus the knockdown of the off-target region can be prevented by RISLE.
It is possible to accommodate the knockdown region by inserting the electrodes after the systemic administration of siRNAs. Unlike in the case of the viral vectors, however, it is difficult for siRNAs to pass the blood brain barrier to reach the target cells (Trülzsch and Wood 2004
). Therefore the direct injection of siRNAs into the target region may be better than systemic administration.
The emergence and maintenance of effect of RNAi depend on species and siRNAs used. The effect of RISLE was transient and was most effective 1 wk after electroporation. This is due to the apparent lack of mechanisms for amplifying silencing unlike in the cases of worms and plants (Wall and Shi 2003
). To overcome this disadvantage of RISLE, it may be effective to use several plasmid-vector systems that produce short-hairpin RNAs that are driven by promoters dependent on RNA polymerase III (Pol III) (Paddison et al. 2002
; Sui et al. 2002
) or Pol II (Shinagawa and Ishii 2003
; Xia et al. 2002
).
RISLE is expected to have experimental applications. Depending on the volume, shape and distribution of the region to be knocked down, the isolation-free length at the tip should be changed by coating or removing EPICO, and the amount of siRNA, injecting-duration delayed application of electric shocks after injecting siRNA, and stereotaxical determination of the target region should be changed. It is possible to use RISLE in establishing animal models of diseases, for example, producing a model for ischemia, Parkinsons disease, or Alzheimers disease by introducing the siRNAs of related genes into a specific region. The alternative applications of reducing the expression level of a target protein, on the other hand, include the clinical treatment of diseases and gene therapy. As a phenotype for gene therapy, RISLE may be used in the therapy of diseases caused by abnormal proteins and may be available for not only small target regions but also other substantial organs such as the liver, kidneys, and muscles.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: Y. Akaneya, Division of Neurophysiology, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita 565-0871, Japan (E-mail: akaneya{at}nphys.med.osaka-u.ac.jp)
| REFERENCES |
|---|
|
|
|---|
Akaneya Y, Tsumoto T, and Hatanaka H. Brain-derived neurotrophic factor blocks long-term depression in rat visual cortex. J Neurophysiol 76: 41984201, 1996.
Akaneya Y, Tsumoto T, Kinoshita S, and Hatanaka H. Brain-derived neurotrophic factor enhances long-term potentiation in rat visual cortex. J Neurosci 17: 67076716, 1997.
Baker-Herman TL, Fuller DD, Bavis RW, Zabka AG, Golder FJ, Doperalski NJ, Johnson RA, Watters JJ, and Mitchell G. BDNF is necessary and sufficient for spinal respiratory plasticity following intermittent hypoxia. Nat Neurosci 7: 4855, 2004.[CrossRef][Web of Science][Medline]
Barry MF and Ziff EB. Receptor trafficking and the plasticity of excitatory synapses. Curr Opin Neurobiol 12: 279286, 2002.[CrossRef][Web of Science][Medline]
Bonnafous P, Vernhes M, Teissie J, and Gabriel B. The generation of reactive-oxygen species associated with long-lasting pulse-induced electropermeabilization of mammalian cells is based on a non-destructive alteration of the plasma membrane. Biochim Biophys Acta 1461: 123134, 1999.[Medline]
Brantl S. Antisense-RNA regulation and RNA interference. Biochim Biophys Acta 1575: 1525, 2002.[Medline]
Bridge AJ, Pebernard S, Ducraux A, Nicoulaz AL, and Iggo R. Induction of an interferon response by RNAi vectors in mammalian cells. Nat Genet 34: 263264, 2003.[CrossRef][Web of Science][Medline]
Choi DW, Maulucci-Gedde M, and Kriegstein AR. Glutamate neurotoxicity in cortical cell culture. J Neurosci 7: 357368, 1987.[Abstract]
Ehrengruber MU, Hennou S, Bueler H, Naim HY, Deglon N, and Lundstrom K. Gene transfer into neurons from hippocampal slices: comparison of recombinant Semliki Forest Virus, adenovirus, adeno-associated virus, lentivirus, and measles virus. Mol Cell Neurosci 17: 855871, 2001.[CrossRef][Web of Science][Medline]
Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, and Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391: 806811, 1998.[CrossRef][Medline]
Fukuchi-Shimogori T and Grove EA. Emx2 patterns the neocortex by regulating FGF positional signaling. Nat Neurosci 6: 825831, 2003.[CrossRef][Web of Science][Medline]
Gehl J, Skovsgaard T, and Mir LM. Vascular reactions to in vivo electroporation: characterization and consequences for drug and gene delivery. Biochim Biophys Acta 1569: 5158, 2002.[Medline]
Gehl J, Sorensen TH, Nielsen K, Raskmark P, Nielsen SL, Skovsgaard T, and Mir LM. In vivo electroporation of skeletal muscle: threshold, efficacy and relation to electric field distribution. Biochim Biophys Acta 1428: 233240, 1999.[Medline]
Gil J and Esteban M. Induction of apoptosis by the dsRNA-dependent protein kinase (PKR): mechanism of action. Apoptosis 5: 107114, 2000.[CrossRef][Web of Science][Medline]
Glogauer M and McCulloch CA. Introduction of large molecules into viable fibroblasts by electroporation: optimization of loading and identification of labeled cellular compartments. Exp Cell Res 200: 227234, 1992.[CrossRef][Web of Science][Medline]
Hatayama T, Yamagishi N, Minobe E, and Sakai K. Role of hsp105 in protection against stress-induced apoptosis in neuronal PC12 cells. Biochem Biophys Res Commun 288: 528534, 2001.[CrossRef][Web of Science][Medline]
Inoue T and Krumlauf R. An impulse to the brain-using in vivo electroporation. Nat Neurosci 4: 11561158, 2001.
Itasaki N, Bel-Vialar S, and Krumlauf R. "Shocking" developments in chick embryology: electroporation and in ovo gene expression. Nat Cell Biol 1: E203207, 1999.[CrossRef][Web of Science][Medline]
Jia Z, Agopyan N, Miu P, Xiong Z, Henderson J, Gerlai R, Taverna FA, Velumian A, MacDonald J, Carlen P, Abramow-Newerly W, and Roder J. Enhanced LTP in mice deficient in the AMPA receptor GluR2. Neuron 17: 945956, 1996.[CrossRef][Web of Science][Medline]
Jiang B, Akaneya Y, Hata Y, and Tsumoto T. Long-term depression is not induced by low-frequency stimulation in rat visual cortex in vivo: a possible preventing role of endogenous brain-derived neurotrophic factor. J Neurosci 23: 37613770, 2003.
Jiang B, Akaneya Y, Ohshima M, Ichisaka S, Hata Y, and Tsumoto T. Brain-derived neurotrophic factor induces long-lasting potentiation of synaptic transmission in visual cortex in vivo in young rats, but not in the adult. Eur J Neurosci 14: 12191228, 2001.[CrossRef][Web of Science][Medline]
Janson CG, McPhee SW, Leone P, Freese A, and During MJ. Viral-based gene transfer to the mammalian CNS for functional genomic studies. Trends Neurosci 24: 706712, 2001.[CrossRef][Web of Science][Medline]
Jovanovic JN, Czernik AJ, Fienberg AA, Greengard P, and Sihra TS. Synapsins as mediators of BDNF-enhanced neurotransmitter release. Nat Neurosci 3: 323329, 2000.[CrossRef][Web of Science][Medline]
Matsuda T and Cepko CL. Electroporation and RNA interference in the rodent retina in vivo and in vitro. Proc Natl Acad Sci USA 101: 1622, 2004.
Meng Y, Zhang Y, and Jia Z. Synaptic transmission and plasticity in the absence of AMPA glutamate receptor GluR2 and GluR3. Neuron 39: 163176, 2003.[CrossRef][Web of Science][Medline]
Mir LM, Bureau MF, Gehl J, Rangara R, Rouy D, Caillaud JM, Delaere P, Branellec D, Schwartz B, and Scherman D. High-efficiency gene transfer into skeletal muscle mediated by electric pulses. Proc Natl Acad Sci USA 96: 42624267, 1999.
Neumann E, Kakorin S, and Toensing K. Fundamentals of electroporative delivery of drugs and genes. Bioelectrochem Bioenerg 48: 316, 1999.[CrossRef][Web of Science][Medline]
Paddison PJ, Caudy AA, Bernstein E, Hannon GJ, and Conklin DS. Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 16: 948958, 2002.
Petralia RS and Wenthold RJ. Light and electron immunocytochemical localization of AMPA-selective glutamate receptors in the rat brain. J Comp Neurol 318: 329354, 1992.[CrossRef][Web of Science][Medline]
Shinagawa T and Ishii S. Generation of Ski-knockdown mice by expressing a long double-strand RNA from an RNA polymerase II promoter. Genes Dev 17: 13401345, 2003.
Sihra TS, Bogonez E, and Nicholls DG. Localized Ca2+ entry preferentially effects protein dephosphorylation, phosphorylation, and glutamate release. J Biol Chem 267: 19831989, 1992.
Sletz CA, Holko M, de Veer MJ, Silverman RH, and Williams BR. Activation of the interferon system by short-interfering RNAs. Nat Cell Biol 5: 834839, 2003.[CrossRef][Web of Science][Medline]
Sui G, Soohoo C, Affar el B, Gay F, Shi Y, Forrester WC, and Shi Y. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci USA 99: 55155520, 2002.
Sukharev SI, Klenchin VA, Serov SM, Chernomordik LV, and Chizmadzhev YuA. Electroporation and electrophoretic DNA transfer into cells. The effect of DNA interaction with electropores. Biophys J 63: 13201327, 1992.[Web of Science][Medline]
Trülzsch B and Wood M. Applications of nucleic acid technology in the CNS. J Neurochem 88: 257265, 2004.[Web of Science][Medline]
Tsien JZ, Chen DF, Gerber D, Tom C, Mercer EH, Anderson DJ, Mayford M, Kandel ER, and Tonegawa S. Subregion- and cell type-restricted gene knockout in mouse brain. Cell 87: 13171326, 1996.[CrossRef][Web of Science][Medline]
Verspohl EJ, Kaiserling-Buddemeier I, and Wienecke A. Introducing specific antibodies into electropermeabilized cells is a valuable tool for eliminating specific cell functions. Cell Biochem Funct 15: 127134, 1997.[CrossRef][Web of Science][Medline]
Wall NR and Shi Y. Small RNA: can RNA interference be exploited for therapy? Lancet 362: 14011403, 2003.[CrossRef][Web of Science][Medline]
Xia H, Mao Q, Paulson HL, and Davidson BL. siRNA-mediated gene silencing in vitro and in vivo. Nat Biotechnol 20: 10061010, 2002.[CrossRef][Web of Science][Medline]
Yamagata K, Andreasson KI, Kaufmann WE, Barnes CA, and Worley PF. Expression of a mitogen-inducible cyclooxygenase in brain neurons: regulation by synaptic activity and glucocorticoids. Neuron 11: 371386, 1993.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
A.-J. Li, Q. Wang, T. T. Dinh, and S. Ritter Simultaneous Silencing of Npy and Dbh Expression in Hindbrain A1/C1 Catecholamine Cells Suppresses Glucoprivic Feeding J. Neurosci., January 7, 2009; 29(1): 280 - 287. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jagannath and M. Wood RNA interference based gene therapy for neurological disease Brief Funct Genomic Proteomic, May 3, 2007; (2007) elm005v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Mack, M. Wu, P. Kc, and M. A. Haxhiu Stimulation of the hypothalamic paraventricular nucleus modulates cardiorespiratory responses via oxytocinergic innervation of neurons in pre-Botzinger complex J Appl Physiol, January 1, 2007; 102(1): 189 - 199. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. E. Schlick, M. I. Jensen-Seaman, K. Orlebeke, A. E. Kwitek, H. J. Jacob, and J. Lazar Sequence analysis of the complete mitochondrial DNA in 10 commonly used inbred rat strains Am J Physiol Cell Physiol, December 1, 2006; 291(6): C1183 - C1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Akaneya and T. Tsumoto Bidirectional Trafficking of Prostaglandin E2 Receptors Involved in Long-Term Potentiation in Visual Cortex J. Neurosci., October 4, 2006; 26(40): 10209 - 10221. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Guo, M. T. Robbins, F. Wei, S. Zou, R. Dubner, and K. Ren Supraspinal Brain-Derived Neurotrophic Factor Signaling: A Novel Mechanism for Descending Pain Facilitation J. Neurosci., January 4, 2006; 26(1): 126 - 137. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |