| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1Departments of Experimental Neurophysiology and 2Molecular and Cellular Neurobiology, Center for Neurogenomics and Cognitive Research, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands
Submitted 24 January 2005; accepted in final form 6 March 2005
 |
ABSTRACT |
|---|
|
1 subunit replaces the 2 and/or 3 subunit as major subunit. This is accompanied by a marked decrease in the open time of GABAA receptors and hence in the duration of postsynaptic responses. We describe here the development of GABAergic, synaptic transmission in mice lacking the 1 subunit. We show that 1 is to a large extent—but not entirely—responsible for the relatively short duration of postsynaptic responses in the developing and the mature brain. However, 1 already affects GABAergic transmission in the neonatal cerebral cortex when it is only sparsely expressed. It appears that the 1 –/– mice do not show a large reduction in GABAergic synapses but do retain long-lasting postsynaptic currents into adulthood. Hence, they form a good model to study the functional role of developmental GABAA receptor subunit switching. |
|
INTRODUCTION |
|---|
|
; Lavoie et al. 1997; Verdoorn 1994). There is widespread plasticity in the expression of GABAA receptor subtypes, especially during development (Fritschy et al. 1994; Laurie et al. 1992).
The large majority of postsynaptic GABAA receptors is composed of two , two 
, and one 
subunit (Baumann et al. 2001; Farrar et al. 1999; Tretter et al. 1997). In most brain regions, the postsynaptic GABAA receptors in very young animals incorporate 2 and/or 3 subunits (Fritschy et al. 1994; Laurie et al. 1992). These receptors mediate relatively long-lasting inhibitory postsynaptic currents (IPSCs) (Bosman et al. 2002; Brussaard et al. 1997; Okada et al. 2000). During development, the relative abundance of 2 and 3 diminishes (Fritschy et al. 1994; Heinen et al. 2004; Laurie et al. 1992). Simultaneously, the 1 subunit, which is initially rare, is strongly upregulated and forms the dominant subunit in most brain regions during adulthood (Fritschy et al. 1994; Heinen et al. 2004; Laurie et al. 1992; Pirker et al. 2000). Synapses that have mostly 1-containing GABAA receptors mediate relatively short-lasting IPSCs (Bosman et al. 2002; Goldstein et al. 2002; Koksma et al. 2003; Vicini et al. 2001). The functional impact of 1 during earlier stages, when it is only sparsely expressed, is less clear.
Although the developmental subunit switching and accompanied changes in GABAergic IPSCs is a widespread phenomenon, its functional relevance is poorly understood. In this study, we addressed the role of 1 in synaptic, GABAergic transmission at various stages of development of the cerebral cortex. To this end, we used homozygous 1 –/– mice (Sur et al. 2001). In addition, we evaluated whether these mice retain the juvenile phenotype of GABAergic transmission. Because this is indeed the case, we propose that the 1 –/– mouse is a valid model to study functional implications of developmental subunit switching of GABAA receptors.
|
|
METHODS |
|---|
|
All experimental methods were approved by the animal welfare committee of our university, as required by Dutch law. Mice lacking the 1 subunit of the GABAA receptor were in a mixed 50% C57BL6-50% 129SvEv background, as previously described (Sur et al. 2001). The wild-type mice were also a cross between C57BL6 and 129SvEv. Mice were decapitated and their brains quickly removed and placed in ice-cold artificial cerebrospinal fluid (ACSF), which contained (in mM) 125 NaCl, 25 NaHCO3, 3 KCl, 1.2 NaH2PO4, 2.4 CaCl2, 1.3 MgSO4, 10 D(+)-glucose (carboxygenated with 5% CO2-95% O2, 304 mosmol, pH 7.4). According to the guidelines of the local animal welfare committee, adult mice (2–3 mo) were paralyzed with ketamine (circa 0.1 mg/g body wt) prior to decapitation. Mice from other ages were not treated with ketamine. Coronal sections (400 µm thick) of the visual cortex were cut using a VT1000S vibratome slicer (Leica, Wetzlar, Germany). Slices were stored 
8 h in continuously carboxygenated ACSF at room temperature.
Total RNA isolation and cDNA preparation
Total RNA was isolated from a 1-mm-wide, 400-µm-thick freshly dissected visual cortex slice (layers I–IV) according to the procedure described by Chomczynski and Sacchi (1987), dissolved in 25 µl RNAse-free H2O and subsequently treated with 10 u DNAse-I (Roche) to remove residual genomic DNA. Then, hexanucleotide (125 pmol) primed cDNA was generated on 
1 µg RNA using 250 u Superscript in a total volume of 50 µl using the manufacturers protocol (Gibco BRL, Gaithersburg, MD). Samples were aliquoted and stored at –20°C.
Quantitative PCR (qPCR)
Specific primer combinations (Eurogentec, Seraing, Belgium) were designed for each GABAA receptor subunit sequence. Amplified sequences were: GABAAR 1 NM_010250
[GenBank]
.1 (nt 466–562); GABAAR 2 NM_008066
[GenBank]
.1 (nt 1557–1635); GABAAR 3 NM_008067
[GenBank]
.1 (nt 1549–1633); GABAAR 4 gi|12851204| (nt 1776–1858); GABAAR 5. (forward primer: AAAAGACATACAACAGCATCAGCAA; reverse primer: AAAGTGCCAAACAAGATGGG); GABAAR 2 L08497
[GenBank]
.1 (nt 1256–1345); Gephyrin (forward primer: ATACTGGCAGCCAGTAACTGGATAC; reverse primer: CAGCACTTGAGGAAGCATTGC); GABARAP gi|20988472 (nt 685–755); GAD65 gi|17225420 (nt 1478–1602), and the housekeeping gene GAPDH gi|20984453 (nt 30–116) that was used for normalization of the expression levels in relation to the total RNA input. Amplicons were chosen within a range of 80–120 bp. Each primer-combination was tested on amplification efficiency and only those that had a value between 1.8 and 2 were accepted for the experiments. cDNA quantification was performed on Perkin-Elmer ABI PRISM 7700 sequence detection system (PE Biosystems, Foster City, CA) using 45 cycles (95°C, 15 s; 59°C, 1 min) on 0.3 µl cDNA per reaction (20 µl; SYBR green core reagent kit, PE Biosystems). Regulation of gene expression in the 1 –/– mice compared with wild-type mice was calculated by: regulation = E([CT(geneX WT)- CT(GAPDH WT)]-[CT(geneX 1–/–) - CT(GAPDH 1–/–)]), where CT(geneX, GAPDH) = # cycles at which the PCR product reaches the set threshold value (0.3*
Rn) and E = the amplification efficiency, which was considered 2 for all primers. Significant regulation was examined by using unpaired Student's t-test on the GAPDH normalized data.
Electrophysiology
In situ whole cell voltage-clamp recordings were made of randomly selected neurons of layer II–III of the visual cortex using an Axopatch 200A amplifier (Axon Instruments, Foster City, CA) and borosilicate glass (Harvard Apparatus, Norfolk, UK) electrodes with an open tip resistances of 2–5 M
. All experiments were performed at 33°C using ACSF with 20 µM 6,7-dinitroquinoxaline-2,3(1H, 4H)-dione (DNQX) and 20 µM APV (both from Sigma) to block the ionotropic glutamate receptors. The pipettes were filled with (in mM) 135 CsCl, 1 CaCl2, 10 EGTA, 10 HEPES, 2 MgATP, and 296 mosmol, pH 7.2 (with CsOH). TTX was from Alomone Labs (Jerusalem, Israel).
Experimental data were stored on digital tapes and analyzed later using the Computer Disk Recorder v1.3 and the Whole Cell Program v2.3 (both kindly provided by Dr. J. Dempster, Strathclyde University, UK) for synaptic current analysis. All automatically detected synaptic events were checked by eye. Only events with fast rise times starting from a stable base line were accepted. Dendritically filter IPSCs were rejected as described previously (Bosman et al. 2002). Double events were rejected. From all accepted IPSCs, the peak current and the corresponding inter-event time were measured and the synaptic current decay time constant (
decay) was calculated by fitting the decay phase with a monoexponential function. All exponential fits were checked by eye and inaccurate fits were rejected.
For each neuron, histograms were made of the peak currents, decay and interval times of all the IPSCs. Neurons that had <50 accepted control IPSCs were rejected from further analysis. Typically, we analyzed 400 IPSCs per condition per neuron. Peak current and decay histograms were best fitted with lognormal curves; interval time histograms were best fitted with mono-exponential functions as described previously (Brussaard et al. 1996). For each experimental condition, at least three individual animals were used. The numbers of neurons used for each group are mentioned in Tables 1 and 2.
|
|
|
|
RESULTS |
|---|
|
1 –/– mice. In previous, semi-quantitative studies performed at various brain regions, no compensatory regulation was detected in the F5 generation of the 1 –/– mouse-line generated by Sur et al. (2001), which was also used for this study. Here, we present an additional, quantitative analysis of the gene expression of all GABAA receptor subunits at postnatal day 21 (p21) in cells of layer I-IV of the visual cortex (Fig. 1). This analysis was done in F5–F7 mice, which were also used for the rest of this study.
|
1 is the dominant GABAA receptor subunit at p21, accounting for 57% of the total subunit mRNA. Whereas 1 gene expression was absent in 1 –/– mice, the expression of the other subunits was unaltered with the exception of 5. Whereas 5 is almost absent in wild-type mice, it is upregulated in 1 –/– mice. In the cerebral cortex, however, 5 is probably exclusively incorporated in extrasynaptic GABAA receptors (Fritschy and Brünig 2003). Taken together, the total expression of GABAA receptor subunits was reduced by 54% following 1 knock out, which corresponds to the contribution of 1 to the wild-type mRNA pool (57%). Hence, we conclude that there are no compensations in gene expression of the other (postsynaptic) subunits in the 1 –/– mice (Fig. 1A).
We also measured gene expression of a selected set of other proteins involved in GABAergic neurotransmission. The mRNA level of the GABAA receptor trafficking protein GABARAP (Chen et al. 2000; Nymann-Andersen et al. 2002) was similar in 1 –/– and wild-type mice (Fig. 1B). However, both the levels of the GABAA receptor 2 subunit and of the GABAA receptor clustering protein gephyrin (Kneussel and Betz 2000; Moss and Smart 2001) were doubled in 1 –/– compared with wild-type mice (Fig. 1, C and D). Finally, the presynaptic marker GAD65, involved in GABA synthesis (Pinal and Tobin 1998), did not show a difference between 1 –/– and wild-type mice (Fig. 1E).
In conclusion, in line with Sur et al. (2001), we failed to find any major compensation of the GABAA receptor subunits in 1 –/– mice. The same was true for the trafficking protein GABARAP and the presynaptic marker GAD65. However, both gephyrin, involved in the clustering of postsynaptic GABAA receptors, and the GABAA receptor 2 subunit were upregulated, which may suggest compensation of expression or trafficking of functional GABAA receptors.
Therefore we characterized the functioning of postsynaptic GABAA receptors at key stages of development in 1 –/– and wild-type mice. To this end, we performed whole cell voltage-clamp measurements of randomly selected neurons of layers II/III of the visual cortex in acutely prepared brain slices The slices were taken from mice at the completion of cortical layer formation (p6), around eye opening (p14), at the onset of the critical period (p21), and from adult animals (>3 mo old), respectively. The spontaneous IPSCs (sIPSCs) could be completely blocked by the specific GABAA receptor antagonist gabazine (50 µM, n = 8, data not shown).
The frequency with which sIPSCs occurred did not differ between 1 –/– and wild-type mice during early development (Fig. 2). However, in adult mice, the sIPSC frequency was clearly reduced in 1 –/– mice. This may reflect fewer functional synapses surviving in 1 –/– compared with wild-type mice.
|
|
1 subunit and the absence of alterations in gene expression of other subunits, the peak currents were not reduced in 1 –/– mice when compared with wild types. On the contrary, the peak currents at p21 were even larger in 1 –/– animals (Fig. 3F).
The decay time constant (decay) was always larger in 1 –/– mice than in wild types. Already at p6, when 1 expression is still very low (Heinen et al. 2004), a clear difference between 1 –/– and wild-type mice was observed when comparing the experimental medians. During development, the decay of the IPSCs in both wild-type and 1 –/– mice shortened. Remarkably, around p21, when 1 is already the most abundant subunit (Heinen et al. 2004), there was a relatively small difference in decay between 1 –/– and wild-type mice (Fig. 3E).
Because sIPSCs may originate either as a consequence of action potential firing of the presynaptic cell or are action potential-independent, they form inevatibly a mixed population. Indeed, also changes in the action potential firing pattern in the 1 –/– slices may affect the outcome of sIPSC-analysis. Hence we performed a series of experiments in the presence of the Na+ channel blocker TTX (1 µM) to exclude the action potential-driven IPSCs and measure exclusively the miniature IPSCs (mIPSCs; Fig. 4). These experiments were done at p14 and p21.
|
1 –/– and wild-type mice. However, at p21, TTX had a larger effect on 1 –/– mice than on wild types, indicating that the fraction of action potential-driven IPSCs is increased in these animals. Comparing the mIPSC frequency, which most likely reflects the number of GABAergic synapses per neuron, between equally old 1 –/– and wild-type mice, there was no significant difference (Fig. 4A). This suggests that the number of GABAergic synapses is not reduced in the 1 –/– mice, although we cannot exclude a change in the presynaptic release probabilities between wild-type and 1 –/– mice.
In line with the previous sIPSC analysis, the peak currents of mIPSCs were not reduced following 1 knock out (Fig. 4C). Again, at p21, 1 –/– mice showed larger mIPSCs than wild-type animals. At p14, there was no difference between the two genotypes. Because the peak current of mIPSCs is correlated to the number of (active) GABAA receptors at the postsynaptic membrane (Nusser et al. 1997), this suggests that removal of 1 does not lead to a reduction of the number of active GABAA receptors per synapse.
Also in line with the sIPSCs, the decay of the mIPSCs was increased in the 1 –/– mice compared with the wild types (Fig. 4D). Again, the increase was larger at p14 than at p21.
Taken together, this implies that the strength of GABAergic neurotransmission may very well be increased rather than reduced on 1 deletion (Fig. 5). The duration of IPSCs is increased, whereas the occurrence and amplitude of the IPSCs is not reduced in the 1 –/– mice. As expected, the differences in charge transfer in very young animals are rather small because 1 expression increases sharply during development. In older animals, however, the charge transfer per IPSCs is clearly larger in 1 –/– mice than in wild types (Fig. 5B). This is even clearer when only mIPSCs are taken into account (Fig. 5A).
|
|
|
DISCUSSION |
|---|
|
During normal development, the number of active GABAergic synapses increases (Blue and Parnavelas 1983; Heinen et al. 2004). Simultaneously, the impact of a single synaptic event decreases because the open times of the GABAA receptors shortens. The simultaneous downregulation of the 3 subunit and the upregulation of 1 during development of the cerebral cortex appear to cause this reduction in the duration of GABAergic IPSCs (Bosman et al. 2002; Heinen et al. 2004). Our longitudinal analysis of the various developmental stages in mice has revealed the following: at p6, when 1 is expressed at a relatively low level in rodents (Heinen et al. 2004), the IPSC kinetics in 1 mutants were strongly affected. In contrast, at p14 and in particular at p21, when the mRNA level of 1 has reached its maximal (mature) level, the phenotypic consequences of 1 mutation are not so large. This implies that the IPSC kinetics are not linearly related to the level of 1 mRNA. Second, we found that in the absence of 1, new GABAergic synapses are assembled, like in wild-type mice. However, the GABAergic synapses in 1 –/– mice retain relatively slow kinetics throughout life. We conclude that the 1 –/– mouse, in view of its development, is an interesting animal model to study the effects of developmental changes in the efficacy of synaptic inhibition.
Phenotype of the 1 –/– mice
Interference with GABAergic neurotransmission can alter the functioning of the brain dramatically. Several clinically relevant anesthetics and analgetics act via allosteric modulation of GABAA receptors (Belelli et al. 1999; Rudolph and Antkowiak 2004). Also the neurological effects of (excessive) alcohol consumption are largely caused by the interaction of ethanol with GABAA receptors (Chester and Cunningham 2002; Grobin et al. 1998). In addition, irregular functioning of GABAA receptors has been implicated in several diseases, for instance epilepsy (Brooks-Kayal et al. 1998; Jones-Davis and Macdonald 2003; Loup et al. 2000) and schizophrenia (Benes and Berretta 2001; Huntsman et al. 1998).
Knocking out the most abundant GABAA receptor subunit, 2, proved to be lethal (Günther et al. 1995). Deletion of 3 was lethal for most mice with the few surviving mice displaying a severe phenotype, reminiscent of the human Angelman syndrome (DeLorey et al. 1998). It came therefore as a surprise that deletion of the most abundant subunit, 1, produced only a mild phenotype: a slightly reduced body weigth and a 25-Hz tremor on handling (Kralic et al. 2002; Sur et al. 2001; Vicini et al. 2001).
There are two independent lines of 1 –/– mice (Sur et al. 2001; Vicini et al. 2001). In the mouse line we have used, generated by Rosahl's lab (Sur et al. 2001), the null mice were interbred, contrary to the other line, generated by Homanics' lab (Vicini et al. 2001). Both mouse lines show upregulation of 2 and 3 subunits at the receptor level (Kralic et al. 2002), whereas mRNA levels remain unaltered (Sur et al. 2001). However, the upregulation is lost in the Sur et al. mouse line over several generations, presumably due to the chosen breeding strategy, which might have facilitated the accumulation of genetic differences between the wild-type and the 1 –/– colonies.
The results of the present study may help explain the relatively healthy state of the 1 –/– animals. Contrary to the 2 –/– and 3 –/– mice, 1 –/– mice do not display a dramatic change in the function of GABAA receptors (see also Goldstein et al. 2002; Sur et al. 2001; Vicini et al. 2001). In fact, they have an approximately normal number of GABAergic synapses, which in turn have a more or less normal number of GABAA receptors. Apparently, there is a compensatory upregulation of non-1 subunits, as was previously shown by Sur et al. (2001) and Kralic et al. (2002). To what extent this upregulation contributes to the observed compensatory regulation of the number of GABAA receptors, that seems to reach a peak level around the onset of the critical period, is as yet unclear. This compensatory upregulation is not reflected in the gene expression of the subunits, as shown in Fig. 1. In contrast, the 2 subunit and gephyrin showed an increased expression in the 1 –/– mice at p21. Because both proteins are involved in the postsynaptic clustering of GABAA receptors (Essrich et al. 1998; Sassoè-Pognetto et al. 2000), it is tempting to speculate that the total number of postsynaptic GABAA receptors was relatively intact after 1 deletion, due to the fact that 2 and gephyrin-mediated GABAA receptor clustering mechanisms appear increased. If true, this may also affect the ratio of synaptic versus extrasynaptic GABAA receptor in this mutant. In this respect it is interesting to note that the number of functional extrasynaptic GABAA receptors appear reduced in 1 –/– mice (L. W. J. Bosman, T. S. Heistek, J. C. Lodder and A. B. Brussaard, unpublished observation), suggesting that translocation of functional GABAA receptor from the extra- to the postsynaptic membrane may account to some extent for the relatively normal receptor numbers at GABA synapses in these mutants.
Developmental plasticity in IPSC kinetics
In wild-type animals, the duration of GABAergic IPSCs decreases during development. This change in IPSC kinetics is probably caused by alterations in the expression of the GABAA receptor subunits (Bosman et al. 2002; Heinen et al. 2004). There is ample evidence that the channel open time of a GABAA receptor is largely determined by its subunits. Extensive studies on heterologous expression systems have addressed this issue (Hevers and Lüddens 1998; Lavoie et al. 1997; Verdoorn 1994). These studies have the obvious disadvantage that they do not take the native environment of postsynaptic GABAA receptors into account. Measuring the decay kinetics of GABAA receptor subtypes in the native environment is complicated, however, by the large variation in GABAA receptor subtypes expressed. Several studies have taken advantage of this heterogeneity and correlated the decay kinetics with the presence of specific GABAA receptor subunits (Dunning et al. 1999; Jüttner et al. 2001; Okada et al. 2000). In a previous study, we exploited subunit-specific pharmacology (Bosman et al. 2002). These studies conclude that the 2, 3, and 5 subunit are involved in long-lasting IPSCs, whereas 1 and 4 are associated with short-during IPSCs. In accordance, antisense deletion of 1 suppressed the occurrence of fast decaying IPSCs (Bosman et al. 2002) and antisense deletion of 2 specifically reduced slow decaying IPSCs (Brussaard et al. 1997).
Studies on two independent 1 –/– mice lines have confirmed that 1 deletion leads to elongated IPSCs in mature neurons of several brain regions, which all have 1 as their major subunit (Bosman et al. 2002; Goldstein et al. 2002; Koksma et al. 2003; Ortinski et al. 2004; Vicini et al. 2001). The only previous observation made in juvenile 1 –/– mice concerned cerebellar stellate neurons (Vicini et al. 2001). GABAergic IPSCs in juvenile, cerebellar stellate neurons (p11) are not affected by zolpidem, indicating that the 1 subunit is not or rarely incorporated in postsynaptic densities. In line with this, the IPSC kinetics were not affected by 1 deletion (Vicini et al. 2001).
Contrary to the juvenile cerebellar stellate neurons, IPSCs in the cerebral cortex show already at p6 zolpidem-sensitivity (Bosman et al. 2002). The effect of zolpidem on IPSC kinetics increases during development, reflecting the increase in (postsynaptic) 1 expression (Bosman et al. 2002; Heinen et al. 2004). We show here that already at p6, there is a clear difference in decay kinetics of IPSCs in the cerebral cortex, indicating that even relatively small amounts of postsynaptic 1 can influence the IPSC kinetics significantly.
The IPSCs in wild types are faster than in 1 –/– mice at all developmental stages. This demonstrates that 1 containing GABAA receptors mediate faster decaying IPSCs than non-1-containing ones. The upregulation of the number of GABAA receptors as a putative (post)translational compensation (by virtue of regulation of non-1 subunits and gephyrin) in the 1 –/– mice cannot alter this conclusion.
During normal development of the neocortex, the switch from 3 to 1 is thought to be largely responsible for the change in decay kinetics. Similar mechanisms have been described in other brain regions (Dunning et al. 1999; Liu and Wong-Riley 2004; Okada et al. 2000). However, we describe that there is also a clear, developmental shortening of the IPSCs in the absence of 1. Which mechanisms can be responsible for this plasticity?
First, the 3/1 switch is not the only change in subunit expression during wild-type development. There is also an upregulation of 4 and a downregulation of 5 (Heinen et al. 2004). Most likely, the 5 subunit is not incorporated in postynaptic receptors in the cerebral cortex (Fritschy and Brünig 2003). As the 1 subunit, 4 is associated with fast-decaying IPSCs (Bosman et al. 2002). However, the impact of 4 in wild-type mice is relatively small as compared with that of 1 because 4 expression is much lower than 1 expression. But in the absence of 1, 4 makes up a relatively larger portion of subunits. Hence, an 3/4 switch may to some extent explain the observed kinetic changes during development in the mutant mice.
Second, other mechanisms may play a role. Allosteric modulation, for instance, can also affect the duration of GABAergic IPSCs (Jones and Westbrook 1997; Lambert et al. 2001). Finally, we cannot exclude that non- subunits also affected synaptic current decay (see for instance, Benkwitz et al. 2004).
1 –/– mice as a model for juvenile GABAA receptors
Although one cannot expect us to make definitive conclusions as to why neurons make the switch from 2/3 to 1 and what compensatory mechanisms may be called on in the 1 –/– mice, there might be interesting mechanistic parallels to explore with respect to the developmental switch from the to the 
subunit in the muscle nACh receptor with its concomitant shortening of synaptic decay (e.g., Jaramillo and Schuetze 1988), and the resulting pathology that results when this does not occur (e.g., slow channel syndrome). In particular, a phenotype labeled as slow channel syndrome (SCS) may occur, being caused by prolonged activation of nAChRs, either resulting from single amino acid mutations of for instance the subunit (Ohno et al. 1995) or by aberrant expression of the fetal subunit, probably related to destruction and regeneration of the junctional folds and known to lead to a muscle weakness and rapid fatigue in humans. This phenotype is most likely caused by socalled depolarization block as a result of inactivation of voltage-gated Na+ channels.
The functional significance of the developmental change in IPSC and/or IPSP kinetics in the CNS is still largely unknown. GABAA receptor 1 –/– mice provide a good model to study the functional consequences of the widespread subunit switching because these mutant mice retain IPSCs with a juvenile phenotype into adulthood. However, they do show a relatively normal development of the number of GABAergic synapses, so that they differ from wild-type mice mainly in the duration of their IPSCs. Hence, they represent a valid model to study the consequences of developmental receptor subunit changes. We have recently begun to do so by screening for difference in morphological differences in the visual cortex of these mutant mice and found that there is a substantial reduction of the density of mature spines on the apical dendrites of pyramidal neurons in the visual cortex (Heinen et al. 2003).
|
|
GRANTS |
|---|
|
|
|
ACKNOWLEDGMENTS |
|---|
|
1 –/– mice and helpful discussion and J. C. Lodder and T. E. Busé-Pot for excellent technical support. Present address of K. Heinen: Wellcome Laboratory of Neurobiology, University College London, Gower Street, London WC1E 6BT, UK.
|
|
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: A. B. Brussaard, Dept. of Experimental Neurophysiology, Center for Neurogenomics and Cognitive Research, Vrije Universiteit Amsterdam, De Boelelaan 1085, 1081 HV Amsterdam, The Netherlands (E-mail: brssrd{at}cncr.vu.nl)
|
|
REFERENCES |
|---|
|
-aminobutyric acid type A receptors. J Biol Chem 276: 36275–36280, 2001.Belelli I, Pistis I, Peters JA, and Lambert JJ. General anaesthetic action at transmitter-gated inhibitory amino acid receptors. Trends Pharmacol Sci 20: 496–502, 1999.[CrossRef][Medline]
Benes FM and Berretta S. GABAergic interneurons: implications for understanding schizophrenia and bipolar disorder. Neuropsychopharmacology 25: 1–27, 2001.[CrossRef][Web of Science][Medline]
Benkwitz C, Banks MI, and Pearce RA. Influence of GABAA receptor 2 splice variants on receptor kinetics and isoflurane modulation. Anesthesiology 101: 924–936, 2004.[CrossRef][Web of Science][Medline]
Blue ME and Parnavelas JG. The formation and maturation of synapses in the visual cortex of the rat. II. Quantative analysis. J Neurocytol 12: 697–712, 1983.[CrossRef][Web of Science][Medline]
Bosman LWJ, Rosahl TW, and Brussaard AB. Neonatal development of the rat visual cortex: synaptic function of GABAA receptor subunits. J Physiol 545: 169–181, 2002.
Brooks-Kayal AR, Shumate MD, Jin H, Rikhter TY, and Coulter DA. Selective changes in single cell GABAA receptor subunit expression and function in temporal lobe epilepsy. Nat Med 4: 1166–1172, 1998.[CrossRef][Web of Science][Medline]
Brussaard AB, Kits KS, Baker RE, Willems WP, Leyting-Vermeulen JW, Voorn P, Smit AB, Bicknell RJ, and Herbison AE. Plasticity in fast synaptic inhibition of adult oxytocin neurons caused by switch in GABAA receptor subunit expression. Neuron 19: 1103–1114, 1997.[CrossRef][Web of Science][Medline]
Brussaard AB, Kits KS, and de Vlieger TA. Postsynaptic mechanism of depression of GABAergic synapses by oxytocin in the supraoptic nucleus of immature rat. J Physiol 497: 495–507, 1996.
Chen L, Wang H, Vicini S, and Olsen RW. The -aminobutyric acid type A (GABAA) receptor-associated protein (GABARAP) promotes GABAA receptor clustering and modulates the channel kinetics. Proc Natl Acad Sci USA 97: 11557–11562, 2000.
Chester JA and Cunningham CL. GABAA receptor modulation of the rewarding and aversive effects of ethanol. Alcohol 26: 131–143, 2002.[CrossRef][Web of Science][Medline]
Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987.[Web of Science][Medline]
DeLorey TM, Handforth A, Anagnostaras SG, Homanics GE, Minassian BA, Asatourian A, Fanselow MS, Delgado-Escueta A, Ellison GD, and Olsen RW. Mice lacking the 3 subunit of the GABAA receptor have the epilepsy phenotype and many of the behavioral characteristics of Angelman syndrome. J Neurosci 18: 8505–8514, 1998.
Dunning DD, Hoover CL, Soltesz I, Smith MA, and O'Dowd DK. GABAA receptor-mediated miniature postsynaptic currents and -subunit expression in developing cortical neurons. J Neurophysiol 82: 3286–3297, 1999.
Essrich C, Lorez M, Benson JA, Fritschy JM, and Lüscher B. Postsynaptic clustering of major GABAA receptor subtypes requires the 2 subunit and gephyrin. Nat Neurosci 1: 563–571, 1998.[CrossRef][Web of Science][Medline]
Farrar SJ, Whiting PJ, Bonnert TP, and McKernan RM. Stoichiometry of a ligand-gated ion channel determined by fluorescence energy transfer. J Biol Chem 274: 10100–10104, 1999.
Fritschy JM and Brünig I. Formation and plasticity of GABAergic synapses: physiological mechanisms and pathophysiological implications. Pharmacol Ther 98: 299–323, 2003.[CrossRef][Web of Science][Medline]
Fritschy JM, Paysan J, Enna A, and Möhler H. Switch in the expression of rat GABAA-receptor subtypes during postnatal development: an immunohistochemical study. J Neurosci 14: 5302–5324, 1994.[Abstract]
Goldstein PA, Elsen FP, Ying SW, Ferguson C, Homanics GE, and Harrison NL. Prolongation of hippocampal miniature inhibitory postsynaptic currents in mice lacking the GABAA receptor 1 subunit. J Neurophysiol 88: 3208–3217, 2002.
Grobin AC, Matthews DB, Devaud LL, and Morrow AL. The role of GABAA receptors in the acute and chronic effects of ethanol. Psychopharmacology 139: 2–19, 1998.[CrossRef][Medline]
Günther U, Benson J, Benke D, Fritschy JM, Reyes G, Knoflach F, Crestani F, Aguzzi A, Arigoni M, Lang Y, Bluethmann H, Mohler H, and Lüscher B. Benzodiazepine-insensitive mice generated by targeted disruption of the 2 subunit gene of -aminobutyric acid type A receptors. Proc Natl Acad Sci USA 92: 7749–7753, 1995.
Heinen K, Baker RE, Spijker S, Rosahl T, van Pelt J, and Brussaard AB. Impaired dendritic spine maturation in GABAA receptor 1 subunit knock out mice. Neuroscience 122: 699–705, 2003.[CrossRef][Web of Science][Medline]
Heinen K, Bosman LWJ, Spijker S, Van Pelt J, Smit AB, Voorn P, Baker RE, and Brussaard AB. GABAA receptor maturation in relation to eye opening in the rat visual cortex. Neuroscience 124: 161–171, 2004.[CrossRef][Web of Science][Medline]
Hevers W and Lüddens H. The diversity of GABAA receptors. Pharmacological and electrophysiological properties of GABAA channel subtypes. Mol Neurobiol 18: 35–86, 1998.[Web of Science][Medline]
Huntsman MM, Tran BV, Potkin SG, Bunney WE, Jr, and Jones EG. Altered ratios of alternatively spliced long and short 2 subunit mRNAs of the -amino butyrate type A receptor in prefrontal cortex of schizophrenics. Proc Natl Acad Sci USA 95: 15066–15071, 1998.
Jaramillo F and Schuetze SM. Kinetic differences between embryonic- and adult-type acetylcholine receptors in rat myotubes. J Physiol 396: 267–296, 1988.
Jones MV and Westbrook GL. Shaping of IPSCs by endogenous calcineurin activity. J Neurosci 17: 7626–7633, 1997.
Jones-Davis DM, and Macdonald RL. GABAA receptor function and pharmacology in epilepsy and status epilepticus. Curr Opin Pharmacol 3: 12–18, 2003.[CrossRef][Web of Science][Medline]
Jüttner R, Meier J, and Grantyn R. Slow IPSC kinetics, low levels of 1 subunit expression and paired-pulse depression are distinct properties of neonatal inhibitory GABAergic synaptic connections in the mouse superior colliculus. Eur J Neurosci 13: 2088–2098, 2001.[CrossRef][Web of Science][Medline]
Kneussel M and Betz H. Receptors, gephyrin and gephyrin-associated proteins: novel insights into the assembly of inhibitory postsynaptic membrane specializations. J Physiol 525: 1–9, 2000.
Koksma JJ, van Kesteren RE, Rosahl TW, Zwart R, Smit AB, Luddens H, and Brussaard AB. Oxytocin regulates neurosteroid modulation of GABAA receptors in supraoptic nucleus around parturition. J Neurosci 23: 788–797, 2003.
Kralic JE, Korpi ER, O'Buckley TK, Homanics GE, and Morrow AL. Molecular and pharmacological characterization of GABA(A) receptor 1 subunit knockout mice. J Pharmacol Exp Ther 302: 1037–1045, 2002.
Lambert JJ, Belelli D, Harney SC, Peters JA, and Frenguelli BG. Modulation of native and recombinant GABAA receptors by endogenous and synthetic neuroactive steroids. Brain Res Brain Res Rev 37: 68–80, 2001.[CrossRef][Medline]
Laurie DJ, Wisden W, and Seeburg PH. The distribution of thirteen GABAA receptor subunit mRNAs in the rat brain. III. Embryonic and postnatal development. J Neurosci 12: 4151–4172, 1992.[Abstract]
Lavoie AM, Tingey JJ, Harrison NL, Pritchett DB, and Twyman RE. Activation and deactivation rates of recombinant GABAA receptor channels are dependent on -subunit isoform. Biophys J 73: 2518–2526, 1997.[Web of Science][Medline]
Liu Q and Wong-Riley MT. Developmental changes in the expression of GABAA receptor subunits 1, 2, and 3 in the rat pre-Botzinger complex. J Appl Physiol 96: 1825–1831, 2004.
Loup F, Wieser HG, Yonekawa Y, Aguzzi A, and Fritschy JM. Selective alterations in GABAA receptor subtypes in human temporal lobe epilepsy. J Neurosci 20: 5401–5419, 2000.
Moss SJ and Smart TG. Constructing inhibitory synapses. Nat Rev Neurosci 2: 240–250, 2001.[Web of Science][Medline]
Nusser Z, Cull-Candy S, and Farrant M. Differences in synaptic GABAA receptor number underlie variation in GABA mini amplitude. Neuron 19: 697–709, 1997.[CrossRef][Web of Science][Medline]
Nymann-Andersen J, Wang H, Chen L, Kittler JT, Moss SJ, and Olsen RW. Subunit specificity and interaction domain between GABAA receptor-associated protein (GABARAP) and GABAA receptors. J Neurochem 80: 815–823, 2002.[CrossRef][Web of Science][Medline]
Ohno K, Hutchinson DO, Milone M, Brengman JM, Bouzat C, Sine SM, and Engel AG. Congenital myasthenic syndrome caused by prolonged acetylcholine receptor channel openings due to a mutation in the M2 domain of the subunit. Proc Natl Acad Sci USA 92: 758–762, 1995.
Okada M, Onodera K, Van Renterghem C, Sieghart W, and Takahashi T. Functional correlation of GABAA receptor subunits expression with the properties of IPSCs in the developing thalamus. J Neurosci 20: 2202–2208, 2000.
Ortinski PI, Lu C, Takagaki K, Fu Z, and Vicini S. Expression of distinct subunits of GABAA receptor regulates inhibitory synaptic strength. J Neurophysiol 92: 1718–1727, 2004.
Pinal CS and Tobin AJ. Uniqueness and redundancy in GABA production. Perspect Dev Neurobiol 5: 109–118, 1998.[Web of Science][Medline]
Pirker S, Schwarzer C, Wieselthaler A, Sieghart W, and Sperk G. GABAA receptors: immunocytochemical distribution of 13 subunits in the adult rat brain. Neuroscience 101: 815–850, 2000.[CrossRef][Web of Science][Medline]
Rudolph U and Antkowiak B. Molecular and neuronal substrates for general anaesthetics. Nat Rev Neurosci 5: 709–720, 2004.[CrossRef][Web of Science][Medline]
Sassoè-Pognetto M, Panzanelli P, Sieghart W, and Fritschy JM. Colocalization of multiple GABAA receptor subtypes with gephyrin at postsynaptic sites. J Comp Neurol 420: 481–498, 2000.[CrossRef][Web of Science][Medline]
Sur C, Wafford KA, Reynolds DS, Hadingham KL, Bromidge F, Macaulay A, Collinson N, O'Meara G, Howell O, Newman R, Myers J, Atack JR, Dawson GR, McKernan RM, Whiting PJ, and Rosahl TW. Loss of the major GABAA receptor subtype in the brain is not lethal in mice. J Neurosci 21: 3409–3418, 2001.
Tretter V, Ehya N, Fuchs K, and Sieghart W. Stoichiometry and assembly of a recombinant GABAA receptor subtype. J Neurosci 17: 2728–2737, 1997.
Verdoorn TA. Formation of heteromeric -aminobutyric acid type A receptors containing two different subunits. Mol Pharmacol 45: 475–480, 1994.[Abstract]
Vicini S, Ferguson C, Prybylowski K, Kralic J, Morrow AL, and Homanics GE. GABAA receptor 1 subunit deletion prevents developmental changes of inhibitory synaptic currents in cerebellar neurons. J Neurosci 21: 3009–3016, 2001.
This article has been cited by other articles:
|
|
 |
|
  V. C. Kotak, A. E. Takesian, and D. H. Sanes Hearing Loss Prevents the Maturation of GABAergic Transmission in the Auditory Cortex Cereb Cortex, September 1, 2008; 18(9): 2098 - 2108. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Fedi, S. F. Berkovic, R. A. L. Macdonell, J. M. Curatolo, C. Marini, and D. C. Reutens Intracortical Hyperexcitability in Humans with a GABAA Receptor Mutation Cereb Cortex, March 1, 2008; 18(3): 664 - 669. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. R. Peden, C. M. Petitjean, M. B. Herd, M. S. Durakoglugil, T. W. Rosahl, K. Wafford, G. E. Homanics, D. Belelli, J.-M. Fritschy, and J. J. Lambert Developmental maturation of synaptic and extrasynaptic GABAA receptors in mouse thalamic ventrobasal neurones J. Physiol., February 15, 2008; 586(4): 965 - 987. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Zeller, F. Crestani, I. Camenisch, T. Iwasato, S. Itohara, J. M. Fritschy, and U. Rudolph Cortical Glutamatergic Neurons Mediate the Motor Sedative Action of Diazepam Mol. Pharmacol., February 1, 2008; 73(2): 282 - 291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Mitchell, L. J. Gentet, J. Dempster, and D. Belelli GABAA and glycine receptor-mediated transmission in rat lamina II neurones: relevance to the analgesic actions of neuroactive steroids J. Physiol., September 15, 2007; 583(3): 1021 - 1040. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Lagier, P. Panzanelli, R. E. Russo, A. Nissant, B. Bathellier, M. Sassoe-Pognetto, J.-M. Fritschy, and P.-M. Lledo GABAergic inhibition at dendrodendritic synapses tunes {gamma} oscillations in the olfactory bulb PNAS, April 24, 2007; 104(17): 7259 - 7264. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Pangratz-Fuehrer, U. Rudolph, and J. R. Huguenard Giant Spontaneous Depolarizing Potentials in the Developing Thalamic Reticular Nucleus J Neurophysiol, March 1, 2007; 97(3): 2364 - 2372. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. E. Reddy, B. E. Shakhnovich, D. S. Roberts, S. J. Russek, and C. DeLisi Positional clustering improves computational binding site detection and identifies novel cis-regulatory sites in mammalian GABAA receptor subunit genes Nucleic Acids Res., February 16, 2007; 35(3): e20 - e20. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Jiao, C. Zhang, Y. Yanagawa, and Q.-Q. Sun Major Effects of Sensory Experiences on the Neocortical Inhibitory Circuits. J. Neurosci., August 23, 2006; 26(34): 8691 - 8701. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. A. Prenosil, E. M. Schneider Gasser, U. Rudolph, R. Keist, J.-M. Fritschy, and K. E. Vogt Specific Subtypes of GABAA Receptors Mediate Phasic and Tonic Forms of Inhibition in Hippocampal Pyramidal Neurons J Neurophysiol, August 1, 2006; 96(2): 846 - 857. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Ponomarev, R. Maiya, M. T. Harnett, G. L. Schafer, A. E. Ryabinin, Y. A. Blednov, H. Morikawa, S. L. Boehm II, G. E. Homanics, A. Berman, et al. Transcriptional Signatures of Cellular Plasticity in Mice Lacking the {alpha}1 Subunit of GABAA Receptors J. Neurosci., May 24, 2006; 26(21): 5673 - 5683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-M. Fritschy, P. Panzanelli, J. E. Kralic, K. E. Vogt, and M. Sassoe-Pognetto Differential dependence of axo-dendritic and axo-somatic GABAergic synapses on GABAA receptors containing the alpha1 subunit in Purkinje cells. J. Neurosci., March 22, 2006; 26(12): 3245 - 3255. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
TOP
ABSTRACT
INTRODUCTION
) and GABAA receptor 
) mice at p21. Ab: total GABAA receptor 
