|
|
||||||||
REPORT
Center for Translational Neuroscience, Department of Neurobiology and Developmental Sciences, University of Arkansas for Medical Sciences, Little Rock, Arkansas
Submitted 15 December 2006; accepted in final form 3 January 2007
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
During our study of SubC neurons, we detected spikelets, indicative of the presence of electrical coupling in some of these cells. Frequently, electrical coupling is present in GABAergic neurons (Connors and Long 2004
) and is mediated by the neuronal gap junction protein Connexin 36 (Cx 36) (Srinivas et al. 1999
). Because gap junctions are developmentally regulated, we investigated Cx 36 gene expression and protein levels in relation to the developmental decrease in REM sleep known to occur between birth and puberty in man (Roffwarg et al. 1966
) but between 10 and 30 days in the rat (Jouvet-Mounier et al. 1970
). We describe electrophysiological, pharmacological and molecular evidence suggestive of the presence of electrical coupling in the SubC. The manifestation of electrical coupling in part of the RAS introduces a novel potential mechanism of action for the regulation of sleep-wake states.
| METHODS |
|---|
|
|
|---|
Whole cell recordings were acquired using borosilicate glass capillaries pulled on a P-97 puller (Sutter Instrument, Novato, CA) and filled with a solution of (in mM) 114 K-gluconate, 17.5 KCl, 4 NaCl, 4 MgCl2, 10 HEPES, 0.2 EGTA, 3 Mg2ATP, 0.3 Na2GTP, and 0.02% Lucifer yellow. Osmolarity was adjusted to
270290 mosM and pH to 7.4. The pipette resistance was 58 M
. All recordings were made using a Multiclamp 700B amplifier (Axon Instruments, Foster City, CA). Analog signals were low-pass filtered at 2 kHz (Multiclamp 700B) and digitized at 5kHz using a Digidata-1322A and pClamp9 software (Axon instruments). Off-line analyses were performed using Clampfit software (Axon Instruments). Drugs were applied to the slice via a peristaltic pump (Cole-Parmer, Vernon Hills, IL) and a three-way valve system. CAR (2050 µM), carbenoxolone (CBX, 300 µM), 6-cyano-7-nitroquinoxaline-2, 3-dione (CNQX, 10 µM), gabazine (GAB, 10 µM), strychnine (STR, 10 µM), and (±)-2-amino-5-phosphopentanoic acid (APV, 10 µM) were all purchased from Sigma (St. Louis, MO). CNQX, APV, and GAB are termed herein as fast synaptic blockers.
For sharp electrode intracellular recordings (80100 M
), pipettes were filled with 3 M potassium acetate and 1% neurobiotin. Only neurons with a resting membrane potential (RMP) more than 55 mV, action potentials (AP) >50 mV, and stable recordings were included in data analyses. In current-clamp mode, a series of hyperpolarizing and depolarizing current steps of 0.10.9 nA at RMP were applied to determine several membrane properties as previously described (Garcia-Rill et al. 2003
).
The locations of recorded cells were determined using histological verification of neurobiotin- or Lucifer-yellow-injected cells. Most neurons were located anterior to the seventh nerve in the region of the rat brain stem termed dorsal SubC, and some were found in the more dorsal region closer to the locus coeruleus known as SubC pars alpha. Although tyrosine hydroxylase immunocytochemistry was not performed, most recordings were well ventral to the locus coeruleus and scattered tyrosine hydroxylase-positive neurons. We did not attempt to identify different morphological or neurotransmitter types due to the small sample.
In three litters, a region of the mesopontine tegmentum containing the PPN and SubC as well as locus coeruleus and posterior substantia nigra was dissected and analyzed for Cx 36 gene expression and protein levels in 7-day, 17-day, and adult rats (60 day) from each litter. To sample the SubC specifically, we cut 400-µm sagittal sections such as those used for recordings and punched (1 mm) the SubC in 10- and 30-day animals from each of four additional litters. For Cx 36 protein analysis, tissue was homogenized in RIPA buffer (50 mM Tris-Cl, pH 7.45, 150 mM NaCl 1% NP-40, 0.5%, Na-deoxycholate, 0.1% SDS) with protease inhibitor cocktail (Sigma) and cell debris removed by centrifugation. Protein (50 µg/lane) was separated by SDS-PAGE and transferred onto nitrocellulose. Blots were blocked in 5% nonfat milk in TBS (Tris-buffered saline: 20 mM Tris-Cl, pH 7.5, 150 M NaCl) overnight at 4°C. Anti-Cx 36 antibodies were used at 1:250 (Invitrogen) in TBST (TBS with 0.05% Tween-20) with 1% milk, 4 h, 25°C (51p-6200 for mesopontine tegmentum, 516300 for SubC punches). Anti-rabbit IgG-HRP was used at 1:2,500 (Promega) in TBST for 1 h at 25°C. Proteins in were visualized using SuperSignal (Pierce) and X-ray film (mesopontine tegmentum), or Chemiglow West (Alpha Innotech) and light emission captured by a Fluorchem SP (Alpha Innotech; SubC punches). Blots were stripped with Restore (Pierce) and reprobed with antibodies against actin (CP01, Calbiochem, San Diego, CA) to verify equal protein loading. AlphaEase software was used to quantitate the amount of Cx 36 and actin protein in the SubC.
For Cx 36 mRNA expression, mesopontine tegmentum tissue was homogenized in RNA lysis buffer, and total RNA extracted using RNeasy Mini Kit (QIAGEN, Valencia, CA) following the manufacturer's protocol. cDNA was made from 0.20.5 µg RNA using poly (dT) primer and Superscript II reverse transcriptase (Invitrogen) following the manufacturer's protocol. The cDNA was diluted 20 times with 10 mM Tris.HCl (pH 7.5), and a 4-µl aliquot used to perform quantitative RT-PCR with primers and standards developed specifically for rat Cx 36 [aka gap junction protein alpha 9 (Gja9)] following procedures described previously (Zhou et al. 2005
). Quantitative real-time PCR was conducted using a Roche LightCycler Instrument in 10-µl glass capillaries (Roche, Indianapolis, IN), using primers Cx36-F2 (5'CAGCAGCACTCCACTATGAT3') and Cx 36-R2 (5'ACACCATTATGATCTGGAAGA C3'), in 3.5 mM MgCl2, with the cycling parameters: 95°C, 10 s; 60°C, 5 s; 72°C, 10 s. The expression of three rat housekeeping genes (Hprt, Eno1, and Gapdh) was quantified as previously described (Iruthayanathan et al. 2005
). To identify the appropriate internal control gene for normalizing Cx 36 expression in mesopontine tegmentum across age, a statistical approach was used as described previously (Zhou et al. 2003
).
For comparison of data between the different groups in each experiment, measures were tested using one-factor ANOVA to conclude whether any of the factors has a significant effect on the magnitude of the variable and also whether the interaction of the factors significantly affects the variable. Differences were considered significant at values of P
0.05. If statistical significance was present, the Scheffe post hoc test was used to compare between groups.
| RESULTS |
|---|
|
|
|---|
|
|
6 Hz) after CAR, increased frequency oscillations after synaptic blockers and CAR (
8 Hz), and a decrease in power to initial levels after the application of CBX. Figure 2D shows a characteristic spikelet waveform. We further investigated whether neurons exhibiting spikelets had any characteristic voltage-dependent currents. We found that 5 of 18 (28%) cells with LTS manifested spikelets, 7 of 24 (29%) cells with IA currents had spikelets, and 6 of 20 (30%) cells with Ih cells had spikelets. Please note that some cells had more than one type of current.
We next investigated the presence of gap junctions using molecular techniques. Because Cx 36 is a neuronal gap junction protein, we examined Cx 36 gene expression in the mesopontine tegmentum and the SubC specifically for both mRNA and protein levels. Because studies suggest a reduction of electrical coupling may occur by 14 days of age, at least in some regions (Walton and Navarrete 1991
), we analyzed tissue across a wide developmental period. We first dissected the mesopontine tegmentum, omitting the colliculi, cerebellum, medulla, and midbrain anterior to the midcollicular level, in rats aged 7 days, 17 days, and adult (60 days). Figure 3A shows that the ratio of mRNA expression of Cx 36 compared with each of three housekeeping genes, Enolase, Hprt, and Gapdh (the ratios of these genes against each other did not change during development), were all high at 7 days, reduced by >50% by 17 days and by two-thirds in the adult. Figure 3B shows that Cx 36 protein levels were also high at 7 days, considerably decreased by 17 days and required extended exposure to be visible in the adult.
|
1/3 of those at day 10, the beginning of that decrease. Figure 3E shows representative Western blots of these results. Pooled samples from four litters showed that Cx 36 protein levels at 10 days (mean ± SE of integrated density values, 17,203 ± 1,383) versus 30 days (4,357 ± 297) were significantly different (ANOVA, df = 7, F = 82.48, P < 0.001; post hoc Scheffe P < 0.05). | DISCUSSION |
|---|
|
|
|---|
Although some SubC cells showed spontaneous spikelets, others required the addition of CAR. Others showed dye coupling but only some manifested spontaneous spikelets. Evidently, the conditions under which gap junctions open to produce coupling in the SubC are unknown, which lead us to suspect that we may be underestimating the degree of coupling observed with our current methods. Considering the high levels of Cx 36 gene expression and protein found, especially early in development, electrical coupling may be more prevalent.
The induction of spikelets and membrane oscillations by CAR are similar to those induced in electrically coupled neurons in the hippocampus (Valiante et al. 1995
). In fact, these oscillations occurred at a similar frequency to those manifested in the hippocampus, which can generate its own theta frequency in the absence of synaptic inputs (Reich et al. 2005
). The observation that CAR induced these effects in the presence of synaptic blockers is good evidence for the presence of electrical coupling as the likely mechanism mediating these oscillations and spikelets. The fact that CBX could block or reduce the occurrence of such oscillations and spikelets (and decreased theta power) further suggests the presence of electrical coupling, although additional testing with more specific gap junction blockers is needed (Cruikshank et al. 2004
).
Additional studies are needed to determine if pairs of SubC neurons are directly coupled (we did not record from a pair of directly coupled cells), if the coupled neurons represent specific morphological or transmitter type(s) (ongoing studies are attempting to reconstruct recorded cells and to identify the transmitter type, see following text), and if CAR can increase the degree of dye coupling (fixation immediately after induction of oscillations and spikelets has not been carried out). Future studies will need to address the possibility that some SubC neurons may contact locus coeruleus dendrites, which are known to be electrically coupled.
The observation of significant levels of Cx 36 gene expression and protein levels suggests that this neuronal gap junction protein is active in the mesopontine tegmentum, although its levels show a developmental decrease. Because other regions known to have electrical coupling (locus coeruleus, substantia nigra) were included in these samples, we used punches of the SubC to show the presence of Cx 36 protein. In both cases, the levels of Cx 36 decreased during development, but Cx 36 mRNA and protein levels were still detectable in the adult. This decrease paralleled the developmental decrease in REM sleep, making electrical coupling an attractive candidate mechanism for at least partially explaining the developmental decrement in REM sleep. Additional studies will be needed to establish a stronger link between physiological indices of electrical coupling and levels of Cx 36 mRNA and protein by recording larger numbers of neurons at 10 and 30 days of age (only younger ages were sampled electrophysiologically).
In the cortex, hippocampus and reticular nucleus of the thalamus, networks of electrically coupled neurons appear to be GABAergic (Amitai et al. 2002
; Bierlein et al. 2000; Fukuda and Kosaka 2000
; Landisman et al. 2002
). The localization of the recorded neurons in the SubC in this study was done using Lucifer yellow diffusion in patched cells and neurobiotin injection and Texas Red immunocytochemistry in sharp electrode cells. We are in the process of determining if all or only some of the neurons described here were GABAergic. On the other hand, a series of studies have shown that cells in the SubC P-wave generating region are immunopositive for vGlut-2 antibody, indicating they are glutamatergic (Datta 2006
). It has previously been demonstrated that cholinergic stimulation of the SunC increased glutamate release in the dorsal hippocampus, a site where SubC cells appear to project (Datta 2006
).
The present study provides evidence for the presence of functional gap junctions within the SubC nucleus, which has been implicated in the modulation of REM sleep. If electrical synapses are involved in coordinating SubC cells to produce synchrony within this nucleus, they are likely to have a profound effect on the production of PGO waves and will likely have an important role in REM sleep.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
Address for reprint requests and other correspondence: E. Garcia-Rill, Center for Translational Neuroscience, Dept. of Neurobiology and Developmental Sciences, University of Arkansas for Medical Sciences, 4301 W. Markham St., Slot 847, Little Rock, AR, 72205 (E-mail: GarciaRillEdgar{at}uams.edu)
| REFERENCES |
|---|
|
|
|---|
Baghdoyan HB, Rodrigo-Angulo RW, McCarley RW, Hobson JA. Site-specific enhancement and suppresion of desynchronized sleep signs following cholinergic stimulation of three brain stem regionc. Brain Res 306: 3952, 1984.[CrossRef][Medline]
Beierlein M, Gibson JR, Connors BW. A network of electrically coupled interneurons drives synchronized inhibition in neocortex. Nat Neurosci 3: 904910, 2000.[CrossRef][Web of Science][Medline]
Brown RE, Winston S, Basheer R, Thakkar MM, McCarley RW. Electrophysiological characterization of neurons in the dorsolateral pontine rapd-eye-movement sleep induction zone of the rat: intrinsic membrane properties and responses to carbachol and orexins. Neuroscience 143: 739755, 2006.[CrossRef][Web of Science][Medline]
Connors BW, Long MA. Electrical synapses in the mammalian brain. Annu Rev Neurosci 27: 393418, 2004.[CrossRef][Web of Science][Medline]
Cruikshank SJ, Hopperstad M, Younger M, Connors BW, Spray DC, Srinivas M. Potent block of Cx36 and Cx50 gap junction channels by mefloquine. Proc Natl Acad Sci USA 101: 1236412369, 2004.
Datta S. Activation of phasic pontine-wave generator: a mechanism for sleep-dependent memory processing. Sleep Biol Rhythms 4: 1626, 2006.[CrossRef]
Datta S, Siwek DF. Single cell activity patterns of pdenculopontine tegmentum neurons across the sleep-wake cycle in the freely moving rats. J Neurosci Res 70: 611621, 2002.[CrossRef][Web of Science][Medline]
Datta S, Siwek DF, Patterson EH, Cipollini PB. Localization of pontine PGO wave generation sites and their anatomical projections in the rat. Synapse 30: 409423, 1998.[CrossRef][Web of Science][Medline]
Deuerveilher S, Hennevin E. Lesions of the pedunculopontine tegmental nucleus reduce paradoxical sleep (PS) propensity: evidence from a short-term PS deprivation study in rats. Eur J Neurosci 13: 19631976, 2001.[CrossRef][Web of Science][Medline]
Fukuda T, Kosaka T. Gap junctions linking the dendritic network of GABAergic interneurons in the hippocampus. J Neurosci 20: 15191528, 2000.
Garcia-Rill E, Kobayashi T, Good C. The developmental decrease in REM sleep. Thal Related Syst 2: 115131, 2003.
Gerber U, Stevens DR, McCarley RW, Greene RW. Muscarinic agonists activate an inwardly rectifying potassium conductance in medial pontine reticular formation neurons of the rat in vitro. J Neurosci 11: 38613867, 1991.[Abstract]
Greene RW, Gerber U, McCarley RW. Cholinergic activation of medial pontine reticular formation neurons in vitro. Brain Res 476: 154159, 1989.[CrossRef][Web of Science][Medline]
Imon H, Ito K, Dauphin L, McCarley RW. Electrical stimulation of the cholinergic laterodorsal tegmental nucleus elicits scopolamine-sensitive excitatory postsynaptic potentials in medial pontine reticular formation neurons. Neuroscience 74: 393401, 1996.[CrossRef][Web of Science][Medline]
Iruthayanathan M, Zhou YH, Childs GV. Dehydroepiandrosterone restoration of growth hormone gene expression in aging female rats, in vivo and in vitro: evidence for actions via estrogen receptors. Endocrinology 146: 517687, 2005.
Jouvet M, Delorme F. Locus coeruleus et sommeil paradoxal. C R Soc Biol Paris 159: 895899, 1965.
Jouvet-Mounier D, Astic L, Lacote D. Ontogenesis of the states of sleep in rat, cat, and guinea pig during the first postnatal month. Dev Psychobiol 2: 216239, 1970.[Medline]
Karlsson KA, Gall AJ, Mohns EJ, Seelke AM, Blumberg MS. The neural substrates of infant sleep in rats. PloS Biol 3:e143, 2005.[CrossRef][Medline]
Landisman CE, Long MA, Beierlein M, Deans MR, Paul DL, Connors BW. Electrical synapses in the thalamic reticular nucleus. J Neurosci 22: 10021009, 2002.
Lu J, Sherman D, Devor M, Saper CB. A putative flip-flop switch for control of REM sleep. Nature 441: 589594, 2006.[CrossRef][Medline]
Marks GA, Farber J, Roffwarg HP. Metencephalic localization of ponto-geniculo-occipital waves in the albino rat. Exp Neurol 69: 667677, 1980.[CrossRef][Web of Science][Medline]
Mavanji V, Ulloor J, Saha S, Datta S. Neurotoxic lesions of phasic pontine-wave generator cells impair retention of 2-way active avoidance memory. Sleep 27: 12821292, 2004.[Web of Science][Medline]
Mitani A, Ito K, Hallanger AE, Wainer BH, Kataoka K, McCarley RW. Cholinergic projections from the laterodorsal and pedunculopontine tegmental field to the pontine gigantocellular tegmental field in the cat. Brain Res 451: 397402, 1988.[CrossRef][Web of Science][Medline]
Mitler MM, Dement WC. Cataplectic-like behavior in cats after micro-injections of carbachol in pontine reticular formation. Brain Res 68: 335343, 1974.[CrossRef][Web of Science][Medline]
Morrison AR. Paradoxical sleep without atonia. Arch Ital Biol 126: 275289, 1988.[Web of Science][Medline]
Moruzzi G, Magoun HW. Brain stem reticular formation and activation of the EEG. Electroencephlogr Clin Neurophysiol 1: 455473, 1949.
Mouret J, Delorme F, Jouvet M. Lesions of the pontine tegmentum and sleep in rats. CR Seances Soc Biol Fil 161: 16031606, 1967.[Web of Science][Medline]
Reese NB, Garcia-Rill E, Skinner RD. The pedunculopontine nucleus-auditory input, arousal and pathophysiology. Prog Neurobiol 47: 105133, 1995.[CrossRef][Web of Science][Medline]
Reich CG, Karson MA, Karnup SV, Jones LM, Alger BE. Regulation of IPSP theta rhythm by muscarinic receptors and endocannabinoids in hippocampus. J Neurophysiol 94: 42904299, 2005.
Roffwarg HP, Muzio JN, Dement WC. Ontogenetic development of the human sleep-dream cycle. Science 152: 604619, 1966.
Sakai K, El Mansari M, Jouvet M. Inhibition by carbachol microinjections of presumptive cholinergic PGO-on neurons in freely moving cats. Brain Res 527: 213223, 1990.[CrossRef][Web of Science][Medline]
Sanford LD, Morrison AR, Graziella LM, Harris JS, Yoo L, Ross RJ. Sleep patterning and behavior in cats with pontine lesions creating REM without atonia. J Sleep Res 3: 233240, 1994.[Web of Science][Medline]
Shiromani P, Armstrong DM, Gillin JC. Cholinergic neurons from the dorsolateral pons project to the medial pons : a WGA-HRP and choline acetyltransferase immunohistochemical study. Neurosci Lett 95: 1223, 1988.
Srinivas M, Rozental R, Kojima T, Dermietzel R, Mehler M. Functional properties of channels formed by the neuronal gap junction protein connexin 36. J Neurosci 19: 98489855, 1999.
Stevens DR, Birnstiel S, Gerber U, McCarley RW, Greene RW. Nicotinic depolarizations of rat medial pontine reticular neurons studied in vitro. Neuroscience 57: 419424, 1993.[CrossRef][Web of Science][Medline]
Steriade M, Datta S, Pare D, Oakson G, Curro Dossi R. Neuronal activities in brain-stem cholinergic nuclei related to tonic activation processes in thalamocortical systems. J Neurosci 10: 25412559, 1990a.[Abstract]
Steriade M, Paré D, Datta S, Oakson G, Curro Dossi R. Different cellular types in mesopontine cholinergic nuclei related to ponto-geniculo-occipital waves. J Neurosci 10: 25602579, 1990b.[Abstract]
Valiante TA, Perez JL, Velazquez J, Jahromi SS, Carlen PL. Coupling potentials in CA1 neurons during calcium-free-induced field burst activity. J Neurosci 15: 694656, 1995.
Vandecasteele M, Glowinski J, Venance L. Electrical synapses between dopaminergic neurons of the substantia nigra pars compacta. J Neurosci 25: 291298, 2005.
Vanni-Mercier G, Debilly G. A key role for the caudoventral pontine tegmentum in the simultaneous generation of eyesaccades in bursts and associated ponto-geniculo-occipital waves during paradoxical sleep in the cat. Neuroscience 86: 571585, 1989.[CrossRef]
Veruki ML, Hartveit E. Electrical synapses mediate signal transmission in the rod pathway of the mammalian retina. J Neurosci 22: 1055810566, 2002.
Walton KD, Navarrete R. Postnatal changes in motoneurone electrotonic coupling studied in the in vitro rat lumbar spinal cord. J Physiol 433: 283305, 1991.
Webster H, Jones BE. Neurotoxic lesions of the dorsolateral pontomesencephalic tegmentum-cholinergic cell area in the cat.II. Effects upon sleep-waking states. Brain Res 458: 285302, 1988.[CrossRef][Web of Science][Medline]
Yamamoto K, Mamelak AN, Quattrochi JJ, Hobson JA. A cholinoceptive desynchronized sleep induction zone in the anterolateral pontine tegmentum: locus of the sensitive region. Neurosci 39: 279293, 1990.[CrossRef][Web of Science][Medline]
Zhou YH, Hess RK, Liu L, Linskey ME, Yung WKA. Modeling prognosis for patients with malignant astrocytic gliomas: quantifying the expression of multiple genetic markers and clinical variables. Neurooncology 7: 48594, 2005.[Abstract]
Zhou YH, Tan F, Hess KR, Yung WK. The expression of PAX6, PTEN, vascular endothelial growth factor, and epidermal growth factor receptor in gliomas: relationship to tumor grade and survival. Clin Cancer Res 9: 336975, 2003.
This article has been cited by other articles:
![]() |
F. J. Urbano, E. Leznik, and R. R. Llinas Modafinil enhances thalamocortical activity by increasing neuronal electrotonic coupling PNAS, July 24, 2007; 104(30): 12554 - 12559. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ennis and S. Datta Electrotonic Coupling in the Nucleus SubCoeruleus. Focus on "Evidence for Electrical Coupling in the SubCoeruleus (SubC) Nucleus" J Neurophysiol, April 1, 2007; 97(4): 2579 - 2579. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |