| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Neurology and Neurosurgery, Montreal Neurological Institute, McGill University, Montreal, Quebec, Canada
Submitted 23 November 2006; accepted in final form 13 April 2007
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMETHODSRESULTSDISCUSSIONGRANTSACKNOWLEDGMENTSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONGRANTSACKNOWLEDGMENTSREFERENCES |
|---|
), whereas layer V EC principal neurons receive projections from the cortex and from the hippocampus through the subiculum, sending back projections to the neocortical mantle (Insausti et al. 1997; Lavenex and Amaral 2000; Witter et al. 2000).
EC receives massive cholinergic input from the basal forebrain (Alonso and Köhler 1984; Lysakowski et al. 1989); this cholinergic modulation has been related to processes of working memory and memory consolidation during wake and rapid eye movement (REM) sleep periods (Hasselmo 1999). At the cellular level, it has been extensively shown that cortical cholinergic input is neuromodulatory (Andrade 1991; Azouz et al. 1994; Barkai and Hasselmo 1994; Benardo and Prince 1981; Krnjevic et al. 1971; Rovira et al. 1983; Wang and McCormick 1993).
In the presence of a cholinergic agonist, principal neurons in layer V of the medial entorhinal cortex (mEC) of the adult rat respond to repeated applications of a brief stimulus with a graded change in persistent firing frequency. Their firing frequency can be regulated up or down by short-step depolarizations or hyperpolarizations, respectively. This graded pattern of discharge, sensitive to the muscarinic receptor antagonist atropine, has been proposed to represent an intrinsic cellular mechanism for short-term memory operations (Egorov et al. 2002a; Frank and Brown 2003). Cholinergic modulation in layer II of mEC can also trigger postburst activity that self-terminates (Klink and Alonso 1997).
It has been proposed, from behavioral studies, that working-memory ability in rats develops during the first postnatal weeks (Green and Stanton 1989; Stanton 2000). This period of development is highly dynamic both for the cholinergic system, which is the last of the main neuromodulatory systems to reach the cortex (Foehring and Lorenzon 1999; Kiss and Patel 1992; Zahalka et al. 1993), and for the cortical neurons that undergo major phenotypical changes related to the expression of receptors (Tice et al. 1996) and to intrinsic properties (Zhang 2004; Zhou and Hablitz 1996).
The intrinsic properties of cortical neurons and their influence on signal processing have been extensively studied (Contreras 2004; Llinas 1988). These properties are determined by the morphology of the neuron (Whitford et al. 2002), the pool of channels (Moody and Bosma 2005; Picken Bahrey and Moody 2003) and receptors available (Lee et al. 1990; Tice et al. 1996), and by the intracellular machinery coupling receptors to signaling pathways (Balduini et al. 1987). All these factors contribute to the deep transformation observed during the early stages of postnatal development (Connors 1994; Lee et al. 1990).
In the present work we characterize the changes in passive and active properties of the principal neurons in layer V of mEC during the early stages of postnatal development and we describe the increasingly important role of cholinergic modulation during this crucial period. Muscarinic receptor activation triggers a cascade of second messengers that could be sensitive to intracellular washout so we compared the effect of ruptured-patch and perforated-patch recording on the graded persistent activity.
|
METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONGRANTSACKNOWLEDGMENTSREFERENCES |
|---|
1 h before recording at room temperature (22°C). ACSF was constantly bubbled with carbogen (95% O2-5% CO2).
Slices perfused with the extracellular solution were placed in a recording chamber mounted on the stage of an upright microscope Axioskop (Zeiss, Oberkochen, Germany) equipped with a x63 water-immersion objective and differential contrast optics. A near-infrared charged-coupled device (CCD) camera (Sony XC-75) was used to visualize the neurons. Layer V medial entorhinal neurons selected for recording were located close to the lamina dissecans and were filled with biocytin for later identification. The cells were recorded using the current-clamp technique at 33 ± 1°C with an Axopatch 1D or 200B amplifier and Clampex 8.0 recording software (Axon Instruments, Foster City, CA). Whole cell recordings were performed using perforated- or ruptured-patch techniques. Perforated patch was obtained using amphotericin-B (175–200 µg/ml) (Rae et al. 1991). Bath composition was (in mM): 125 NaCl, 1.25 NaH2PO4, 25 NaHCO3, 2 MgCl2, 1.6 CaCl2, 2.5 KCl, 10 glucose, 2 kynurenic acid, and 0.1 picrotoxin; bath solution was constantly bubbled with carbogen. Intracellular pipette solution consisted of (in mM): 120 K-gluconate, 10 HEPES, 0.2 EGTA, 20 KCl, 2 MgCl2, 7 di-Tris phosphocreatine, 4 Na2ATP, 0.3 Tris-GTP, and 0.1% biocytin (pH adjusted at 7.3 with KOH). The same intracellular solution was used for perforated and ruptured whole cell recordings. Drugs and chemicals were purchased from Sigma (St. Louis, MO).
Patch pipettes (5–7 M
) were pulled using a Sutter P-97 horizontal puller (Sutter Instrument, Novato, CA). Tight seals (>5 G) were obtained by applying constant negative pressure. Electrical access to the cell was obtained either by suction (ruptured-patch configuration) or by waiting 30 min for amphotericin-B to attain a stable access resistance (perforated-patch configuration). Bridge correction was done using the built-in circuit of the amplifier. Sampling rate was 20 kHz and the low-pass filter was set at 5 kHz.
Spike-frequency adaptation was measured using 1.5-s current–voltage (I–V) protocols in current-clamp using 10-pA increasing current steps. In these protocols, the first step analyzed was the first pulse triggering at least four action potentials. Steps not showing a positive adaptation were removed for purposes of calculating the adaptation index (AI), which was calculated according to the following equation
 |
 |
 |
Initial and final frequency data were also plotted against 10-pA current steps and fitting a straight line to the first five data points. Linear fitting comparison was performed using GraphPad Prism 4.0.
Multiple comparisons were assessed using ANOVA (P < 0.05) or paired Student's t-test (P < 0.05) for control–carbachol comparison inside each age group.
Plateau potentials were achieved by application of 1-s, 50-pA step depolarizations at voltages close to –60 mV. Frequency of the plateau was graded up with similar step depolarizations and graded down with 1- to 2-s, 50- to 100-pA hyperpolarizations.
ChAT immunostaining
Brains from postnatal day 5 (P5), P12, P21, and adult animals transcardially perfused with 4% paraformaldehyde were postfixed for 24 h and sliced horizontally (100 µm) using a freezing microtome. The slices were incubated overnight in goat anti-choline acetyltransferase (ChAT) antibodies (1:500, Chemicon), rinsed, and then incubated with secondary biotinylated rabbit anti-goat antibodies (1:200, Vector Laboratories) for 90 min. Sections were rinsed, stained with the ABC technique (Vector Laboratories), dehydrated, and mounted for imaging in light microscopy.
Quantitative real-time RT-PCR analysis
Oligonucleotide primers were designed to generate small amplicons for rat M1 muscarinic cholinergic receptor mRNA (TCCTTCAAG GTCAACACCG and ATTCATGACAGAGGCGTTGC) and for GAPDH mRNA (ATCTTCTTGTGCAGTGCCAG and CGTTGA TGGCAACAATCTCC). Total RNA (100 ng/sample) was isolated using the SV total RNA isolation kit (Promega). Real-time PCR was carried out with the SYBR Green I kit (Qiagen) in a Rotor Gene 3000 thermal cycler (Corbett Research). The temperature profile for single-tube quantitative RT-PCR was: reverse transcription at 50°C for 30 min, Hot Start Taq (1.25 units/sample) activation 15 min at 95°C, 40 cycles of denaturation 15 s at 94°C, annealing 30 s at 56°C, and extension 30 s at 72°C. SYBR Green fluorescence was acquired at the end of the extension cycle. A melting curve analysis was performed at the end of each run to verify single-product formation for each reaction. Relative expressions of target genes were determined in comparison to GAPDH using the Pfaffl method (Pfaffl 2001). Initial experiments were carried out to determine the efficiency of each pair of primers and to confirm amplification linearity.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONGRANTSACKNOWLEDGMENTSREFERENCES |
|---|
Before application of carbachol (CCh), neurons from each age group were characterized electrophysiologically by measuring their passive membrane properties (resting membrane potential, membrane resistance, and time constant), their action potentials, and their responses to I–V protocols. Age groups were established as follows: 5–7, 10–13, 16–19, and 21–23 postnatal days. For reasons of clarity we assigned a code to each group: P5, P10, P16, and P21, respectively. Resting membrane potential was measured in current clamp without current injection after bridge compensation. Membrane resistance and time constant were determined using negative low-intensity current pulses (10–25 pA) from –60 mV. Action potential threshold was obtained from control experiments where current was injected to reach the rheobase. Amplitude was calculated using the threshold as a reference and by measuring the depolarization from threshold to the maximum. Duration was measured at the half-amplitude point between the threshold and the maximum. Data are grouped in Table 1. As the animals get older, significant differences appeared: resting membrane potential became more negative, membrane resistance decreased, and time constants were shorter (Fig. 1). Changes in the resting membrane potential could be directly related to a decrease in membrane resistance caused by an increase in the number and characteristics of the channels opened at the resting level and/or by an increase in cellular size.
|
|
All these variables, also measured in ruptured-patch configuration in P16 animals, did not show significant differences with their equivalents measured in perforated-patch configuration (P > 0.05).
Developmental changes in spike properties: ADP and AHP
Besides changes in their threshold, amplitude, and duration, action potentials in layer V principal neurons of the mEC show a gradual increase in afterdepolarization (ADP) and afterhyperpolarization (AHP) during development. Action potentials were evoked by injecting current to keep the cells at –60 mV and applying very short stimuli (0.5 to 1 ms, 1 to 2 nA). In the groups P16 and P21, an abrupt deflection of the membrane potential after the spike indicates an ADP (Fig. 2, C and D). In P5 and P10 groups ADP was more difficult to resolve because the repolarizing rate is more gradual (Fig. 2, A and B); therefore the start of ADP was determined using the second derivative from the trace. The data for ADP do not show statistical differences in amplitude, duration, or area (Table 2). Nevertheless, we observed a significant increase in several AHP parameters during development, including amplitude, duration, and area (Table 2). The P5 group does not show AHP at –60 mV.
|
|
In Fig. 3 (insets) we show typical examples of the firing patterns that we used to calculate the adaptation index (AI) for each age group.
|
|
|
|
|
Previous studies used intracellular recordings with the sharp electrode technique to describe the phenomenon of graded persistent activity in the presence of CCh. Because we used the patch-clamp technique to analyze the prevalence of the graded persistent activity through the early postnatal period, we wanted to eliminate rundown resulting from the washout of diffusible intracellular messengers. To characterize the sensitivity of graded persistent activity to recording conditions, we studied the response of P16 neurons to step depolarizations of 1-s duration and 50-pA amplitude in the presence of 5 µM CCh in ruptured-patch (Fig. 5 A) or perforated-patch (Fig. 5B) recordings, 5 or 30 min after CCh application. The first difference was observed in the number of cells displaying graded persistent activity after 5 min of CCh application in ruptured patch (three of eight) and perforated patch (11 of 16). After 30 min, only one neuron from the ruptured-patch group maintained the graded persistent activity, whereas 10 of 11 neurons recorded in perforated-patch configuration maintained this activity (Fig. 5B).
|
15 s (delayed activity or self-terminating plateau), a persistent plateau with a constant frequency that does not change with subsequent step depolarizations (persistent activity), and a persistent plateau that can be modulated in frequency by step depolarizations that increase the frequency or by step hyperpolarizations that decrease the frequency (graded persistent activity). According to our method of classification, the three types of response cannot be interconverted: neurons in the category "delayed activity" are not able to display persistent activity despite increasing stimulations and neurons in the category "persistent activity" are not able to display graded activity despite increasing stimulations. Logically, neurons with graded persistent activity could also show persistent and delayed activity depending either on the membrane potential or on parameters of the step depolarization. A few neurons did not show any neuromodulatory effect in the presence of a cholinergic agonist. Among the three different types of activity described, the graded persistent activity is the most sensitive to washout of the cytoplasm during ruptured-patch recording. It was common to observe that neurons showing graded persistent activity switched to delayed or persistent activity after 30 min ruptured-patch recording (2 of 3 cells in P16 group). Delayed and persistent activity were preserved during long periods of time (>1 h) in ruptured-patch recording (4 of 4, P16). Proportions of neurons, recorded in perforated-patch configuration, showing the different types of activity are represented in Fig. 6. It is interesting to notice how the percentage of cells that show sustained activity in the presence of CCh increases with development. In parallel, there is an increase in the percentage of cells that are able to grade the frequency of the plateau (Fig. 6A). In Fig. 6B we show the impact of cholinergic modulation (for the cells that showed graded persistent activity from the beginning) after 30 min in CCh and recording in perforated-patch configuration. Most of the cells in the two oldest groups retained this activity (P16: 10 of 11; P21: 8 of 11), whereas in the P10 group some cells have lost the graded activity, displaying instead persistent or self-terminating behavior (P16: 3 of 6 neurons retained graded activity).
|
|
Development of cholinergic transmission in medial entorhinal cortex
We also performed ChAT immunostaining to investigate the change in the pattern of cholinergic projections in the entorhinal cortex during early postnatal development. As illustrated in Fig. 7, the 5-day-old animals do not yet show cholinergic fibers. As the development advances, we observe the appearance of some cholinergic interneurons and the number and density of cholinergic fibers increase. The P21 group shows a cholinergic pattern very similar to that of adult animals (Fig. 7). This parallel development of the cholinergic innervation and of the response to cholinergic modulation points to developmental changes in the expression levels of the muscarinic metabotropic receptors. To study the relation between muscarinic receptor levels and cholinergic modulation, we measured the mRNA levels of the M1 subtype of metabotropic muscarinic receptors in the entorhinal cortex of 5-, 12-, and 21-day-old and adult animals using quantitative RT-PCR. The results obtained show a significant increase from P5 to P12, after which the levels stay constant (Fig. 8). The timing of the upregulation of M1 muscarinic receptor mRNA coincides with the appearance of cholinergic modulation leading to persistent and graded activity. These results do not completely explain the differences in CCh modulation for the different age groups because it is obvious that M1 mRNA levels do not follow the time course observed in CCh responses, suggesting the participation of additional regulatory factors in the mechanisms of cholinergic modulation.
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONGRANTSACKNOWLEDGMENTSREFERENCES |
|---|
), the dendrites are not completely developed (Whitford et al. 2002), and there are changes in membrane conductances, with the appearance of some conductances (Ih, Kv3.1) and the increase of others (INa, ICa, INa,p, BK) (Picken Bahrey and Moody 2003; for a review see Moody and Bosma 2005). This change in conductance levels could be linked to the decrease in membrane resistance that we observed, itself related to the decrease of time constant according to the equation: 
= RC. The arborization and extension of the dendrites increase the capacitance of the cell; therefore the fact that the time constant decreases from 92.83 to 44.05 ms indicates a parallel increase in the density of channels in the cells studied. From a functional perspective, the high resistance and long time constant that we measured at the earliest stages when the synapses are not fully formed would improve the chance of a given stimulus to generate a response in the target cell because stimuli of lower intensities would be able to reach threshold and the chances of spatial and temporal summation would be higher. The gradual decrease of the resting membrane potential from –49.92 to –65.97 mV could likely be explained by developmental changes in K conductances (Jones 1989; Storm 1990).
Changes in active properties have previously been shown for layer V neocortical neurons and our results corroborate those findings. The proposed mechanism is an increase in the levels of Na+ and K+ currents that explains the increase in amplitude, decrease in duration, and change in the threshold value for the action potential (Zhang 2004). It has been reported that the difference between resting membrane potential and threshold remains constant throughout development (McCormick and Prince 1987; Zhang 2004). The main difference between our data showing a smaller difference at P5 and previous data from the prefrontal cortex is that the authors selected the neurons according to the resting membrane potential (i.e., cells below –45 mV), which could introduce a bias in the calculation. Indeed, if we analyze our results by selecting only the cells with a resting membrane potential below –45 mV, we do not obtain any significant differences among the different age groups (ANOVA, P > 0.05; data not shown). It has been proposed that cellular ionic mechanisms would be necessary to maintain this difference throughout development, but a reduction in this difference would allow the cell to be more sensitive to smaller current changes in the synapses, which again would be a mechanism that works to overcome the lack of maturity of the synapse.
There are also developmental changes in the characteristics of the action potentials and the phenomena associated with them, such as ADP and AHP. We showed a clear increase in AHP parameters (amplitude, duration, and area) with development and an apparent increase in ADP showing a clear "shoulder" in the P16 and P21 groups (Fig. 2, C and D). However, because it was not possible to see a clear deflection of the membrane potential after the spike in the two younger groups, as evident in the two older groups, we had to use the second derivative to define the initial point of ADP. Using this method, it was not possible to measure significant differences in ADP among the groups. We must also consider the possibility that the AHP current is masking the ADP so we can observe a change in the shape of the ADP but not a real increase in amplitude, duration, or area.
Changes in spike-frequency adaptation are drastic during this postnatal period. The P21 group shows the strongest adaptation (Fig. 3, B and C). Additionally the final frequency analysis shows a gradual decrease in the intersection value from P5 to P21 (Fig. 4E), which indicates higher steady-state frequencies. Nevertheless, older animals are able to achieve higher initial frequencies before reaching inactivation of the action potential arising from current injection. It has been shown that entorhinal layer V pyramidal neurons show a fast and medium AHP (Egorov et al. 2002b) and we reported here a progressive increase in medium AHP parameters as the age increases. Therefore we conclude that the difference in final frequency and spike adaptation among the different age groups in control is mainly caused by an increase of medium AHP, which could be mediated by KCNQ/M channels and h-channels as in CA1 pyramidal neurons (Gu et al. 2005). Further support for this conclusion is provided by the fact that application of CCh increases the final frequency, in agreement with previous work showing the cholinergic blockade of medium AHP in CA1 neurons (Peters et al. 2005; Storm 1989). At a more functional level, blockade of AHP has been linked to improved working-memory performance (Stocker et al. 2004). Activation of a cholinergic depolarizing cationic nonspecific conductance (CAN) would also facilitate depolarizing the cell (Egorov et al. 2002a; Reboreda-Prieto et al. 2006).
Initial frequency analysis shows no difference in slope among the age groups (Fig. 4B). However there is a difference in the intersection value of P5 with the other groups; again, this could be related to the lack of AHP at P5. Surprisingly we also find significant differences in the intersection value between P16 and P21, which could be related to the change observed in ADP shape. ADP could increase the chances of firing a second action potential as a result of the "shoulder," which becomes obvious in the P16 group and is even more prominent in the P21 group (Fig. 2, C and D). Application of CCh decreases the initial frequency slope for the P10, P16, and P21 groups. This phenomenon could be explained by the activation of the SK calcium-dependent K+ channel, as reported in layer V neocortical neurons (Gulledge and Stuart 2005). Both decrease of initial frequency and increase of final frequency will account for the overall decrease of adaptation during cholinergic modulation observed in P10, P16, and P21 groups. It is interesting to notice that after CCh application P10, P16, and P21 neurons behave in a very similar way to that of the P5 group.
Overall our data show a gradual change in the passive and active electrophysiological properties of the layer V principal neurons in early developing animals. The passive properties in the youngest animals are a consequence of their reduced morphology and of lower levels of channel expression; this difference will allow the cell to become more sensitive to small current changes in a period of time where the synapses are still in formation. If we consider spike-frequency adaptation as an important factor to maintain the coherence of network oscillation (Fuhrmann et al. 2002), it is reasonable to think that this property will have a more central role in adult animals than in very young animals where the network is not completely established. It was recently reported that very young animals show beta network activity between local groups of cells and that this activity is maintained by gap junctions and subplate mechanisms that disappear after 12 days, switching to a mechanism based on N-methyl-D-aspartate receptor (Dupont et al. 2006). It is possible that this ability to use different mechanisms depending on the maturity of the network is extended to intrinsic properties of the neurons. Thus cholinergic afferents would be able to modulate the firing-frequency adaptation and also the dynamics of the network in more mature animals, whereas in the youngest group reduced adaptation and limited cholinergic modulation suggest the expression of other mechanisms.
One of the main objectives of this study was to characterize the developmental changes in cholinergic modulation. It has been described that, during cholinergic modulation, layer V principal neurons are able to display sustained activity after a step depolarization and the frequency of this sustained activity can be modulated by subsequent step depolarizations (increase) or hyperpolarizations (decrease) (Egorov et al. 2002a). We have shown that, although the sustained activity by itself is very resistant to dialysis of the cytoplasm by the patch pipette solution (Fig. 5), the graded activity disappears quickly after achieving the ruptured-patch configuration. We observed a smaller percentage of cells with graded activity in ruptured-patch than in perforated-patch configuration and those cells that show graded activity in perforated patch are able to keep it for a longer time than in ruptured-patch configuration (Fig. 6). This graded activity is dependent on cholinergic modulation and extracellular Ca2+ (Egorov et al. 2002a), which is, at least in part, responsible for the activation of a CAN current. From our data, we can dissociate the mechanism responsible for sustained activity, most probably membrane bound, from the mechanism responsible for the graded activity mediated by a cytoplasmic factor, which either modulates the CAN current or opens another type of channel. Recently a model involving a cytoplasmic cascade regulated by high and low levels of intracellular Ca2+ with a neutral zone in between (e.g., kinases/phosphatases) has been proposed for direct modulation of the CAN channel (Fransen et al. 2006).
From a developmental perspective, our data showed increasing effects of CCh as the animal gets older, leading to the induction of graded persistent activity for the first time at P10 and frequent occurrence in P16 and P21 groups. In the few cells that do not show postburst response to CCh application (including P5 neurons), there is a block of AHP after the step depolarization. The ability of the cells to show sustained firing after the stimulus has been reported previously in this region and other areas of the neocortex (Andrade 1991). It is commonly accepted that persistent firing allows the cell to retain information about the stimulus for a determined amount of time. Graded persistent activity also gives the cell the ability to store several bits of information at different levels of frequency. All these phenomena are proposed as mechanisms of cellular memory (Egorov et al. 2002a; Frank and Brown 2003; Fransen et al. 2006). The developmental changes in the passive and active membrane properties of layer V neurons leading to an increase in excitability are required for the acquisition of graded persistent activity. However, because most of these changes are not specific to this type of cortical neurons (Franceschetti et al. 1998; Kasper et al. 1994; McCormick and Prince 1987), we conclude that they are necessary but not sufficient and that novel properties need to be acquired for the expression of graded activity.
Our data obtained at P5, P12, and P21 show a drastic increase in the density of ChAT-positive cholinergic projections originating from the basal forebrain to the medial EC. This is in agreement with previous reports showing that the cholinergic system reaches maturity between the third and the fourth postnatal weeks (Kiss and Patel 1992; Zahalka et al. 1993). To investigate other mechanisms leading to increased cholinergic modulation, we compared the levels of mRNA of M1 muscarinic receptor at different ages. We chose M1 because it is a major central subtype of cholinergic receptors in the brain that shows changes of expression during postnatal development (Lee et al. 1990; Tice et al. 1996). We measured an upregulation of M1 mRNA from P5 to P12 stages, whereas the higher levels remain constant throughout P12, P21, and adult. Although at a first glance we could think that the difference in the prevalence of the graded persistent activity arises from the lack of cholinergic stimulation in the youngest animals, either by lack of cholinergic projections or low levels of muscarinic receptors, we should also keep in mind that, even if P12 animals have M1 mRNA levels similar to those of adult animals, early development processes also affect the intracellular machinery. It has been shown that during the first two postnatal weeks the accumulation of IP3 in the cytoplasm after cholinergic stimulation reaches levels higher than those in 75-day-old rats, which indicate developmental changes in the intracellular coupling to the PLC pathway (Balduini et al. 1987). Moreover, it has been reported that muscarinic receptor expression precedes cholinergic innervation in the rat parietal cortex (Buwalda et al. 1995).
It has been shown that cholinergic modulation is related to working-memory and memory-consolidation processes during wake states and REM sleep (Hasselmo 1999). Green and Stanton (1989) (see also Stanton 1982) analyzed working memory during development in 15-, 21-, and 27-day-old rats. They showed that working-memory performances were poorer in 15-day-old animals than in older groups. These differences are also shown at a younger age in a study of 11- and 14-day-old rats (Stanton 1982). Moreover, using the same type of tasks that have a delay between the sample and choice runs, medial septum lesions impair the performance in spatial working-memory tasks (Kelsey and Vargas 1993), which again points to the importance of cholinergic modulation. The mEC has been shown to be directly involved in spatial working-memory processes (Fyhn et al. 2004).
We have shown that principal neurons in layer V of mEC, which at the earliest stages show a range of firing frequencies narrower and more stereotyped (lower maximum frequency and less adaptation), gradually acquire a wide array of frequency responses, modulable by cholinergic input, thus likely allowing them to translate small changes in environmental stimuli into complex firing patterns. In summary, during postnatal development, the increasing influence of the cholinergic input on the firing properties of entorhinal neurons leads to the expression of the graded persistent activity, which has been proposed as a cellular basis of working memory, through the activation of metabotropic mechanisms whose exact nature remains to be identified.
|
GRANTS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONGRANTSACKNOWLEDGMENTSREFERENCES |
|---|
|
ACKNOWLEDGMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONGRANTSACKNOWLEDGMENTSREFERENCES |
|---|
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Address for reprint requests and other correspondence: Dr P. Séguéla, Montreal Neurological Institute, 3801 University Street, Montreal, Quebec, Canada, H3A 2B4 (E-mail: philippe.seguela{at}mcgill.ca)
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONGRANTSACKNOWLEDGMENTSREFERENCES |
|---|
Andrade R. Cell excitation enhances muscarinic cholinergic responses in rat association cortex. Brain Res 548: 81–93, 1991.[CrossRef][Web of Science][Medline]
Azouz R, Jensen MS, Yaari Y. Muscarinic modulation of intrinsic burst firing in rat hippocampal neurons. Eur J Neurosci 6: 961–966, 1994.[CrossRef][Web of Science][Medline]
Balduini W, Murphy SD, Costa LG. Developmental changes in muscarinic receptor-stimulated phosphoinositide metabolism in rat brain. J Pharmacol Exp Ther 241: 421–427, 1987.
Barkai E, Hasselmo ME. Modulation of the input/output function of rat piriform cortex pyramidal cells. J Neurophysiol 72: 644–658, 1994.
Benardo LS, Prince DA. Acetylcholine-induced modulation of hippocampal pyramidal neurons. Brain Res 211: 227–234, 1981.[CrossRef][Web of Science][Medline]
Buwalda B, de Groote L, Van der Zee EA, Matsuyama T, Luiten PGM. Immunocytochemical demonstration of developmental distribution of muscarinic acetylcholine receptors in rat parietal cortex. Dev Brain Res 84: 185–191, 1995.[CrossRef][Medline]
Connors B. Intrinsic neuronal physiology and the functions, dysfunctions and development of neocortex. Prog Brain Res 102: 195–203, 1994.[Web of Science][Medline]
Contreras D. Electrophysiological classes of neocortical neurons. Neural Networks 17: 633–646, 2004.[CrossRef][Web of Science][Medline]
Dupont E, Hanganu IL, Kilb W, Hirsch S, Luhmann HJ. Rapid developmental switch in the mechanisms driving early cortical columnar networks. Nature 439: 79–83, 2006.[CrossRef][Medline]
Egorov AV, Hamam BN, Fransen E, Hasselmo ME, Alonso AA. Graded persistent activity in entorhinal cortex neurons. Nature 420: 173–178, 2002a.[CrossRef][Medline]
Egorov AV, Heinemann U, Muller W. Differential excitability and voltage-dependent Ca2+ signalling in two types of medial entorhinal cortex layer V neurons. Eur J Neurosci 16: 1305–1312, 2002b.[CrossRef][Web of Science][Medline]
Foehring RC, Lorenzon NM. Neuromodulation, development and synaptic plasticity. Can J Exp Psychol 54: 45–61, 1999.
Franceschetti S, Sancini G, Panzica F, Radici C, Avanzini G. Postnatal differentiation of firing properties and morphological characteristics in layer V pyramidal neurons of the sensorimotor cortex. Neuroscience 83: 1013–1024, 1998.[CrossRef][Web of Science][Medline]
Frank LM, Brown EN. Persistent activity and memory in the entorhinal cortex. Trends Neurosci 26: 400–401, 2003.[CrossRef][Web of Science][Medline]
Fransen E, Tahvildari B, Egorov AV, Hasselmo ME, Alonso AA. Mechanism of graded persistent cellular activity of entorhinal cortex layer V neurons. Neuron 49: 735–746, 2006.[CrossRef][Web of Science][Medline]
Fuhrmann G, Markram H, Tsodyks M. Spike frequency adaptation and neocortical rhythms. J Neurophysiol 88: 761–770, 2002.
Fyhn M, Molden S, Witter MP, Moser EI, Moser M-B. Spatial representation in the entorhinal cortex. Science 305: 1258–1264, 2004.
Green RJ, Stanton ME. Differential ontogeny of working memory and reference memory in the rat. Behav Neurosci 103: 98–105, 1989.[CrossRef][Web of Science][Medline]
Gu N, Vervaeke K, Hu H, Storm JF. Kv7/KCNQ/M and HCN/h, but not KCa2/SK channels, contribute to the somatic medium after-hyperpolarization and excitability control in CA1 hippocampal pyramidal cells. J Physiol 566: 689–715, 2005.
Gulledge AT, Stuart GJ. Cholinergic inhibition of neocortical pyramidal neurons. J Neurosci 25: 10308–10320, 2005.
Haj-Dahmane S, Andrade R. Calcium-activated cation nonselective current contributes to the fast afterdepolarization in rat prefrontal cortex neurons. J Neurophysiol 78: 1983–1989, 1997.
Hasselmo ME. Neuromodulation: acetylcholine and memory consolidation. Trends Cogn Sci 3: 351–359, 1999.[CrossRef][Web of Science][Medline]
Hogg RC, Raggenbass M, Bertrand D. Nicotinic acetylcholine receptors: from structure to brain function. Rev Physiol Biochem Pharmacol 147: 1–46, 2003.[Web of Science][Medline]
Insausti R, Herrero MT, Witter MP. Entorhinal cortex of the rat: cytoarchitectonic subdivisions and the origin and distribution of cortical efferents. Hippocampus 7: 146–183, 1997.[CrossRef][Web of Science][Medline]
Jones SW. On the resting potential of isolated frog sympathetic neurons. Neuron 3: 153–161, 1989.[CrossRef][Web of Science][Medline]
Kasper EM, Larkman AU, Lubke J, Blakemore C. Pyramidal neurons in layer 5 of the rat visual cortex. II. Development of electrophysiological properties. J Comp Neurol 339: 475–494, 1994.[CrossRef][Web of Science][Medline]
Kelsey JE, Vargas H. Medial septal lesions disrupt spatial, but not nonspatial, working memory in rats. Behav Neurosci 107: 565–574, 1993.[CrossRef][Web of Science][Medline]
Khaing ZZ, Fidler L, Nandy N, Phillips GR. Structural stabilization of CNS synapses during postnatal development in rat cortex. J Neurochem 98: 471–480, 2006.[CrossRef][Web of Science][Medline]
Kiss J, Patel AJ. Development of the cholinergic fibres innervating the cerebral cortex of the rat. Int J Dev Neurosci 10: 153–170, 1992.[CrossRef][Web of Science][Medline]
Klink R, Alonso A. Muscarinic modulation of the oscillatory and repetitive firing properties of entorhinal cortex layer II neurons. J Neurophysiol 77: 1813–1828, 1997.
Krnjevic K, Pumain R, Renaud L. The mechanism of excitation by acetylcholine in the cerebral cortex. J Physiol 215: 247–268, 1971.
Lanzafame AA, Christopoulos A, Mitchelson F. Cellular signaling mechanisms for muscarinic acetylcholine receptors. Receptors Channels 9: 241–260, 2003.[CrossRef][Web of Science][Medline]
Lavenex P, Amaral DG. Hippocampal–neocortical interaction: a hierarchy of associativity. Hippocampus 10: 420–430, 2000.[CrossRef][Web of Science][Medline]
Lee W, Nicklaus KJ, Manning DR, Wolfe BB. Ontogeny of cortical muscarinic receptor subtypes and muscarinic receptor-mediated responses in rat. J Pharmacol Exp Ther 252: 482–490, 1990.
Llinas RR. The intrinsic electrophysiological properties of mammalian neurons: insights into central nervous system function. Science 242: 1654–1664, 1988.
Lysakowski A, Wainer BH, Bruce G, Hersh LB. An atlas of the regional and laminar distribution of choline acetyltransferase immunoreactivity in rat cerebral cortex. Neuroscience 28: 291–336, 1989.[CrossRef][Web of Science][Medline]
Magistretti J, Castelli L. Differential expression of resurgent sodium current in rat hippocampal, parahippocampal, and palaeocortical neurons. FENS Abstr 3: A011.012, 2006.
McCormick D, Prince D. Post-natal development of electrophysiological properties of rat cerebral cortical pyramidal neurones. J Physiol 393: 743–762, 1987.
Moody WJ, Bosma MM. Ion channel development, spontaneous activity, and activity-dependent development in nerve and muscle cells. Physiol Rev 85: 883–941, 2005.
Peters HC, Hu H, Pongs O, Storm JF, Isbrandt D. Conditional transgenic suppression of M channels in mouse brain reveals functions in neuronal excitability, resonance and behavior. Nat Neurosci 8: 51–-60, 2005.[CrossRef][Web of Science][Medline]
Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45, 2001, Online.
Picken Bahrey HL, Moody WJ. Early development of voltage-gated ion currents and firing properties in neurons of the mouse cerebral cortex. J Neurophysiol 89: 1761–1773, 2003.
Rae J, Cooper K, Gates P, Watsky M. Low access resistance perforated patch recordings using amphotericin B. J Neurosci Methods 37: 15–26, 1991.[CrossRef][Web of Science][Medline]
Reboreda-Prieto A, Alonso A, Séguéla P. Characterization of Ican role on the firing pattern of layer V neurons from rat entorhinal cortex under cholinergic modulation. FENS Abstr 3: A153.113, 2006.
Rovira C, Ben-Ari Y, Cherubini E. Dual cholinergic modulation of hippocampal somatic and dendritic field potentials by the septo-hippocampal pathway. Exp Brain Res 49: 151–155, 1983.[Web of Science][Medline]
Stanton ME. Performance of 11- and 14-day-old rats on a working memory problem. Behav Neural Biol 36: 304–310, 1982.[CrossRef][Web of Science][Medline]
Stanton ME. Multiple memory systems, development and conditioning. Behav Brain Res 110: 25–37, 2000.[CrossRef][Web of Science][Medline]
Steward O, Scoville SA. Cells of origin of entorhinal cortical afferents to the hippocampus and fascia dentata of the rat. J Comp Neurol 169: 347–370, 1976.[CrossRef][Web of Science][Medline]
Stocker M, Hirzel K, D'Hoedt D, Pedarzani P. Matching molecules to function: neuronal Ca2+-activated K+ channels and afterhyperpolarizations. Toxicon 43: 933–949, 2004.[Medline]
Storm JF. An after-hyperpolarization of medium duration in rat hippocampal pyramidal cells. J Physiol 409: 171–190, 1989.
Storm JF. Potassium currents in hippocampal pyramidal cells. Prog Brain Res 83: 161–187, 1990.[Web of Science][Medline]
Tice MAB, Hashemi T, Taylor LA, McQuade RD. Distribution of muscarinic receptor subtypes in rat brain from postnatal to old age. Dev Brain Res 92: 70–76, 1996.[Medline]
Wang Z, McCormick DA. Control of firing mode of corticotectal and corticopontine layer V burst-generating neurons by norepinephrine, acetylcholine, and 1S,3R-ACPD. J Neurosci 13: 2199–2216, 1993.[Abstract]
Whitford KL, Dijkhuizen P, Polleux F, Ghosh A. Molecular control of cortical dendrite development. Annu Rev Neurosci 25: 127–149, 2002.[CrossRef][Web of Science][Medline]
Witter MP, Naber PA, van Haeften T, Machielsen WCM, Rombouts SARB, Barkhof F, Scheltens P, Lopes da Silva FH. Cortico-hippocampal communication by way of parallel parahippocampal-subicular pathways. Hippocampus 10: 398–410, 2000.[CrossRef][Web of Science][Medline]
Yoshida M, Alonso A. Differential role of the M-current on the oscillatory and bursting behavior of principal cells from layers II, III and V of the entorhinal cortex. Soc Neurosci Abstr 971.5, 2005.
Yue C, Remy S, Su H, Beck H, Yaari Y. Proximal persistent Na+ channels drive spike afterdepolarizations and associated bursting in adult CA1 pyramidal cells. J Neurosci 25: 9704–9720, 2005.
Zahalka EA, Seidler FJ, Lappi SE, Yanai J, Slotkin TA. Differential development of cholinergic nerve terminal markers in rat brain regions: implications for nerve terminal density, impulse activity and specific gene expression. Brain Res 601: 221–229, 1993.[CrossRef][Web of Science][Medline]
Zhang Z-w. Maturation of layer V pyramidal neurons in the rat prefrontal cortex: intrinsic properties and synaptic function. J Neurophysiol 91: 1171–1182, 2004.
Zhou FM, Hablitz JJ. Postnatal development of membrane properties of layer I neurons in rat neocortex. J Neurosci 16: 1131–1139, 1996.
This article has been cited by other articles:
|
|
 |
|
  S. J. Bang and T. H. Brown Muscarinic Receptors in Perirhinal Cortex Control Trace Conditioning J. Neurosci., April 8, 2009; 29(14): 4346 - 4350. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Rheims, M. Minlebaev, A. Ivanov, A. Represa, R. Khazipov, G. L. Holmes, Y. Ben-Ari, and Y. Zilberter Excitatory GABA in Rodent Developing Neocortex In Vitro J Neurophysiol, August 1, 2008; 100(2): 609 - 619. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
